<?xml version="1.0"?>
<pathinfo pathogen-name="Rickettsia prowazekii" curators="Wattam" xmlns:src="http://xml.apache.org/xindice/Query" src:col="/db/piml" src:key="Rickettsia_prowazekii_Info">
	<!-- ********************************************************** -->
	<!--                    Organism information                    -->
	<!-- ********************************************************** -->
	<organism>
		<taxonomy>
			<species ontology="UMLS:C0035587" taxonID="prowazekii" genbank-taxon-id="782" refs="Website1">
				<common-name>
					<ref-info refs="Baxter">Epidemic typhus, louse-borne typhus, classic typhus, sylvatic typhus</ref-info>
				</common-name>
				<scientific-name>Rickettsia prowazekii</scientific-name>
				<description>
					<ref-info refs="Baxter">Rickettsia prowazekii is the etiologic agent of epidemic typhus, which occurs in two clinical forms: the primary febrile illness and recrudescent infection (Brill-Zinsser disease).  Epidemic typhus is transmitted by the body louse (Pediculus humanus corporis) and typically occurs during cold-weather months.  Epidemic typhus is also known as louse-borne typhus, classic typhus, and sylvatic typhus.</ref-info>
				</description>
				<variant taxonID="Madrid" genbank-taxon-id="272947" parent="prowazekii" refs="Website15">
					<scientific-name>
						<ref-info refs="Website15">Rickettsia prowazekii str. Madrid E</ref-info>
					</scientific-name>
					<description>
						<ref-info refs="Ge">Madrid E is an attenuated strain of R. prowazekii.</ref-info>
					</description>
				</variant>
			</species>
		</taxonomy>
		<lifecycle>
			<stage name="Rickettsia prowazekii vegetative state" stageID="a-stageID">
				<size>
					<ref-info refs="Walker">0.2 to 0.3 by 1um</ref-info>
				</size>
				<shape>
					<ref-info refs="Walker">Intracellular rickettsia appeared as paired, lanceolate-to-ovoid bacilli.</ref-info>
				</shape>
				<picture refs="Website10" name="">
					<URL>http://staff.vbi.vt.edu/pathport/pathinfo_images/Rickettsia_prowazekii/rick2-an.jpg</URL>
					<description>
						<ref-info refs="Website10">Following the release from the phagosomes, rickettsia grow free in the cytoplasm of cultured cells, dividing by binary fission (seen at arrows).  Inset highlights the outer and inner membranes of rickettsia.</ref-info>
					</description>
				</picture>
				<description>
					<ref-info refs="Raoult">Rickettsia prowazekii is a rickettsia-an obligate intracellular bacterium that is transmitted by an arthropod-vectored by the human body louse (Pediculus humanus subspecies P. corporis).  The organisms are small (0.3-1.0 um) coccobacilli that have a typical gram-negative cell envelope in ultrastructural studies and also contain peptidoglycan and lipopolysaccharides.  They are poorly stained by the Gram method and are better visualized using the Gimenez or Giemsa stains.  Within the outer membrane are also found immunodominant surface-exposed proteins of the Sca family, which may provide structure or potentially contribute to host cell adhesion or other host cell interactions.</ref-info>
				</description>
				<other name="">
					<ref-info />
				</other>
			</stage>
			<description>
				<ref-info refs="Baxter">The life cycle of epidemic typhus is believed to be initiated by a human case of primary epidemic typhus or by a case of recrudescent typhus, when the body louse feeds on an infected person.  In the louse, the organism reproduces in the alimentary tract, yielding a large number of rickettsial organisms in its feces.  The louse defecates while taking a blood meal, and the host then scratches the site, contaminating the bite wound with louse feces.  Close personal or clothing contact is usually required to transmit lice from person to person.  Infected lice usually die within 1 to 3 weeks from obstruction of the alimentary tract and do not transmit the organism to their offspring.</ref-info>
			</description>
		</lifecycle>
		<genome-summary taxon="prowazekii">
			<description>
				<ref-info refs="Andersson">The 1.1-Mb genome sequence of the aetiological agent of epidemic typhus, R. prowazekii, was published in 1998. One of the most controversial aspects of this genome sequence was its low coding content. Many scientists found it hard to accept that as much as 24% of this extremely small genome would be nothing but junk DNA. In total, only 834 protein coding genes were identified and these were sorted into their functional categories to provide a description of the R. prowazekii metabolism.</ref-info>
			</description>
			<genome-component name="Rickettsia prowazekii strain Madrid E" type="chromosome" genbank-access-number="NC_000963" refs="Website6">
				<picture refs="Website11" name="Rickettsia prowazekii strain Madrid E, complete genome ">
					<URL>http://staff.vbi.vt.edu/pathport/pathinfo_images/Rickettsia_prowazekii/RickettsiaProwazekiiMadridE_genome.jpg</URL>
				</picture>
				<size>
					<ref-info refs="Website6">1111523 bp</ref-info>
				</size>
				<gene-count>
					<ref-info refs="AnderssonB">834 protein-coding genes</ref-info>
				</gene-count>
				<description>
					<ref-info refs="AnderssonB">The complete genome sequence (1,111,523 base pairs) of the obligate intracellular parasite Rickettsia prowazekii, the causative agent of epidemic typhus is described. This genome contains 834 protein-coding genes. The functional profiles of these genes show similarities to those of mitochondrial genes: no genes required for anaerobic glycolysis are found in either R. prowazekii or mitochondrial genomes, but a complete set of genes encoding components of the tricarboxylic acid cycle and the respiratory-chain complex is found in R. prowazekii. In effect, ATP production in Rickettsia is the same as that in mitochondria. Many genes involved in the biosynthesis and regulation of biosynthesis of amino acids and nucleosides in free-living bacteria are absent from R. prowazekii and mitochondria. Such genes seem to have been replaced by homologues in the nuclear (host) genome. The R. prowazekii genome contains the highest proportion of non-coding DNA (24%) detected so far in a microbial genome. Such non-coding sequences may be degraded remnants of &apos;neutralized&apos; genes that await elimination from the genome. Phylogenetic analyses indicate that R. prowazekii is more closely related to mitochondria than is any other microbe studied so far.</ref-info>
				</description>
			</genome-component>
		</genome-summary>
	</organism>
	<!-- ********************************************************** -->
	<!--                   Epidemiology information                 -->
	<!-- ********************************************************** -->
	<epidemiology>
		<outbreak>
			<ref-info refs="Raoult">Between 1981 and 1997, epidemic typhus was predominantly thought of as a sporadic disease.  However, in the last 25 years, intermittent outbreaks have occurred in Africa (Ethiopia, Nigeria, Burundi), Mexico, Central America, South America, Eastern Europe, Afghanistan, India, and China.  There is a general lack of awareness that between 1993 and 1997, louse-borne typhus and &apos;sutama&apos; (the abdominal pain manifestation of the disease) occurred in more than 45,000 Burundian patients with a case fatality rate of 15%, underscoring the woeful reporting and inattention of the western world.  Thus it is highly likely that the prevalence and mortality of this important infection is significantly underestimated. </ref-info>
		</outbreak>
		<transmission transmissionID="Human-to-Louse">
			<from host="humans">
				<ref-info refs="Fang">Rickettsia prowazekii is the causative agent of epidemic typhus, a severe reemerging disease.  It is transmitted to humans by the body louse, Pediculus hominis corporis, and has the most serious epidemic potential among all rickettsiae.</ref-info>
				<ref-info refs="Andersson"> Man is the main host and seems also to be the natural reservoir for R. prowazekii.</ref-info>
			</from>
			<to host="lice">
				<ref-info refs="Andersson">The disease is transmitted among humans by the body louse, Pediculus humanus corporis. The lice are strict blood-sucking insects, depositing their infected feces near the bite lesion. The lice have a tendency to desert febrile hosts to seek new healthy individuals, which effectively spreads the disease in human populations. However, the louse also suffers from the rickettsial infection, and depending on the amount of bacteria in the gut, the louse may be killed within 12 weeks.</ref-info>
				<ref-info refs="Robinson">In 1909, Charles Nicolle infected a chimpanzee with R. prowazekii, and then placed body lice onto it. After the lice had fed, he transferred them to another chimpanzee, which subsequently developed typhus. Subsequent similar experiments with head lice gave the same result. Goldberger and Anderson took hair that contained head lice from patients who were admitted to hospital with LBET, and used these lice to infect rhesus monkeys with R. prowazekii. Their findings were later confirmed by Murray and Torrey in 1975, who infected head lice with R. prowazekii by feeding these lice on a rabbit that was infected with R. prowazekii. Murray and Torrey, using labeled antibodies to R. prowazekii, found that from the sixth day after exposure, head lice passed infective rickettsiae in their feces. No other experiments have been reported to contradict these results. </ref-info>
			</to>
			<destination host="lice">
				<ref-info refs="Roux">Louse infestation always occurs in a blood meal, and the louse remains infected all its life.</ref-info>
			</destination>
			<mechanism>
				<ref-info refs="Roux">Louse infestation always occurs in a blood meal, and the louse remains infected all its life, developing into an efficient epidemiological witness. The arthropod location, the effect of the location on louse survival, and microorganism transmission depend on the microorganism. After ingestion, R. prowazekii invades the midgut epithelium cells of the insect, in which they replicate, and a large number of infective organisms are released back into the gut. The organisms are then excreted with louse fecal matter and are thus transmitted to humans when a skin wound is scratched or scraped.  The louse will then die as a result of the R. prowazekii infection.</ref-info>
			</mechanism>
		</transmission>
		<transmission transmissionID="Louse-to-Human">
			<from host="lice">
				<ref-info refs="Andersson">The disease is transmitted among humans by the body louse, Pediculus humanus corporis. The lice are strict blood-sucking insects, depositing their infected feces near the bite lesion. The lice have a tendency to desert febrile hosts to seek new healthy individuals, which effectively spreads the disease in human populations. However, the louse also suffers from the rickettsial infection, and depending on the amount of bacteria in the gut, the louse may be killed within 12 weeks.</ref-info>
			</from>
			<to host="human">
				<ref-info refs="Fang">Rickettsia prowazekii is the causative agent of epidemic typhus, a severe reemerging disease.  It is transmitted to humans by the body louse, Pediculus hominis corporis, and has the most serious epidemic potential among all rickettsiae.</ref-info>
				<ref-info refs="Andersson"> Man is the main host and seems also to be the natural reservoir for R. prowazekii.</ref-info>
			</to>
			<destination host="human">
