New insights into rickettsioses: genomics, proteomics, pathobiology, and the international threat of rickettsial diseases: introduction

Mediterranean spotted fever

Fever boutonneuse

Rickettsia conorii

Mediterranean spotted fever (MSF), also known as boutonneuse fever, is caused by Rickettsia conorii, an obligately intracellular, slow-growing gram-negative bacterium. Unusual rickettsial strains related to R. conorii have been described as belonging to an "R. conorii complex" which includes the Indian tick typhus rickettsia, the Astrakhan fever rickettsia, and the Israeli spotted fever (ISF) rickettsia. Recently, the creation of four R. conorii subspecies has been proposed in order to separate these strains on the basis of genetic and serological methods. Therefore, rickettsial isolates exhibiting close genetic similarity to the R. conorii Malish type strain (ATCC VR-613) should be classified as Rickettsia conorii subsp. conorii, while three further subspecies, Rickettsia conorii subsp. indica, Rickettsia conorii subsp. caspia, and Rickettsia conorii subsp. israelensis, have been created to accommodate isolates genetically similar to the type strains of the Indian tick typhus rickettsia (ATC C VR-597), the Astrakhan fever rickettsia (A-167), and the ISF rickettsia (ISTTCDC1), respectively.

Like other Gram-negative bacteria, typhus rickettsiae are members of the alpha-group of the purple bacteria. Along with the families Bartonellaceae and Anaplasmatacease, they are members of the order Rickettsiales and the family Rickettsiaceae. The tribe Rickettsieae now has two genera, Rickettsia and Orientia. The genus rickettsia is divided into spotted fever and typhus groups.

Boutonneuse fever, also known as Marseilles fever and Mediterranean spotted fever, caused by Rickettsia conorii and transmitted by ixodid ticks, especially Rhipicephalus sanguineus, the common dog tick in the Mediterranean.

Rickettsia conorii str. Malish 7.

Rickettsia conorii strain Malish 7. This strain was isolated from a human in South Africa.

Species: R. conorii, Strain: Seven (Malish), ATCC VR-613T, Source organism: Unknown, Geographical origin: South Africa, Human disease: Mediterranean spotted fever, Reference: none, Supplier/source: ATCC.

The type strain is Malish, ATCC VR-613, which was isolated in South Africa by J.H.S. Gear in 1946. This type is the most common and representative of the isolates of R. conorii subsp. conorii subsp. nov. Rickettsiae closely related to the Malish strain, the reference Rickettsia conorii strain, include Indian tick typhus rickettsia (ITTR), Israeli spotted fever rickettsia (ISFR), and Astrakhan fever rickettsia (AFR).

Rickettsia conorii subsp. caspia.

Rickettsia conorii subsp. caspia (cas' pi.a N. L. fem.adj. caspia, from Mare Caspium, the Latin name of the Caspian sea where the disease caused by this rickettsia is endemic). The characteristics are the same as those of the species. Transmitted to humans through the bite of Rhipicephalus sanguineus and R. pumilio ticks. The type strain is A-167, which was isolated from a Rhipicephalus pumilio tick collected in Astrakhan in 1992. Rickettsiae closely related to the Malish strain, the reference Rickettsia conorii strain, include Indian tick typhus rickettsia (ITTR), Israeli spotted fever rickettsia (ISFR), and Astrakhan fever rickettsia (AFR).

Rickettsia conorii subsp. israelensis.

R. conorii subsp. israelensis was first isolated in 1974 in Israel, where its distribution initially appeared to be restricted. Our recent finding of R. conorii subsp. israelensis infection in a Rhipicephalus sanguineus tick, which is the main vector for MSF in Sicily, also suggested that the geographic distribution of ISF might be wider than previously thought, including not only Israel and Portugal but also Italy.

Rickettsia conorii subsp. israelensis (is.ra. el en' sis. N. L. gen.n. israelensis, from Israel, where the Rhipicephalus sanguineus tick providing the first isolate was collected). The characteristics are the same as those of the species. Transmitted to humans through the bite of Rhipicephalus sanguineus ticks. Grows in Vero cells at 32 C in antibiotic-free Minimal Essential Medium supplemented with 2 % fetal calf serum and 2 mg/ml L-glutamine. The type strain is ISTTCDC1, which was isolated from a Rhipicephalus sanguineus tick collected in Israel in 1974. Israeli spotted fever rickettsia- Strain (ATCC number): ISTT CDCI, Original source: Rhipicephalus sanguineus, Geographical origin: Israel, Human disease: Israeli spotted fever. Israeli spotted fever ricekttsia- Strain (ATCC number): ISTT CDCI, Original source: Rhipicephalus sanguineus, Geographical origin: Portugal, Human disease: Unnamed spotted fever.

Rickettsia conorii subsp. indica.

Species: R. conorii, Strain: Indian tick typhus rickettsia, ATCC VR-597, Source organism: Rhipicephalus sanguineus, Geographical origin: India, Human disease: Mediterranean spotted fever, Reference: Golinevitch (1960), Supplier/source: Gamaleya Institute, Moscow.