				<ref-info refs="Roux"> After ingestion, R. prowazekii invades the midgut epithelium cells of the insect, in which they replicate, and a large number of infective organisms are released back into the gut. The organisms are then excreted with louse fecal matter and are thus transmitted to humans when a skin wound is scratched or scraped.</ref-info>
			</destination>
			<mechanism>
				<ref-info refs="Azad">Outbreaks of epidemic typhus can result from rapid transmission of R. prowazekii from human to human by infected lice.</ref-info>
				<ref-info refs="Reynolds ">Inhalation and transdermal or mucous membrane inoculation of infected louse feces are well-established routes of pathogen transmission during epidemics of human louse-borne typhus.</ref-info>
			</mechanism>
		</transmission>
		<transmission transmissionID="Neohaematopinus-to-Human">
			<from host="lice">
				<ref-info refs="AzadB">15 strains of R. prowazekii have been isolated, 10 from flying squirrels and the remainder from their ectoparasites (3 from lice and 2 from fleas).  This rickettsial infection appears to be transmitted among the flying squirrel populations by their ectoparasites, primarily by squirrel lice, Neohaematopinus sciuropteri.  The squirrel flea, Orchopeas howardii, is also implicated in the transmission cycle, but to a lesser degree.</ref-info>
			</from>
			<to host="human">
				<ref-info refs="Azad">Flying squirrel ectoparasites (lice and fleas) were implicated in the transmission of R. prowazekii between the squirrels and from squirrels to humans.</ref-info>
			</to>
			<destination host="human">
				<ref-info refs="Roux"> After ingestion, R. prowazekii invades the midgut epithelium cells of the insect, in which they replicate, and a large number of infective organisms are released back into the gut. The organisms are then excreted with louse fecal matter and are thus transmitted to humans when a skin wound is scratched or scraped.</ref-info>
			</destination>
			<mechanism>
				<ref-info refs="Reynolds">Inhalation and transdermal or mucous membrane inoculation of infected louse feces are well-established routes of pathogen transmission during epidemics of human louse-borne typhus.  The mechanism by which R. prowazekii is transmitted from flying squirrels to humans is less well understood.  Various routes have been hypothesized, but none have been empirically established.  Plausible mechanisms include inhalation or direct introduction (through mucous membrane or dermal abrasion) of infected feces from louse or flea ectoparasites of flying squirrels or through the bite of infected flea ectoparasites of flying squirrels.</ref-info>
			</mechanism>
		</transmission>
		<transmission transmissionID="Orchopeas-to-Human">
			<from host="Orchopeas">
				<ref-info refs="AzadB">15 strains of R. prowazekii have been isolated, 10 from flying squirrels and the remainder from their ectoparasites (3 from lice and 2 from fleas).  This rickettsial infection appears to be transmitted among the flying squirrel populations by their ectoparasites, primarily by squirrel lice, Neohaematopinus sciuropteri.  The squirrel flea, Orchopeas howardii, is also implicated in the transmission cycle, but to a lesser degree.</ref-info>
			</from>
			<to host="human">
				<ref-info refs="Azad">Flying squirrel ectoparasites (lice and fleas) were implicated in the transmission of R. prowazekii between the squirrels and from squirrels to humans.</ref-info>
			</to>
			<destination host="human">
				<ref-info refs="Roux"> After ingestion, R. prowazekii invades the midgut epithelium cells of the insect, in which they replicate, and a large number of infective organisms are released back into the gut. The organisms are then excreted with louse fecal matter and are thus transmitted to humans when a skin wound is scratched or scraped.</ref-info>
			</destination>
			<mechanism ontology="UMLS:C0205535, C0694643">
				<ref-info refs="Reynolds">Inhalation and transdermal or mucous membrane inoculation of infected louse feces are well-established routes of pathogen transmission during epidemics of human louse-borne typhus.  The mechanism by which R. prowazekii is transmitted from flying squirrels to humans is less well understood.  Various routes have been hypothesized, but none have been empirically established.  Plausible mechanisms include inhalation or direct introduction (through mucous membrane or dermal abrasion) of infected feces from louse or flea ectoparasites of flying squirrels or through the bite of infected flea ectoparasites of flying squirrels.  At least one species of flea ectoparasite (Orchopeas howardii) of flying squirrels is known to opportunistically bite humans and could serve as a bridge vector for transmission from flying squirrel to human.</ref-info>
			</mechanism>
		</transmission>
		<intentional-release>
			<description>
				<ref-info refs="AzadC">R. prowazekii was transformed into a battlefield weapon by the Red Army, and the Japanese Army successfully tested biobombs, containing R. prowazekii.  So the precedent exists for using R. prowazekii as an agent of terror.</ref-info>
			</description>
			<emergency-contact>
				<ref-info />
			</emergency-contact>
			<delivery-mechanism ontology="UMLS:C0205535">
				<ref-info refs="Raoult">Dust containing infected louse excrement may transmit the organism by inhalation, an observation that lead to weaponization of R. prowazekii by the USSR in the 1930&apos;s and has raised recent fears of its use in bioterrorism.</ref-info>
			</delivery-mechanism>
			<containment>
				<ref-info refs="Website12">Biosafety Level 2 practices and facilities are recommended for nonpropagative laboratory procedures, including serological and fluorescent antibody procedures, and for the staining of impression smears. Biosafety Level 3 practices and facilities are recommended for all other manipulations of known or potentially infectious materials, including necropsy of experimentally infected animals and trituration of their tissues, and inoculation, incubation, and harvesting of embryonate eggs or cell cultures. Animal Biosafety Level 2 practices and facilities are recommended for the holding of experimentally infected mammals other than arthropods. Level 3 practices and facilities are recommended for animal studies with arthropods naturally or experimentally infected with rickettsial agents of human disease.</ref-info>
			</containment>
		</intentional-release>
	</epidemiology>
	<!-- ********************************************************** -->
	<!--                    Host interaction                        -->
	<!-- ********************************************************** -->
	<host hostID="humans" name="Human" ontology="UMLS:C0086418">
		<taxonomy>
			<species ontology="UMLS:C0086418" taxonID="human" genbank-taxon-id="9606" refs="Website2">
				<common-name>Human</common-name>
				<scientific-name>Homo sapiens</scientific-name>
				<description>
					<ref-info refs="Fang">Rickettsia prowazekii is the causative agent of epidemic typhus, a severe reemerging disease.  It is transmitted to humans by the body louse, Pediculus hominis corporis, and has the most serious epidemic potential among all rickettsiae.</ref-info>
					<ref-info refs="Andersson">Man is the main host and seems also to be the natural reservoir for R. prowazekii.</ref-info>
				</description>
			</species>
		</taxonomy>
		<infection>
			<infectious-dose>
				<ref-info refs="AzadC">The minimum infectious dose is less than 10 organisms.</ref-info>
			</infectious-dose>
			<picture refs="Website13" name="Rickettsia prowazekii">
				<URL>http://staff.vbi.vt.edu/pathport/pathinfo_images/Rickettsia_prowazekii/rick-an.jpg</URL>
				<description>
					<ref-info refs="Website13">Attachment of Rickettsia to the surface of an endothelial cell is followed by their entry into the cell via rickettsia-induced phagocytosis.  Following phagocytosis, the phagosome membrane (arrow) is lost and the rickettsia escape into the host cell cytoplasm.  Bar = 5 um.</ref-info>
				</description>
			</picture>
			<description>
				<ref-info refs="Roux"> After ingestion, R. prowazekii invades the midgut epithelium cells of the insect, in which they replicate, and a large number of infective organisms are released back into the gut. The organisms are then excreted with louse fecal matter and are thus transmitted to humans when a skin wound is scratched or scraped.</ref-info>
			</description>
		</infection>
		<prevention type="vaccination" ontology="UMLS:C0042210" name="Vaccine">
			<description>
				<ref-info refs="Gross">Production of very large doses of vaccine, which was very complicated and dangerous for laboratory technicians, presented tremendous difficulties.  The problem was finally solved by Dr. H R Cox of the United States in 1938, who found that typhus Rickettsias will grow without difficulty in embyonated chicken eggs.  This method made it possible to produce very large quantities of live Rickettsias.  They can then be killed by the addition of one-half percent solution of phenol, to produce a sufficient vaccine against typhus.  Large quantities of vaccine could thus be prepared and used.  An attenuated, live Rickettsia prowazekii vaccine against epidemic typhus is now also available, although infrequently used.</ref-info>
			</description>
			<complication ontology="UMLS:C0542243">
				<ref-info refs="AzadC">Successful vaccination against R. prowazekii has been partially achieved with inoculation of inactivated rickettsiae or attenuated strains (Madrid E).  Unfortunately, these vaccine approaches have been accompanied with undesirable toxic reactions and difficulties in standardization.</ref-info>
			</complication>
		</prevention>
		<prevention type="other" ontology="UMLS:C0031249" name="Vector Control">
			<description>
				<ref-info refs="Raoult">An important consideration in outbreaks is the early eradication of louse vectors using an insecticide.  Delousing of clothing and bedding is also beneficial.</ref-info>
			</description>
			<efficacy>
				<duration>
					<ref-info refs="RaoultB">The general applicability of insecticides to the immediate control of epidemic typhus was established during the first N&apos;Gozi jail outbreak in 1996, and a standard treatment protocol with 1% permethrin has been produced by WHO. Because treatment should be repeated every 6 weeks, a total of 35 tonnes of powder are required to treat 100,000 people on one occasion.  One year&apos;s supply is therefore ten times this figure. In practice, over-reliance on insecticides may be foolhardy.  The severe limitations imposed by the war on Burundi&apos;s distribution and communication infrastructures prevented the widespread availability of such quantities of insecticides until July 1997, 6 months after the scale of the outbreak was first recognized. The transient nature of the camps&apos; populations also presented logistical difficulties, since several delousing stations were required to ensure treatment was continued every 6 weeks.</ref-info>
				</duration>
			</efficacy>
		</prevention>
		<disease ontology="UMLS:C0041473" medical-name="Epidemic Typhus" common-name="">
			<pathogenesis>
				<description>
					<ref-info refs="Baxter">R. prowazekii is a coccobacillary obligate intracellular organism that reproduces by binary fission and is closely related antigenically to R. typhi (the agent of murine typhus).  After local infection at the site of the louse bite, the organism infects the endothelial cells of capillaries and small blood vessels, producing a vasculitis.  Platelet and fibrin deposition results in occlusion of vessels.  Tissue biopsy reveals perivascular infiltration with lymphocytes, plasma cells, polymorphonuclear leukocytes, and histiocytes, with or without necrosis of the vessel.  Giemsa or Gimenez staining is useful for identifying the organism in the cytoplasm of cells.  The vasculitis is most prominent in the skin, heart, central nervous system, skeletal muscle, and kidneys.  Gangrene of the skin can occur if local thrombosis is severe.</ref-info>
				</description>
			</pathogenesis>
			<incubation>
				<ref-info refs="Raoult">The clinical onset of epidemic typhus is usually abrupt after an incubation period of about 14 days.</ref-info>
			</incubation>
			<prognosis>
				<ref-info refs="Andersson">The disease is fatal in 10-30% of cases.</ref-info>
				<ref-info refs="Raoult">  The case fatality rate in outbreaks is estimated to range between 4% in the antibiotic era to up to 60% before antibiotics were available.</ref-info>
				<ref-info refs="Baxter">In uncomplicated epidemic typhus, fever usually resolves after 2 weeks of illness if untreated, but recovery of strength usually takes 2 to 3 months.  Mortality is quite variable, with the highest rates among those over 60 years of age.  With the use of appropriate antibiotics, fever resolves within 72 hours of the initiation of therapy.</ref-info>
			</prognosis>
			<symptomology>
				<syndrome ontology="UMLS:UMLS:C0006181" name="Brill-Zinsser disease" refs="Baxter">
					<description>
						<ref-info refs="Baxter">Brill-Zinsser disease occurs as recrudescence of previous infection with R. prowazekii.  In the United States, it occurs primarily in immigrants from Eastern Europe who acquired epidemic typhus during World War II.  It is believed that stress or a waning immune system may reactivate earlier infection.  The clinical symptoms are usually milder than primary epidemic typhus and more closely resemble those of murine typhus.  Patients with Brill-Zinsser disease lack specific IgM antibody and have elevated IgG antibody to R. prowazekii.  Treatment is identical to that of primary epidemic typhus.</ref-info>
					</description>
					<observed>
						<ref-info refs="Stein">A few cases of this form of typhus are encountered each year in Eastern Europe and Russia, and less than ten cases of Brill-Zinsser disease have been describe in Western Europe and the USA since World War II.</ref-info>
					</observed>
				</syndrome>
				<syndrome ontology="UMLS:C0041473" name="Epidemic Typhus">
					<description>
						<ref-info refs="Baxter">Patients with epidemic typhus typically have a 1 to 3 days of malaise before abrupt onset of severe headache, fevers, chills, and myalgia.</ref-info>
					</description>
					<observed>
						<ref-info refs="Raoult">Although relegated by many to historical anecdotes, epidemic typhus still afflicts tens of thousands of individuals in post modern outbreaks, with mortality exceeding 10% To 15%.</ref-info>
					</observed>
					<symptom ontology="UMLS:C0041473" name="Epidemic Typhus">
						<description>
							<ref-info refs="Raoult">Early clinical manifestations include fever and severe headache, although recent observations suggest that abdominal pain is also frequent.  Other manifestations occur variably and include chills, rash, myalgias, and arthralgias; central nervous system involvement often included delirium, coma, and seizures.  Pulmonary manifestations can be rickettsial interstitial infection that leads to vascular leakage and noncardiogenic pulmonary edema or secondary infections of the airway.  A nonproductive cough is observed in 38% to 70% of patients, and the frequent detection of infiltrates on chest radiographs underscores the prevalence of primary pulmonary involvement and secondary bacterial pneumonia.</ref-info>
						</description>
						<observed>
							<ref-info refs="Raoult">Although relegated by many to historical anecdotes, epidemic typhus still afflicts tens of thousands of individuals in post modern outbreaks, with mortality exceeding 10% to 15%.</ref-info>
						</observed>
					</symptom>
				</syndrome>
				<symptom ontology="UMLS:C0015967" name="Fever" refs="Raoult">
					<description>
						<ref-info refs="Baxter">in a review of 60 patients with epidemic typhus in Ethiopia, all patients were reported to have complained of severe headache and fever.</ref-info>
					</description>
					<observed>
						<ref-info refs="Raoult">100%</ref-info>
					</observed>
				</symptom>
				<symptom ontology="UMLS:C0031256, C0423791" name="Rash" refs="Raoult">
					<description>
						<ref-info refs="Baxter">A petechial rash was described in 33% of patients, and 5% had a macular erythematous rash.  The rash was most evident on the trunk but could also be seen on the extremities.  In a few patients, petechiae was also found on the conjuctivial and soft palate.  Typically, the rash of epidemic typhus begins in the axillary folds and the upper trunk on about the fifth day of illness and spreads to the extremities.  The rash initially appears as nonconfluent erythematous macules that blanch on pressure.  After several days, the rash becomes maculopapular and petechial, affecting the trunk and extremities and sparing the face, palms, and soles.</ref-info>
					</description>
					<observed>
						<ref-info refs="Raoult">30%</ref-info>
					</observed>
				</symptom>
				<symptom ontology="UMLS:C0018681" name="Headache" refs="Raoult">
					<description>
						<ref-info refs="Baxter">In a review of 60 patients with epidemic typhus in Ethiopia, all patients were reported to have complained of severe headache and fever.</ref-info>
						<ref-info refs="Baxter">Headache usually resolves after 7 days of treatment.</ref-info>
					</description>
					<observed>
						<ref-info refs="Raoult">100%</ref-info>
					</observed>
				</symptom>
				<symptom ontology="UMLS:C0231528" name="Myalgia" refs="Raoult">
					<observed>
						<ref-info refs="Raoult">70%</ref-info>
					</observed>
				</symptom>
				<symptom ontology="UMLS:C0027497, C0042963" name="Nausea or vomiting" refs="Raoult">
					<observed>
						<ref-info refs="Raoult">48%</ref-info>
					</observed>
				</symptom>
				<symptom ontology="UMLS:C0000737" name="Abdominal pain" refs="Raoult">
					<observed>
						<ref-info refs="Raoult">74%</ref-info>
					</observed>
				</symptom>
				<symptom ontology="UMLS:C0009763" name="Conjunctivitis" refs="Raoult">
					<observed>
						<ref-info refs="Raoult">29%</ref-info>
					</observed>
				</symptom>
				<symptom name="Pneumonitis" refs="Raoult">
					<observed>
						<ref-info refs="Raoult">8%</ref-info>
					</observed>
				</symptom>
				<symptom ontology="UMLS:C0085636, C0040264, C0025287, C0547030, C0036572, C0011206, C0085628, C0009421" name="Any severe neurological complication" refs="Raoult">
					<description>
						<ref-info refs="Raoult">Severe neurologic complications include photophobia, tinnitus, meningismus, visual disturbances, seizure, delirium, stupor, and coma.</ref-info>
					</description>
					<observed>
						<ref-info refs="Raoult">58%</ref-info>
					</observed>
				</symptom>
				<symptom ontology="UMLS:C0010200" name="Cough" refs="Raoult">
					<observed>
						<ref-info refs="Raoult">A nonproductive cough is observed in 38% to 70% of patients (Raoult et al., 2004).</ref-info>
					</observed>
				</symptom>
				<symptom ontology="UMLS:C0017086" name="Gangrene" refs="Baxter">
					<description>
						<ref-info refs="Baxter">The most serious complications of typhus include gangrene and cerebral thrombosis secondary to vasculitis.  When it occurs, gangrene is usually symmetric, affecting the distal fingers and toes.  Treatment is usually nonsurgical in these cases; however, extensive gangrene of an extremity may require surgical amputation.</ref-info>
					</description>
				</symptom>
				<symptom ontology="UMLS:C0079102" name="Cerebral thrombosis" refs="Baxter">
					<description>
						<ref-info refs="Baxter">The most serious complications of typhus include gangrene and cerebral thrombosis secondary to vasculitis.</ref-info>
						<ref-info refs="Baxter">Neurologic deficits due to cerebral thrombosis usually take 2 to 4 weeks to resolve, and residual deficits are uncommon.</ref-info>
					</description>
				</symptom>
			</symptomology>
			<treatment ontology="UMLS:C0338237" name="Antibiotic Therapy">
				<applicable>
					<ref-info refs="RaoultC">The conventional antibiotic treatment for the typhus group rickettsioses is a 7- to 15-day course of doxycycline (200 mg/day) or chloramphenicols (2g/day) given orally.</ref-info>
				</applicable>
				<description>
					<ref-info refs="Baxter">Tetracyclines and chloramphenicol are highly effective in the treatment of epidemic typhus.  Because of a long half-life, doxycycline has been shown to be effective against epidemic typhus when administered as a a single oral dose, however, the standard recommended treatment is doxycycline 200 mg per day for 5 days.  If the patient is too ill to take drugs orally, tetracycline, doxycycline, or chloramphenicol can be administered intravenously.  Because antibiotic therapy does not eradicate rickettsia in lice-infested patients, delousing is essential in the management of typhus outbreak.  If appropriate treatment is begun promptly, complications, including mortality, can be avoided in most cases.</ref-info>
					<ref-info refs="Huys">Doxycycline is a very active compound in the treatment of classic epidemic typhus at an oral dosage of only 200 mg in a single administration.  With such a dosage, side effects are very unlikely and the cost of a complete treatment is minimal.  This is a particularly important factor when a large population has to be treated.  In addition, one can assure that the drug is actually taken by personally administering the two capsules to the patient.</ref-info>
				</description>
				<contraindicator ontology="">
					<ref-info refs="Turcinov">Tetracycline and chloramphenicol are effective antibiotics against R. prowazekii infection but not suitable for children and pregnant women.</ref-info>
				</contraindicator>
				<success-rate>
					<ref-info refs="Niang">The death rate of untreated epidemic typhus is approximately 15%; this rate is reduced to 0.5% with a single 200 mg dose of doxycycline.</ref-info>
				</success-rate>
			</treatment>
		</disease>
		<model-system ontology="UMLS:C0024399" name="Macaca fascicularis, Cynomolgus monkeys">
			<model-host>
				<ref-info refs="Gonder">Macaca fascicularis</ref-info>
			</model-host>
			<model-pathogen taxon="prowazekii">
				<ref-info refs="Gonder">Rickettsia prowazekii</ref-info>
			</model-pathogen>
			<description>
				<ref-info refs="Gonder">A nonhuman primate model of clinical Rickettsia prowazekii infections was developed in cynomolgus monkeys (Macaca fascicularis). Monkeys infected intravenously with 10(7) plaque-forming units developed clinical signs of illness and pathological changes characteristic of epidemic typhus infection in humans. Increases in total leukocyte counts, serum alkaline phosphatase, blood urea nitrogen, and serum glutamic pyruvate transaminase values were observed. Microscopic examination revealed typical typhus nodules in the brains of two monkeys that died. These data indicated that the cynomolgus monkey is a suitable model for study of the pathogenesis of epidemic typhus infection and may prove valuable in the evaluation of candidate R. prowazekii vaccines.</ref-info>
			</description>
		</model-system>
		<model-system ontology="UMLS: C0324547" name="Rabbit">
			<model-host>
				<ref-info refs="Houhamdi">New Zealand white rabbit</ref-info>
			</model-host>
			<model-pathogen taxon="prowazekii">
				<ref-info refs="Houhamdi">Rickettsia prowazekii</ref-info>
			</model-pathogen>
			<description>
				<ref-info refs="Houhamdi">Eight hundred human lice were infected by feeding on a rabbit that was made bacteremic by injecting 2x10(6) plaque-forming units of R. prowazekii.</ref-info>
			</description>
		</model-system>
		<model-system ontology="UMLS:C0999699" name="Cavia porcellus, Guinea pig">
			<model-host>
				<ref-info refs="Popov">Guinea pig</ref-info>
			</model-host>
			<model-pathogen taxon="prowazekii">
				<ref-info refs="Popov">Rickettsia prowazekii</ref-info>
			</model-pathogen>
			<description>
				<ref-info refs="Popov">Alike to macrophages from intact animals, reproduction, destruction and formation of spheroplast-like forms were observed in macrophages from immune guinea pigs 2 months post-infection (p.i.) with the virulent Breinl strain of Rickettsia prowazekii.</ref-info>
			</description>
		</model-system>
	</host>
	<host hostID="lice" name="Lice">
		<taxonomy>
			<species ontology="UMLS:C0322630" taxonID="body-louse" genbank-taxon-id="121224" refs="Website3">
				<common-name>
					<ref-info refs="Website3">Human body louse</ref-info>
				</common-name>
				<scientific-name>
					<ref-info refs="Website3">Pediculus humanus corporis, Pediculus humanus humanus</ref-info>
				</scientific-name>
				<description>
					<ref-info refs="Andersson">The disease is transmitted among humans by the body louse, Pediculus humanus corporis. The lice are strict blood-sucking insects, depositing their infected feces near the bite lesion. The lice have a tendency to desert febrile hosts to seek new healthy individuals, which effectively spreads the disease in human populations. However, the louse also suffers from the rickettsial infection, and depending on the amount of bacteria in the gut, the louse may be killed within 12 weeks.</ref-info>
				</description>
			</species>
			<species ontology="UMLS:C0411280" taxonID="head-lice" genbank-taxon-id="121226" refs="Website4">
				<common-name>
					<ref-info refs="Website4">Human head louse</ref-info>
				</common-name>
				<scientific-name>
					<ref-info refs="Website4">Pediculus humanus capitis, Pediculus capitis</ref-info>
				</scientific-name>
				<description>
					<ref-info refs="Robinson">In 1909, Charles Nicolle infected a chimpanzee with R. prowazekii, and then placed body lice onto it. After the lice had fed, he transferred them to another chimpanzee, which subsequently developed typhus. Subsequent similar experiments with head lice gave the same result. Goldberger and Anderson  took hair that contained head lice from patients who were admitted to hospital with LBET, and used these lice to infect rhesus monkeys with R. prowazekii. Their findings were later confirmed by Murray and Torrey in 1975, who infected head lice with R. prowazekii by feeding these lice on a rabbit that was infected with R. prowazekii. Murray and Torrey, using labeled antibodies to R. prowazekii, found that from the sixth day after exposure, head lice passed infective rickettsiae in their feces. No other experiments have been reported to contradict these results.</ref-info>
				</description>
			</species>
			<species ontology="UMLS:C1095632" taxonID="Orchopeas" genbank-taxon-id="160165" refs="Website8">
				<scientific-name>
					<ref-info refs="Website8">Neohaematopinus </ref-info>
				</scientific-name>
				<description>
					<ref-info refs="AzadB">15 strains of R. prowazekii have been isolated, 10 from flying squirrels and the remainder from their ectoparasites (3 from lice and 2 from fleas).  This rickettsial infection appears to be transmitted among the flying squirrel populations by their ectoparasites, primarily by squirrel lice, Neohaematopinus sciuropteri.  The squirrel flea, Orchopeas howardii, is also implicated in the transmission cycle, but to a lesser degree.</ref-info>
				</description>
			</species>
		</taxonomy>
	</host>
	<host hostID="Flea" name="Fleas">
		<taxonomy>
			<species ontology="UMLS:C1015900" taxonID="Squirrel_flea" genbank-taxon-id="51296" refs="Website9">
				<scientific-name>
					<ref-info refs="Website9">Orchopeas</ref-info>
				</scientific-name>
				<description>
					<ref-info refs="AzadB">15 strains of R. prowazekii have been isolated, 10 from flying squirrels and the remainder from their ectoparasites (3 from lice and 2 from fleas).  This rickettsial infection appears to be transmitted among the flying squirrel populations by their ectoparasites, primarily by squirrel lice, Neohaematopinus sciuropteri.  The squirrel flea, Orchopeas howardii, is also implicated in the transmission cycle, but to a lesser degree.</ref-info>
				</description>
			</species>
		</taxonomy>
	</host>
	<host hostID="Squirrel" name="Flying squirrels">
		<taxonomy>
			<species ontology="UMLS:C1024867" taxonID="Glaucomys_volans" genbank-taxon-id="64683" refs="Website5">
				<common-name>
					<ref-info refs="Website5">Southern flying squirrel</ref-info>
				</common-name>
				<scientific-name>
					<ref-info refs="Website5">Glaucomys volans</ref-info>
				</scientific-name>
				<description>
					<ref-info refs="Andersson">Man is the main host and seems also to be the natural reservoir for R. prowazekii. However, flying squirrels may be infected with R. prowazekii, suggesting that there is a human-independent natural cycle of epidemic typhus.</ref-info>
					<ref-info refs="Reynolds">Flying squirrels are the only known vertebrate reservoir of R. prowazekii, other than humans, and contact with these animals has been linked to most sporadic typhus cases in the United States. Interest in this disease was high in the 10 years after the first isolation of R. prowazekii from flying squirrels, but few cases have been reported since 1985.</ref-info>
				</description>
			</species>
		</taxonomy>
	</host>
	<!-- ********************************************************** -->
	<!--                   Labwork information                      -->
	<!-- ********************************************************** -->
	<labwork>
		<biosafety refs="Website12">
			<level>2 and 3</level>
			<precautions>
				<ref-info refs="Website12">Biosafety Level 2 practices and facilities are recommended for nonpropagative laboratory procedures, including serological and fluorescent antibody procedures, and for the staining of impression smears. Biosafety Level 3 practices and facilities are recommended for all other manipulations of known or potentially infectious materials, including necropsy of experimentally infected animals and trituration of their tissues, and inoculation, incubation, and harvesting of embryonate eggs or cell cultures. Animal Biosafety Level 2 practices and facilities are recommended for the holding of experimentally infected mammals other than arthropods. Level 3 practices and facilities are recommended for animal studies with arthropods naturally or experimentally infected with rickettsial agents of human disease.</ref-info>
			</precautions>
		</biosafety>
		<culturing name="Shell Vial Cell Culture Assay" refs="Vestris">
			<description>
				<ref-info refs="Vestris">Over the last 7 years (from November 1995 to May 2002) our laboratory has adapted a centrifugation-cell culture system, the shell vial assay, for isolation of bacteria.  This technique is used routinely in a biosafety level equipped laboratory for the isolation of rickettsiae and other strictly, or facultatively, intracellular bacteria from tissue biopsies, especially tick-bite eschars, and blood samples</ref-info>
				<ref-info refs="Vestris">We received 490 clinical samples (273 blood samples and 217 cutaneous biopsies) from patients suspected of having a rickettsial disease.  We have isolated and established by culture in shell vials 26 (5.3%) clinical isolates including 10 Rickettsia conorii, 9 R. africae, 1 R. slovaca, 4 R. mongolotimonae, 1 R. prowazekii, and a R. conorii new serotype.  Rickettsiae were isolated more frequently from cutaneous biopsies (20, 9.2%) than from blood (6, 2.2%) (significant difference: P less than 0.05).</ref-info>
			</description>
			<medium>
				<ref-info refs="Vestris">Eagle&apos;s minimal essential medium with 4% fetal calf serum and 2 mM L glutamine</ref-info>
			</medium>
			<note>
				<ref-info refs="Vestris">Detection of rickettsial organisms on the coverslip was carried out, while it remained inside the shell vial, by Gimenez staining and indirect immunofluorecence assay after 3, 6, and 14 days.  If immunofluorescence was positive, the culture was reported as positive and culture supernatants were sampled in order to identify the isolate by a specific PCR assay.  The remaining supernatants of positive shell vials as well as the  third shell vial were inoculated on confluent layers of HEL cells in 25 cm(2) culture flasks in order to propagate isolates</ref-info>
			</note>
		</culturing>
		<culturing name="Plaque Assay in Vero76 Cells" refs="Policastro">
			<description>
				<ref-info refs="Policastro">Typhus group rickettsiae, including Rickettsia prowazekii and R. typhi, produce visible plaques on primary chick embryo fibroblasts and low-passage mouse embryo fibroblasts but do not form reproducible plaques on continuous cell culture lines. We tested medium overlay modifications for plaque formation of typhus group rickettsiae on the continuous fibroblast cell line Vero76. A procedure involving primary overlay with medium at pH 6.8, which was followed 2 to 3 days later with secondary overlay at neutral pH containing 1 microgram of emetine per ml and 20 micrograms of NaF per ml, resulted in visible plaques at 7 to 10 days postinfection. A single-step procedure involving overlay with medium containing 50 ng of dextran sulfate per ml also resulted in plaque formation within 8 days postinfection. These assays represent reproducible and inexpensive methods for evaluating the infectious titers of typhus group rickettsiae, cloning single plaque isolates, and testing the susceptibilities of rickettsiae to antibiotics.</ref-info>
			</description>
		</culturing>
		<culturing name="R. prowazekii in Mouse L929 cells" refs="Turco">
			<description>
				<ref-info refs="Turco">L929 cells were harvested from monolayer cultures by incubation with 0.5% trypsin and 0.02% disodium EDTA in a salt solution.  After being washed, the cells were suspended in serum-supplemented medium (MS) at a concentration of 2 x 10(6) viable (trypan blue excluding) cells per ml.  Rickettsiae were diluted in Hanks balanced salt solution supplemented with 5 mM L-glutamic acid (monopotassium salt) and 0.1% gelatin (HBSSGG), and an equal volume of rickettsiae (approximately 2 x 10(8)/ ml) was added to each cell suspension.-</ref-info>
			</description>
			<medium>
				<ref-info refs="Turco">MS medium</ref-info>
			</medium>
			<optimal-temperature>
				<ref-info refs="Turco">34 C</ref-info>
			</optimal-temperature>
		</culturing>
		<diagnostic-tests>
			<organism-detection name="Gimenez or Giemsa stain for light microscopy" type="light-microscopy" ontology="UMLS:C0523206, C0017542, C0430389" time-to-perform="unknown">
				<description>
					<ref-info refs="Raoult">The organisms are small (0.3-1.0 um) coccobacilli that have a typical gram-negative cell envelope in ultrastructural studies and also contain peptidoglycan and lipopolysaccharides.  They are poorly stained by the Gram method and are better visualized using the Gimenez or Geimsa stains.</ref-info>
					<ref-info refs="Baxter">Giemsa or Gemenez staining is useful for identifying the organism in the cytoplasm of cells.</ref-info>
				</description>
			</organism-detection>
			<organism-detection name="Immunofluorescence microscopy" type="immunofluorescence-microscopy" ontology="UMLS:C0079603" time-to-perform="unknown">
				<description>
					<ref-info refs="Fang">In order to identify Rickettsia prowazekii in lice, we developed a panel of 29 representative monoclonal antibodies selected from 187 positive hybridomas made by fusing splenocytes of immunized mice with SP2/0-Ag14 myeloma cells. Immunoblotting revealed that 15 monoclonal antibodies reacted with the lipopolysaccharide-like (LPS-L) antigen and 14 reacted with the epitopes of a 120-kDa protein. Only typhus group rickettsiae reacted with the monoclonal antibodies against LPS-L. R. felis, a recently identified rickettsial species, did not react with these monoclonal antibodies, confirming that it is not antigenically related to the typhus group. Monoclonal antibodies against the 120-kDa protein were highly specific for R. prowazekii. We successfully applied a selected monoclonal antibody against the 120-kDa protein to detect by immunofluorescence assay R. prowazekii in smears from 56 wild and laboratory lice, as well as in 10 samples of louse feces infected or not infected with the organism. We have developed a simple, practical, and specific diagnostic assay for clinical specimens and large-scale epidemiological surveys with a sensitivity of 91%. These monoclonal antibodies could be added to the rickettsial diagnostic panel and be used to differentiate R. prowazekii from other rickettsial species</ref-info>
				</description>
				<false-negative>
					<ref-info refs="Fang">The negative predictive value of our test was 100%. </ref-info>
				</false-negative>
			</organism-detection>
			<organism-detection name="Immunofluorescence" type="immunofluorescence-microscopy" ontology="UMLS:C0079603" time-to-perform="unknown">
				<description>
					<ref-info refs="Niang">The diagnosis of epidemic typhus was established by demonstrating increasing antibody titers from the acute to the convalescent-phase of illness, with the presence of immunoglobulin (Ig) M to R. prowazekii (micro-immunofluorescence titer IgG less than 1:80 and IgM less than 80 to IgG 1:4,096 and IgM titer 1:256) in serum samples collected 6 days apart.</ref-info>
				</description>
			</organism-detection>
			<organism-detection name="Microimmunofluorescence test" type="immunofluorescence-microscopy" ontology="UMLS:C0079603" time-to-perform="unknown">
				<description>
					<ref-info refs="Philip">A microimmunofluorescence test was used to study antibody responses to various spotted fever group and typhus group rickettsiae during Rocky Mountain spotted fever (RMSF) and epidemic typhus (ET). Patients with RMSF reacted most strongly to Rickettsia rickettsii; those with ET reacted predominantly to R. prowazekii. The degree of cross-reaction to other rickettsial strains varied from patient to patient, but a particular pattern of cross-reaction was consistently observed in serial sera from the same patient.</ref-info>
				</description>
				<false-positive>
					<ref-info refs="Philip">Cross-reactions of varying degree sometimes occurred to antigens both within and between the spotted fever and typhus group.</ref-info>
				</false-positive>
			</organism-detection>
			<immunoassay name="Haemagglutination assay for endemic and epidemic typhus" type="latex-agglutination" ontology="UMLS:C0441688" time-to-perform="unknown">
				<description>
					<ref-info refs="Hechemy">A latex test for assay of antibodies to endemic and epidemic typhus rickettsiae is simple, group-specific, sensitive, and reproducible. Cross-reactivity within the typhus group was extensive.</ref-info>
					<ref-info refs="Hechemy">Endemic typhus infection cannot be serologically differentiated from epidemic typhus by latex or micro-IF procedures.</ref-info>
				</description>
			</immunoassay>
			<immunoassay name="Complement-fixation" type="complement-fixation" ontology="UMLS:C030191" time-to-perform="unknown">
				<description>
					<ref-info refs="Shephard">Sera from patients suspected of having rickettsial infections were tested in the complement fixation test with antigens prepared from the rickettsiae of Rocky Mountain spotted fever (SF), rickettsial pox (RP), murine typhus, epidemic typhus, and from Rickettsia canada (RC). Eight units of antigen were used in all cases and two units in man. Only those patients with antibody titers of 1:16 or higher were included in the study. Largely on the basis of comparative titers, the patients were divided into two groups: 102 with SF and 35 with infections by one of the members of the typhus group. The antibody titers were higher with SF antigen than RP antigen in 72% of the SF patients, and in only two SF patients was the RP titer higher, and then by only one tube (twofold dilution). There seemed little advantage in including the RP antigen in the battery of rickettsial antigens. Cross-reaction with at least one of the typhus antigens was observed in the sera from 64% of the SF patients. It was extensive enough to be confusing (within one tube) in 17% with eight units of antigen, but the differentiation was more distinct with two units of antigen. The cross-reaction with typhus antigens was as frequent in children with SF as it was in adults; thus, it is unlikely that these cross-reactions resulted from previous typhus vaccination. The serological differentiation between murine typhus and epidemic typhus was frequently difficult, but the epidemiological background was distinct. Five patients had higher titers to RC antigen, and four of these may possibly have had RC infections.</ref-info>
					<ref-info refs="LaScolaB">Antibody titers obtained by the CF test correlate better with IgG titers than with IgM titers obtained by immunofluorescence assay.  Results vary according to the method of antigen production and the amount of antigen used in the assay.  The use of 8U of antigen increases the sensitivity of detection of the early IgM response but also increases the numbers of cross-reactions between antibodies to typhus and SFG rickettsiae. </ref-info>
				</description>
			</immunoassay>
			<immunoassay name="Enzyme-linked immunosorbent assay" type="ELISA" ontology="UMLS:C0014441" time-to-perform="unknown">
				<description>
					<ref-info refs="LaScolaB">Enzyme-linked immunosorbent assay (ELISA) was first introduced for detection of antibodies against Rickettsia typhi and Rickettsia prowazekii.  The use of this technique is highly sensitive and reproducible, allowing the differentiation of IgG and IgM antibodies</ref-info>
				</description>
			</immunoassay>
			<immunoassay name="Western blotting" type="western-blotting" ontology="UMLS:C0005863" time-to-perform="unknown">
				<description>
					<ref-info refs="LaScola">Differentiation of murine typhus due to Rickettsia typhi and epidemic typhus due to Rickettsia prowazekii is critical epidemiologically but difficult serologically. Using serological, epidemiological, and clinical criteria, we selected sera from 264 patients with epidemic typhus and from 44 patients with murine typhus among the 29,188 tested sera in our bank. These sera cross-reacted extensively in indirect fluorescent antibody assays (IFAs) against R. typhi and R. prowazekii, as 42% of the sera from patients with epidemic typhus and 34% of the sera from patients with murine typhus exhibited immunoglobulin M (IgM) and/or IgG titers against the homologous antigen (R. prowazekii and R. typhi, respectively) that were more than one dilution higher than those against the heterologous antigen. Serum cross-adsorption studies and Western blotting were performed on sera from 12 selected patients, 5 with murine typhus, 5 with epidemic typhus, and 2 suffering from typhus of undetermined etiology. Differences in IFA titers against R. typhi and R. prowazekii allowed the identification of the etiological agent in 8 of 12 patients. Western blot studies enabled the identification of the etiological agent in six patients. When the results of IFA and Western blot studies were considered in combination, identification of the etiological agent was possible for 10 of 12 patients. Serum cross-adsorption studies enabled the differentiation of the etiological agent in all patients. Our study indicates that when used together, Western blotting and IFA are useful serological tools to differentiate between R. prowazekii and R. typhi exposures. While a cross-adsorption study is the definitive technique to differentiate between infections with these agents, it was necessary in only 2 of 12 cases (16.7%), and the high costs of such a study limit its use.</ref-info>
				</description>
				<false-positive>
					<ref-info refs="LaScola">When both IFA and Western blot results were considered, exposure to R. prowazekii or R. typhi was reliably determined for 10 of the 12 patients.</ref-info>
				</false-positive>
			</immunoassay>
			<immunoassay name="Immunoblotting" type="other" ontology="UMLS:C0020985" time-to-perform="unknown">
				<description>
					<ref-info refs="Fang">In order to identify Rickettsia prowazekii in lice, we developed a panel of 29 representative monoclonal antibodies selected from 187 positive hybridomas made by fusing splenocytes of immunized mice with SP2/0-Ag14 myeloma cells. Immunoblotting revealed that 15 monoclonal antibodies reacted with the lipopolysaccharide-like (LPS-L) antigen and 14 reacted with the epitopes of a 120-kDa protein. Only typhus group rickettsiae reacted with the monoclonal antibodies against LPS-L. R. felis, a recently identified rickettsial species, did not react with these monoclonal antibodies, confirming that it is not antigenically related to the typhus group. Monoclonal antibodies against the 120-kDa protein were highly specific for R. prowazekii. We successfully applied a selected monoclonal antibody against the 120-kDa protein to detect by immunofluorescence assay R. prowazekii in smears from 56 wild and laboratory lice, as well as in 10 samples of louse feces infected or not infected with the organism. We have developed a simple, practical, and specific diagnostic assay for clinical specimens and large-scale epidemiological surveys with a sensitivity of 91%. These monoclonal antibodies could be added to the rickettsial diagnostic panel and be used to differentiate R. prowazekii from other rickettsial species</ref-info>
				</description>
				<false-negative>
					<ref-info refs="Fang">9%</ref-info>
				</false-negative>
			</immunoassay>
			<immunoassay name="Weil-Felix test" type="other" ontology="UMLS:C1272857" time-to-perform="unknown">
				<description>
					<ref-info refs="LaScolaB">The Weil-Felix test is based on the detection of antibodies to various Proteus species which contain antigens with cross-reacting epitopes to antigens from members of the genus Rickettsia with the exception of R. akari.  Whole cells to Proteus vulgaris OX-2 react strongly with sera from persons infected with SFG rickettsia with the exception of those with RMSF, and whole cells of P. vulgaris OX-19 react with sera from persons infected with typhus group rickettsiae as well as with RMSF.</ref-info>
					<ref-info refs="LaScolaB">By the Weil-Felix test, agglutinating antibodies are detectable after 5 to 10 days following the onset of symptoms, with the antibodies detected being mainly of the immunoglobulin M (IgM) type.</ref-info>
					<ref-info refs="LaScolaB">The poor sensitivity and specificity of the Weil-Felix test are now well demonstrated for the diagnosis of RMSF, MSF, murine typhus, epidemic typhus, and scrub typhus.  Although a good correlation between the results of the Weil-Felix test and detection of IgM antibodies by an immunofluorescence assay is often observed, with the development of techniques that are used to grow rickettsiae, this test should be used only as a first line of testing in rudimentary hospital laboratories.</ref-info>
					<ref-info refs="WalkerB">In most hospitals the laboratory diagnosis of RMSF is synonymous with the archaic, nonspecific, insensitive Weil-Felix test.  Early in this century, the agglutination of certain strains of Proteus vulgaris by sera of patients convalescent from typhus fever was recognized.  This phenomenon depends on antigens shared by P. vulgaris OX-19 and OX-2 and R. prowazekii, R. typhi, R. rickettsii, R. conorii, R. sibirica, and R. australis.  Between 5 and 12 days after onset of symptoms, antibodies appear that agglutinate P. vulgaris OX-19 in 70% of patients and agglutinate P. vulgaris OX-2 in 47%.  In addition to this poor level of sensitivity, another drawback is lack of specificity.  Many healthy persons have agglutinating antibodies to P. vulgaris OX-19.  </ref-info>
				</description>
			</immunoassay>
			<nucleic-acid-detection>
				<PCR name="Real-time PCR" ontology="UMLS:C0032520" time-to-perform="unknown">
					<description>
						<ref-info refs="Jiang">Rickettsia prowazekii, the etiologic agent for epidemic typhus, and Borrelia recurrentis, the etiologic agent of relapsing fever, both utilize the same vector, the human body louse (Pediculus humanus), to transmit human disease. We have developed an assay to detect both bacterial pathogens in a single tube utilizing real-time PCR. Assays for both agents are specific. The R. prowazekii and B. recurrentis assays do not detect nucleic acid from R. typhi, R. canada, or any of eight spotted fever rickettsiae. In addition they did not react with Neorickettsia risticii, N. sennetsu, Franciscella persica, Bartonella quintana, Legionella pneumophila, Proteus mirabilis, Salmonella enterica, Escherichia coli, and Staphylococcus aureus. Moreover, the B. recurrentis assay did not detect B. duttonii, B. coriaceae, B. afzelii, B. garinii, B. hermsii, or B. burgdorferi nucleic acid. Both assays detected repeatedly only R. prowazekii or B. recurrentis either when tested alone or together in one test tube.</ref-info>
					</description>
					<primers name="Rp337F, Pr455R, Rp428MBP" refs="Jiang">
						<forward>
							<ref-info refs="Jiang">TCTTAACATAACAGGGCAGGGTAT</ref-info>
						</forward>
						<reverse>
							<ref-info refs="Jiang">GCCCGCTAAGATCATTAGCGT</ref-info>
						</reverse>
						<real-time-probe>
							<ref-info refs="Jiang">FAM-CCGAGCCAGCGCCACCATGCACTTTTGTAAGAGGCTCGG-DABCYL</ref-info>
						</real-time-probe>
						<product name="" genbank-access-number="" size="108 bp">
							<ref-info />
						</product>
					</primers>
				</PCR>
				<PCR name="PCR testing of cerebrospinal fluid" ontology="UMLS:C0032520" time-to-perform="unknown">
					<description>
						<ref-info refs="Massung">A novel molecular assay was performed at the Centers for Disease Control and Prevention, and Rickettsia prowazekii, the agent of epidemic typhus, was found, rather than R. typhi. To our knowledge, this is the first reported case of epidemic typhus confirmed by means of polymerase chain reaction--based testing of cerebrospinal fluid, and it introduces a novel assay for the molecular diagnosis of both epidemic and murine typhus.</ref-info>
					</description>
					<primers name="R17122, R17500, RP2, RP1D">
						<forward>
							<ref-info refs="Massung">R17122.  CAGAGTGCTATGAACAAACAAGG</ref-info>
						</forward>
						<reverse>
							<ref-info refs="Massung">R17500.  CTTGCCATTGCCCATCAGGTTG</ref-info>
						</reverse>
					</primers>
					<primers name="RP2, RP1D">
						<forward>
							<ref-info refs="Massung">RP2.  TTCACGGCAATATTGACCTGTACTGTTCC</ref-info>
						</forward>
						<reverse>
							<ref-info refs="Massung">RP1D.  CGGTACACTTCTTGGTGGCGCAGGAGGT</ref-info>
						</reverse>
					</primers>
				</PCR>
				<PCR name="PCR for Rickettsia citrate synthase" ontology="UMLS:C0032520" time-to-perform="unknown">
					<description>
						<ref-info refs="Roux">Specific PCR amplifications were performed with primers CS-877 and CS-1273 or primers 120-M59 and 120-797 obtained from the gene coding for Rickettsia citrate synthase (gltA), and the rickettsial protein rOMpB (the number correspond to the 5&apos; ends of the primers determined with the R. prowazekii sequence [GenBank accession no. M37647]).</ref-info>
					</description>
					<primers name="CS-877, CS-1273">
						<forward>
							<ref-info refs="Roux">CS-877.  5&apos;-GGGGGCCTGCTCACGGCGG-3&apos;</ref-info>
						</forward>
						<reverse>
							<ref-info refs="Roux">CS-1273.  5&apos;-CATAACCAGTGTAAAGCTG-3</ref-info>
						</reverse>
					</primers>
					<primers name="120-M59, 120-797">
						<forward>
							<ref-info refs="Roux">120-M59.  5&apos;-CCGCAGGGTTGGTAACTGC-3&apos;</ref-info>
						</forward>
						<reverse>
							<ref-info refs="Roux">120-797.  5&apos;-CCTTTTAGATTACCGCCTAA-3&apos;</ref-info>
						</reverse>
					</primers>
				</PCR>
				<PCR name="PCR for R. prowazekii and R. rickettsii" ontology="UMLS:C0032520" time-to-perform="unknown">
					<description>
						<ref-info refs="Carl">The first use of the polymerase chain reaction (PCR) for the diagnosis of an acute rickettsial infection is described. A primer pair derived from the 17-kDa antigen sequence of Rickettsia rickettsii gave specific amplification of a 434-base pair DNA fragment from the genome of Rocky Mountain spotted fever and endemic and epidemic typhus. The assay could detect as few as 30 rickettsiae. Detection of PCR-amplified DNA with a nonradioactive DNA probe confirmed an acute infection with Rickettsia prowazekii.</ref-info>
					</description>
					<primers name="primer1, primer2">
						<forward>
							<ref-info refs="Carl"> primer 1.  5&apos;-GCTCTTGCAACTTCTATGTT-3&apos;</ref-info>
						</forward>
						<reverse>
							<ref-info refs="Carl">primer 2.  5&apos;-CATTGTTCGTCAGGTTGGCG-3&apos;</ref-info>
						</reverse>
						<real-time-probe>
							<ref-info refs="Carl">434-bp</ref-info>
						</real-time-probe>
					</primers>
				</PCR>
			</nucleic-acid-detection>
		</diagnostic-tests>
	</labwork>
	<!-- ********************************************************** -->
	<!--                     Reference List                         -->
	<!-- ********************************************************** -->
	<references>
		<journal refID="Turcinov" refName="Turcinov et al., 2000" PMID="10817744">
			<author>
				<last-name>Turcinov</last-name>
				<first-names>D</first-names>
			</author>
			<author>
				<last-name>Kuzman</last-name>
				<first-names>I</first-names>
			</author>
			<author>
				<last-name>Herendic</last-name>
				<first-names>B</first-names>
			</author>
			<title>Failure of azithromycin in treatment of Brill-Zinsser disease</title>
			<journal-name>Antimicrob Agents Chemother</journal-name>
			<year>2000</year>
			<volume>44</volume>
			<issue>6</issue>
			<pages>
				<first>1737</first>
				<last>1738</last>
			</pages>
		</journal>
		<journal refID="Huys" refName="Huys et al., 1973" PMID="4580526">
			<author>
				<last-name>Huys</last-name>
				<first-names>J</first-names>
			</author>
			<author>
				<last-name>Kayihigi</last-name>
				<first-names>J</first-names>
			</author>
			<author>
				<last-name>Freyens</last-name>
				<first-names>P</first-names>
			</author>
			<other-authors>Van den Berghe G</other-authors>
			<title>Single-dose treatment of epidemic typhus with doxycycline</title>
			<journal-name>Chemotherapy</journal-name>
			<year>1973</year>
			<volume>18</volume>
			<issue>5</issue>
			<pages>
				<first>314</first>
				<last>317</last>
			</pages>
		</journal>
		<journal refID="RaoultC" refName="Raoult and Drancourt, 1991" PMID="1810178">
			<author>
				<last-name>Raoult</last-name>
				<first-names>D</first-names>
			</author>
			<author>
				<last-name>Drancourt</last-name>
				<first-names>M</first-names>
			</author>
			<title>Antimicrobial therapy of rickettsial diseases</title>
			<journal-name>Antimicrob Agents Chemother</journal-name>
			<year>1991</year>
			<volume>35</volume>
			<issue>12</issue>
			<pages>
				<first>2457</first>
				<last>2462</last>
			</pages>
		</journal>
		<journal refID="Robinson" refName="Robinson et al., 2003" PMID="12783309">
			<author>
				<last-name>Robinson</last-name>
				<first-names>D</first-names>
			</author>
			<author>
				<last-name>Leo</last-name>
				<first-names>N</first-names>
			</author>
			<author>
				<last-name>Prociv</last-name>
				<first-names>P</first-names>
			</author>
			<other-authors>Barker SC.</other-authors>
			<title>Potential role of head lice, Pediculus humanus capitis, as vectors of Rickettsia prowazekii</title>
			<journal-name>Parasitol Res</journal-name>
			<year>2003</year>
			<volume>90</volume>
			<issue>3</issue>
			<pages>
				<first>209</first>
				<last>211</last>
			</pages>
		</journal>
		<journal refID="Baxter" refName="Baxter, 1996" PMID="8727129">
			<author>
				<last-name>Baxter</last-name>
				<first-names>JD</first-names>
			</author>
			<title>The typhus group</title>
			<journal-name>Clin Dermatol</journal-name>
			<year>1996</year>
			<volume>14</volume>
			<issue>3</issue>
			<pages>
				<first>271</first>
				<last>278</last>
			</pages>
		</journal>
		<journal refID="Fang" refName="Fang et al., 2002" PMID="12202579">
			<author>
				<last-name>Fang</last-name>
				<first-names>R</first-names>
			</author>
			<author>
				<last-name>Houhamdi</last-name>
				<first-names>L</first-names>
			</author>
			<author>
				<last-name>Raoult</last-name>
				<first-names>D</first-names>
			</author>
			<title>Detection of Rickettsia prowazekii in body lice and their feces by using monoclonal antibodies</title>
			<journal-name>J Clin Microbiol</journal-name>
			<year>2002</year>
			<volume>40</volume>
			<issue>9</issue>
			<pages>
				<first>3358</first>
				<last>3363</last>
			</pages>
		</journal>
		<journal refID="Andersson" refName="Andersson and Andersson, 2000" PMID="10865960">
			<author>
				<last-name>Andersson</last-name>
				<first-names>JO</first-names>
			</author>
			<author>
				<last-name>Andersson</last-name>
				<first-names>SGE</first-names>
			</author>
			<title>A century of typhus, lice and Rickettsia </title>
			<journal-name>Res Microbiol</journal-name>
			<year>2000</year>
			<volume>151</volume>
			<issue>2</issue>
			<pages>
				<first>143</first>
				<last>150</last>
			</pages>
		</journal>
		<journal refID="Reynolds" refName="Reynolds et al., 2003" PMID="14609478">
			<author>
				<last-name>Reynolds</last-name>
				<first-names>MG</first-names>
			</author>
			<author>
				<last-name>Krebs</last-name>
				<first-names>JS</first-names>
			</author>
			<author>
				<last-name>Comer</last-name>
				<first-names>JA</first-names>
			</author>
			<other-authors>Sumner JW, Rushton TC, Lopez CE, Nicholson WL, Rooney JA, Lance-Parker SE, McQuiston JH, Paddock CD, Childs JE.</other-authors>
			<title>Emerg Infect Dis</title>
			<journal-name>Flying squirrel-associated typhus, United States</journal-name>
			<year>2003</year>
			<volume>9</volume>
			<issue>10</issue>
			<pages>
				<first>1341</first>
				<last>1343</last>
			</pages>
		</journal>
		<journal refID="AnderssonB" refName="Andersson et al., 1998" PMID="9823893">
			<author>
				<last-name>Andersson</last-name>
				<first-names>SGE</first-names>
			</author>
			<author>
				<last-name>Zomorodipour</last-name>
				<first-names>A</first-names>
			</author>
			<author>
				<last-name>Andersson</last-name>
				<first-names>JO</first-names>
			</author>
			<other-authors>Sicheritz-Ponten T, Alsmark UC, Podowski RM, Naslund AK, Eriksson AS, Winkler HH, Kurland CG.</other-authors>
			<title>The genome sequence of Rickettsia prowazekii and the origin of mitochondria</title>
			<journal-name>Nature</journal-name>
			<year>1998</year>
			<volume>396</volume>
			<issue>6707</issue>
			<pages>
				<first>133</first>
				<last>140</last>
			</pages>
		</journal>
		<journal refID="Azad" refName="Azad and Beard, 1998" PMID="9621188">
			<author>
				<last-name>Azad</last-name>
				<first-names>AF</first-names>
			</author>
			<author>
				<last-name>Beard</last-name>
				<first-names>CB</first-names>
			</author>
			<title>Rickettsial pathogens and their arthropod vectors</title>
			<journal-name>Emerg Infect Dis</journal-name>
			<year>1998</year>
			<volume>4</volume>
			<issue>2</issue>
			<pages>
				<first>179</first>
				<last>186</last>
			</pages>
		</journal>
		<journal refID="Stein" refName="Stein et al., 1999" PMID="10371575 ">
			<author>
				<last-name>Stein</last-name>
				<first-names>A</first-names>
			</author>
			<author>
				<last-name>Purgus</last-name>
				<first-names>R</first-names>
			</author>
			<author>
				<last-name>Olmer</last-name>
				<first-names>Raoult</first-names>
			</author>
			<other-authors>Raoult D.</other-authors>
			<title>Brill-Zinsser disease in France</title>
			<journal-name>Lancet</journal-name>
			<year>1999</year>
			<volume>353</volume>
			<issue>9</issue>
			<pages>
				<first>1936</first>
				<last>1936</last>
			</pages>
		</journal>
		<journal refID="Roux" refName="Roux and Raoult, 1999" PMID="9986818">
			<author>
				<last-name>Roux</last-name>
				<first-names>V</first-names>
			</author>
			<author>
				<last-name>Raoult</last-name>
				<first-names>D</first-names>
			</author>
			<title>Body lice as tools for diagnosis and surveillance of reemerging diseases</title>
			<journal-name>J Clin Microbiol</journal-name>
			<year>1999</year>
			<volume>37</volume>
			<issue>3</issue>
			<pages>
				<first>596</first>
				<last>599</last>
			</pages>
		</journal>
		<journal refID="Gross" refName="Gross, 1996" PMID="8855211">
			<author>
				<last-name>Gross</last-name>
				<first-names>L</first-names>
			</author>
			<title>How Charles Nicolle of the Pasteur Institute discovered that epidemic typhus is transmitted by lice: reminiscences from my years at the Pasteur Institute in Paris</title>
			<journal-name>Proc Natl Acad Sci U S A</journal-name>
			<year>1996</year>
			<volume>93</volume>
			<issue>20</issue>
			<pages>
				<first>10539</first>
				<last>10540</last>
			</pages>
		</journal>
		<journal refID="Raoult" refName="Raoult et al., 2004" PMID="15081509">
			<author>
				<last-name>Raoult</last-name>
				<first-names>D</first-names>
			</author>
			<author>
				<last-name>Woodward</last-name>
				<first-names>T</first-names>
			</author>
			<author>
				<last-name>Dumler</last-name>
				<first-names>JS</first-names>
			</author>
			<title>The history of epidemic typhus</title>
			<journal-name>Infect Dis Clin North Am</journal-name>
			<year>2004</year>
			<volume>18</volume>
			<issue>1</issue>
			<pages>
				<first>127</first>
				<last>140</last>
			</pages>
		</journal>
		<journal refID="RaoultB" refName="Raoult et al., 1998" PMID="9717922">
			<author>
				<last-name>Raoult</last-name>
				<first-names>D</first-names>
			</author>
			<author>
				<last-name>Ndihokubwayo</last-name>
				<first-names>JB</first-names>
			</author>
			<author>
				<last-name>Tissot-Dupont</last-name>
				<first-names>H</first-names>
			</author>
			<other-authors>Roux V, Faugere B, Abegbinni R, Birtles RJ.</other-authors>
			<title>Outbreak of epidemic typhus associated with trench fever in Burundi</title>
			<journal-name>Lancet</journal-name>
			<year>1998</year>
			<volume>352</volume>
			<issue>9125</issue>
			<pages>
				<first>353</first>
				<last>358</last>
			</pages>
		</journal>
		<journal refID="Gonder" refName="Gonder et al., 1980" PMID="7439974">
			<author>
				<last-name>Gonder</last-name>
				<first-names>JC</first-names>
			</author>
			<author>
				<last-name>Kenyon</last-name>
				<first-names>RH</first-names>
			</author>
			<author>
				<last-name>Pedersen</last-name>
				<first-names>CE Jr.</first-names>
			</author>
			<title>Epidemic typhus infection in cynomolgus monkeys (Macaca fascicularis)</title>
			<journal-name>Infect Immun</journal-name>
			<year>1980</year>
			<volume>30</volume>
			<issue>1</issue>
			<pages>
				<first>219</first>
				<last>223</last>
			</pages>
		</journal>
		<journal refID="AzadC" refName="Azad and Radulovic, 2003" PMID="12860715">
			<author>
				<last-name>Azad</last-name>
				<first-names>AF</first-names>
			</author>
			<author>
				<last-name>Radulovic</last-name>
				<first-names>S</first-names>
			</author>
			<title>Pathogenic rickettsiae as bioterrorism agents</title>
			<journal-name>Ann N Y Acad Sci</journal-name>
			<year>2003</year>
			<volume>990</volume>
			<pages>
				<first>734</first>
				<last>738</last>
			</pages>
		</journal>
		<journal refID="Jiang" refName="Jiang et al., 2003" PMID="12860643">
			<author>
				<last-name>Jiang</last-name>
				<first-names>J</first-names>
			</author>
			<author>
				<last-name>Temenak</last-name>
				<first-names>JJ</first-names>
			</author>
			<author>
				<last-name>Richards</last-name>
				<first-names>AL</first-names>
			</author>
			<title>Real-time PCR duplex assay for Rickettsia prowazekii and Borrelia recurrentis</title>
			<journal-name>Ann N Y Acad Sci</journal-name>
			<year>2003</year>
			<volume>990</volume>
			<pages>
				<first>302</first>
				<last>310</last>
			</pages>
		</journal>
		<journal refID="Houhamdi" refName="Houhamdi et al., 2002" PMID="12447741">
			<author>
				<last-name>Houhamdi</last-name>
				<first-names>L</first-names>
			</author>
			<author>
				<last-name>Fournier</last-name>
				<first-names>PE</first-names>
			</author>
			<author>
				<last-name>Fang</last-name>
				<first-names>R</first-names>
			</author>
			<other-authors>Lepidi H, Raoult D.</other-authors>
			<title>An experimental model of human body louse infection with Rickettsia prowazekii</title>
			<journal-name>J Infect Dis</journal-name>
			<year>2002</year>
			<volume>186</volume>
			<issue>11</issue>
			<pages>
				<first>1639</first>
				<last>1646</last>
			</pages>
		</journal>
		<journal refID="Massung" refName="Massung et al., 2001" PMID="11247722">
			<author>
				<last-name>Massung</last-name>
				<first-names>RF</first-names>
			</author>
			<author>
				<last-name>Davis</last-name>
				<first-names>LE</first-names>
			</author>
			<author>
				<last-name>Slater</last-name>
				<first-names>K</first-names>
			</author>
			<other-authors>McKechnie DB, Puerzer M.</other-authors>
			<title>Epidemic typhus meningitis in the southwestern United States</title>
			<journal-name>Clin Infect Dis</journal-name>
			<year>2001</year>
			<volume>32</volume>
			<issue>6</issue>
			<pages>
				<first>979</first>
				<last>982</last>
			</pages>
		</journal>
		<journal refID="Carl" refName="Carl et al., 1990" PMID="2108225">
			<author>
				<last-name> Carl </last-name>
				<first-names> M </first-names>
			</author>
			<author>
				<last-name>Tibbs </last-name>
				<first-names> CW </first-names>
			</author>
			<author>
				<last-name> Dobson </last-name>
				<first-names> ME </first-names>
			</author>
			<other-authors>Paparello S, Dasch GA.</other-authors>
			<title>Diagnosis of acute typhus infection using the polymerase chain reaction.
</title>
			<journal-name> Journal Infectious Diseases </journal-name>
			<year> 1990 </year>
			<volume> 161</volume>
			<issue> 4 </issue>
			<pages>
				<first> 791 </first>
				<last> 793 </last>
			</pages>
		</journal>
		<journal refID="Hechemy" refName="Hechemy et al., 1981" PMID="6780601">
			<author>
				<last-name> Hechemy </last-name>
				<first-names> KE </first-names>
			</author>
			<author>
				<last-name> Osterman </last-name>
				<first-names> JV </first-names>
			</author>
			<author>
				<last-name> Eisemann </last-name>
				<first-names> CS </first-names>
			</author>
			<other-authors> Elliott LB, Sasowski SJ. </other-authors>
			<title> Detection of Typhus Antibodies by Latex Agglutination </title>
			<journal-name> Journal of Clinical Microbiology </journal-name>
			<year> 1981</year>
			<volume> 13 </volume>
			<issue> 1 </issue>
			<pages>
				<first> 214 </first>
				<last> 216 </last>
			</pages>
		</journal>
		<journal refID="LaScola" refName="La Scola et al., 2000" PMID="10882661">
			<author>
				<last-name>La Scola</last-name>
				<first-names>B</first-names>
			</author>
			<author>
				<last-name>Rydkina</last-name>
				<first-names>L</first-names>
			</author>
			<author>
				<last-name>Ndihokubwayo</last-name>
				<first-names>JB</first-names>
			</author>
			<other-authors>Vene S, Raoult D.</other-authors>
			<title>Serological differentiation of murine typhus and epidemic typhus using cross-adsorption and Western blotting</title>
			<journal-name>Clin Diagn Lab Immunol</journal-name>
			<year>2000</year>
			<volume>7</volume>
			<issue>4</issue>
			<pages>
				<first>612</first>
				<last>616</last>
			</pages>
		</journal>
		<journal refID="Niang" refName="Niang et al., 1999" PMID="10511530">
			<author>
				<last-name>Niang</last-name>
				<first-names>M</first-names>
			</author>
			<author>
				<last-name>Brouqui</last-name>
				<first-names>P</first-names>
			</author>
			<author>
				<last-name>Raoult</last-name>
				<first-names>D</first-names>
			</author>
			<title>Epidemic typhus imported from Algeria</title>
			<journal-name>Emerg Infect Dis</journal-name>
			<year>1999</year>
			<volume>5</volume>
			<issue>5</issue>
			<pages>
				<first>716</first>
				<last>718</last>
			</pages>
		</journal>
		<journal refID="Popov" refName="Popov et al., 1987" PMID="2883859">
			<author>
				<last-name>Popov</last-name>
				<first-names>VL</first-names>
			</author>
			<author>
				<last-name>Prozorovsky</last-name>
				<first-names>SV</first-names>
			</author>
			<author>
				<last-name>Vovk</last-name>
				<first-names>OA</first-names>
			</author>
			<other-authors>Kekcheeva NK, Smirnova NS, Barkhatova OI.</other-authors>
			<title>Electron microscopic analysis of in vitro interaction of Rickettsia prowazekii with guinea pig macrophages. II. Macrophages from immune animals.
</title>
			<journal-name>Acta Virol</journal-name>
			<year>1987</year>
			<volume>31</volume>
			<issue>1</issue>
			<pages>
				<first>59</first>
				<last>64</last>
			</pages>
		</journal>
		<journal refID="LaScolaB" refName="La Scola and Raoult, 1997" PMID="9350721">
			<author>
				<last-name>La Scola</last-name>
				<first-names>B</first-names>
			</author>
			<author>
				<last-name>Raoult</last-name>
				<first-names>D</first-names>
			</author>
			<title>Laboratory diagnosis of rickettsioses: current approaches to diagnosis of old and new rickettsial diseases</title>
			<journal-name>J Clin Microbiol</journal-name>
			<year>1997</year>
			<volume>35</volume>
			<issue>11</issue>
			<pages>
				<first>2715</first>
				<last>2727</last>
			</pages>
		</journal>
		<journal refID="Vestris" refName="Vestris et al., 2003" PMID="12860657">
			<author>
				<last-name>Vestris</last-name>
				<first-names>G</first-names>
			</author>
			<author>
				<last-name>Rolain</last-name>
				<first-names>JM</first-names>
			</author>
			<author>
				<last-name>Fournier</last-name>
				<first-names>PE</first-names>
			</author>
			<other-authors>Birg ML, Enea M, Patrice JY, Raoult D.</other-authors>
			<title>Seven years&apos; experience of isolation of Rickettsia spp. from clinical specimens using the shell vial cell culture assay</title>
			<journal-name>Ann N Y Acad Sci</journal-name>
			<year>2003</year>
			<volume>990</volume>
			<pages>
				<first>371</first>
				<last>374</last>
			</pages>
		</journal>
		<journal refID="Philip" refName="Philip et al., 1976" PMID="815267">
			<author>
				<last-name>Philip</last-name>
				<first-names>RN</first-names>
			</author>
			<author>
				<last-name>Casper</last-name>
				<first-names>EA</first-names>
			</author>
			<author>
				<last-name>Ormsbee</last-name>
				<first-names>RA</first-names>
			</author>
			<other-authors>Burgdorfer W.</other-authors>
			<title>Microimmunofluorescence test for the serological study of rocky mountain spotted fever and typhus</title>
			<journal-name>J Clin Microbiol</journal-name>
			<year>1976</year>
			<volume>3</volume>
			<issue>1</issue>
			<pages>
				<first>51</first>
				<last>61</last>
			</pages>
		</journal>
		<journal refID="Shephard" refName="Shephard et al., 1976" PMID="972194">
			<author>
				<last-name>Shephard</last-name>
				<first-names>CC</first-names>
			</author>
			<author>
				<last-name>Redus</last-name>
				<first-names>MA</first-names>
			</author>
			<author>
				<last-name>Tzianabos</last-name>
				<first-names>T</first-names>
			</author>
			<other-authors>Warfield DT.</other-authors>
			<title>Recent experience with the complement fixation test in the laboratory diagnosis of rickettsial diseases in the United States</title>
			<journal-name> J Clin Microbiol</journal-name>
			<year>1976</year>
			<volume>4</volume>
			<issue>3</issue>
			<pages>
				<first>277</first>
				<last>283</last>
			</pages>
		</journal>
		<journal refID="Policastro" refName="Policastro et al., 1996" PMID="8818887">
			<author>
				<last-name>Policastro</last-name>
				<first-names>PF</first-names>
			</author>
			<author>
				<last-name>Peacock</last-name>
				<first-names>MG</first-names>
			</author>
			<author>
				<last-name>Hackstadt</last-name>
				<first-names>T</first-names>
			</author>
			<title>Improved plaque assays for Rickettsia prowazekii in Vero 76 cells</title>
			<journal-name>J Clin Microbiol</journal-name>
			<year>1996</year>
			<volume>34</volume>
			<issue>8</issue>
			<pages>
				<first>1944</first>
				<last>1948</last>
			</pages>
		</journal>
		<journal refID="Turco" refName="Turco and , 1989" PMID="2498207">
			<author>
				<last-name>Turco</last-name>
				<first-names>C</first-names>
			</author>
			<author>
				<last-name>Winkler</last-name>
				<first-names>HH</first-names>
			</author>
			<title>Isolation of Rickettsia prowazekii with reduced sensitivity to gamma interferon</title>
			<journal-name>Infect Immun</journal-name>
			<year>1989</year>
			<volume>57</volume>
			<issue>6</issue>
			<pages>
				<first>1765</first>
				<last>1772</last>
			</pages>
		</journal>
		<journal refID="WalkerB" refName="Walker, 1989" PMID="2504480">
			<author>
				<last-name>Walker</last-name>
				<first-names>DH</first-names>
			</author>
			<title>Rocky Mountain spotted fever: a disease in need of microbiological concern</title>
			<journal-name>Clin Microbiol Rev</journal-name>
			<year>1989</year>
			<volume>2</volume>
			<issue>3</issue>
			<pages>
				<first>227</first>
				<last>240</last>
			</pages>
		</journal>
		<journal refID="Ge" refName="Ge et al., 2004" PMID="14702324">
			<author>
				<last-name>Ge</last-name>
				<first-names>H</first-names>
			</author>
			<author>
				<last-name>Chuang</last-name>
				<first-names>YY</first-names>
			</author>
			<author>
				<last-name>Zhao</last-name>
				<first-names>S</first-names>
			</author>
			<other-authors>Tong M, Tsai MH, Temenak JJ, Richards AL, Ching WM</other-authors>
			<title>Comparative genomics of Rickettsia prowazekii Madrid E and Breinl strains</title>
			<journal-name>J Bacteriol</journal-name>
			<year>2004</year>
			<volume>186</volume>
			<issue>2</issue>
			<pages>
				<first>556</first>
				<last>565</last>
			</pages>
		</journal>
		<book refID="AzadB" refName="Azad, 1988" ISBN="0-8493-4382-8">
			<author>
				<last-name>Azad</last-name>
				<first-names>AF</first-names>
			</author>
			<article-title>Relationship of vector biology and epidemiology of the louse- and flea-borne rickettsiodses</article-title>
			<book-editor>
				<last-name>Walker</last-name>
				<first-names>DH</first-names>
			</book-editor>
			<book-name>Biology of Rickettsial diseases Volume I</book-name>
			<year>1988</year>
			<pages>
				<first>51</first>
				<last>61</last>
			</pages>
			<publisher>CRC Press Inc</publisher>
			<publisher-location>Boca Raton, Fl</publisher-location>
		</book>
		<book refID="Walker" refName="Walker, 1988" ISBN="0-8493-4382-8">
			<author>
				<last-name>Walker</last-name>
				<first-names>DH</first-names>
			</author>
			<article-title>Pathology and pathogenesis of the vasculotropic rickettsioses</article-title>
			<book-editor>
				<last-name>Walker</last-name>
				<first-names>DH</first-names>
			</book-editor>
			<book-name>Biology of Rickettsial diseases Volume I</book-name>
			<year>1988</year>
			<pages>
				<first>115</first>
				<last>138</last>
			</pages>
			<publisher>CRC Press Inc</publisher>
			<publisher-location>Boca Raton, Fl</publisher-location>
		</book>
		<website refID="Website1" refName="Website 1">
			<URL>http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=782&amp;lvl=3&amp;lin=f&amp;keep=1&amp;srchmode=1&amp;unlock</URL>
			<title>Rickettsia prowazekii</title>
		</website>
		<website refID="Website2" refName="Website 2">
			<URL>http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=9606&amp;lvl=3&amp;lin=f&amp;keep=1&amp;srchmode=1&amp;unlock</URL>
			<title>Homo sapiens </title>
		</website>
		<website refID="Website3" refName="Website 3">
			<URL>http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=121224&amp;lvl=3&amp;lin=f&amp;keep=1&amp;srchmode=1&amp;unlock</URL>
			<title>Pediculus humanus corporis</title>
		</website>
		<website refID="Website4" refName="Website 4">
			<URL>http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=121226&amp;lvl=3&amp;lin=f&amp;keep=1&amp;srchmode=1&amp;unlock</URL>
			<title>Pediculus humanus capitis </title>
		</website>
		<website refID="Website5" refName="Website 5">
			<URL>http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=64683&amp;lvl=3&amp;lin=f&amp;keep=1&amp;srchmode=1&amp;unlock</URL>
			<title>Glaucomys volans</title>
		</website>
		<website refID="Website6" refName="Website 6">
			<URL>http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&amp;val=15603881</URL>
			<title>Rickettsia prowazekii strain Madrid E, complete genome</title>
		</website>
		<website refID="Website7" refName="Website 7">
			<URL>http://www.cdc.gov/travel/diseases/rickettsial.htm</URL>
			<title>Rickettsial Infections</title>
		</website>
		<website refID="Website8" refName="Website 9">
			<URL>http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=160165&amp;lvl=3&amp;lin=f&amp;keep=1&amp;srchmode=1&amp;unlock</URL>
			<title>Neohaematopinus </title>
		</website>
		<website refID="Website9" refName="Website 9">
			<URL>http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=51296&amp;lvl=3&amp;lin=f&amp;keep=1&amp;srchmode=1&amp;unlock</URL>
			<title>Orchopeas</title>
		</website>
		<website refID="Website10" refName="Website 10">
			<URL>http://www.microbelibrary.org/images/Walker/images/rick2-an.jpg</URL>
			<title>Rickettsia, Obligately Intracellular Bacteria, Pathogenic for Humans I </title>
		</website>
		<website refID="Website11" refName="Website 11">
			<URL>http://www.ncbi.nlm.nih.gov/genomes/framik.cgi?db=genome&amp;gi=138</URL>
			<title>Rickettsia prowazekii strain Madrid E, complete genome  </title>
		</website>
		<website refID="Website12" refName="Website 12">
			<URL>http://www.cdc.gov/od/ohs/biosfty/bmbl4/bmbl4s7e.htm</URL>
			<title>BMBL Section VII.  Agent Summary Statements.  Section VII-E: Rickettsial Agents</title>
		</website>
		<website refID="Website13" refName="Website 13">
			<URL>http://www.microbelibrary.org/images/Walker/images/rick-an.jpg</URL>
			<title>Rickettsia, Obligately Intracellular Bacteria, Pathogenic for Humans I </title>
		</website>
		<website refID="Website14" refName="Website 14">
			<URL>http://www.emedicine.com/med/topic2332.htm</URL>
			<author>
				<last-name>Hansen</last-name>
				<first-names>EA</first-names>
			</author>
			<author>
				<last-name>Cunha</last-name>
				<first-names>BA</first-names>
			</author>
			<title>Typhus</title>
		</website>
		<website refID="Website15" refName="Website 15">
			<URL>http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=272947&amp;lvl=3&amp;lin=f&amp;keep=1&amp;srchmode=1&amp;unlock</URL>
			<title>Rickettsia prowazekii str. Madrid E</title>
		</website>
		<website refID="ref3" refName="Website 1">
			<URL />
			<author>
				<last-name />
				<first-names />
			</author>
			<title />
		</website>
	</references>
	<!--                    Curation information                    -->
	<curation-info>
		<curator curatorID="Wattam">
			<last-name>Wattam</last-name>
			<first-names>Rebecca</first-names>
		</curator>
		<date>4/21/2004</date>
		<version>0.1</version>
		<note />
		<contact-info>
			<email>pathinfo@vbi.vt.edu</email>
		</contact-info>
	</curation-info>
</pathinfo>