Rickettsiae closely related to the Malish strain, the reference Rickettsia conorii strain, include Indian tick typhus rickettsia (ITTR), Israeli spotted fever rickettsia (ISFR), and Astrakhan fever rickettsia (AFR). Rickettsia conorii subsp. indica (in'di.ca N. L. gen. n. indica, from India, where the Rhipicephalus sanguineus tick providing the first isolate was collected). The characteristics are the same as those of the species. Transmitted to humans through the bite of Rhipicephalus sanguineus ticks. Grows in Vero cells at 32 C in antibiotic-free Minimal Essential Medium supplemented with 2% fetal calf serum and 2mg/ml L-glutamine. The type strain is Indian tick typhus, ATCC VR-597, which was isolated from a Rhipicephalus sanguineus tick collected in India by C.B. Philip in 1950. Indian tick typhus rickettsia- Strain (ATCC number): Indian (VR-597), Original source: Rhipicephalus sanguineus, Geographical origin: India, Human disease: Indian tick typhus.

Indian tick typhus caused by a rickettsia closely related to R. conorii and transmitted by ixodid ticks, especially species of Hemaphysalis.

Rickettsia conorii subsp. conorii

R. conorii, isolates Malish, Vector tick: Rhiphicephalus sp., Haemaphysalis leachii, Geographic location: Mediterranean area, Human disease name: Mediterranean spotted fever. Rickettsia conorii subsp. conorii (co.no'ri.i N. L. gen. n. conorii, of Conor, in honor of A. Conor who, in collaboration with A. Bruch, provided the first description of fievre boutonneuse in 1910). The characteristics are the same as those of the species. Transmitted to humans through the bite of Rhipicephalus sanguineus ticks.

Rickettsia conorii var. pijperi

R. conorii M1

Species: R. conorii, Strain: M1, ATCC VR-613T, Source organism: Rhipicephalus sanguineus, Geographical origin: Georgia, former USSR, Human disease: Mediterranean spotted fever, Reference: Golinevitch (1960), Supplier/source: Gamaleya Institute, Moscow.

Members of the genus rickettsia are small, typical gram-negative coccobacilli measuring approximately 0.7-1.0 um in length by 0.3-0.5 um in width.

The rickettsial envelope appears to be the typical Gram-negative structure with a bilayer inner membrane, a peptidoglycan layer, and a bilayer outer membrane.

The main vector of R. conorii is the dog tick Rhipicephalus sanguineus, and the disease is transmitted to humans by tick bite. The bacterium does not lead to an infection in dogs. MSF is more frequently seen in the spring and summer seasons, during which the ticks are most active. The infection is transmitted via larvae and nymphs, and the tick bite is usually not felt.

The life cycle of rickettsial disease involves an insect vector, as well as an animal host. The rickettsiae that cause boutonneuse fever, African tick bite fever, and Mediterranean fever, R. conorii, are transmitted to man by the ticks Rhipicephalus sanguineus, R. simus and Haemaphysalis leachi. The major reservoir for these agents is the dog, although other species, such as Lagomorpha (herbivorous mammals resembling rodents, such as rabbits), may play a role. These diseases display a seasonal variation when the ticks are most numerous-that is, during the warm months in temperate areas and throughout the year in tropical areas. Studies suggest that contact with dogs is reported in more than 90% of cases of boutonneuse fever. In central Spain, R. sanguineus ticks removed from dogs tested positive for R. conorii by immunofluorescence in 43% of samples, and 58.6% of the dogs had significant immunofluorescence titers in their serum as well.

R. conorii is maintained in ticks and is transmitted to humans by tick bite.

The infection passes from one generation of ticks through the eggs to the next, all stages of which (the larva, the nymph, and the adult) are infected and potentially infective to man. Most human infections, however, are transmitted by larval ticks which are so small that they are not felt walking over the skin and so are not detected and are able to attach without interference from their human hosts. They are also not so specific in their feeding habits, readily feeding on man as well as their more natural hosts.

Rickettsia species live in different ecological niches inside different arthropod hosts (insects or ticks), in which most of them are transmitted vertically from the mother to the progeny. R. conorii naturally infects the dog brown tick Rhipicephalus sanguineus. When transmitted to humans through tick bites, the bacterium causes Mediterranean spotted fever. R. conorii is closely related to the previously sequenced R. prowazekii, the agent of louse-borne typhus. We determined the complete sequence of the R. conorii genome (GenBank accession number AE006914).

1,268,755 nt

1414

We determined the 1,268,755-nucleotide complete genome sequence of R. conorii, containing 1374 open reading frames. This genome exhibits 804 of the 834 genes of the previously determined R. prowazekii genome plus 552 supplementary open reading frames and a 10-fold increase in the number of repetitive elements. Despite these differences, the two genomes exhibit a nearly perfect colinearity that allowed the clear identification of different stages of gene alterations with gene remnants and 37 genes split in 105 fragments, of which 59 are transcribed. A 38-kilobase sequence inversion was dated shortly after the divergence of the genus.

Mediterranean spotted fever and its variants-Astrakhan fever, Israeli tick typhus, and Indian tick typhus-are caused by Rickettsia conorii and transmitted by dog ticks in urban and suburban areas. The disease is present in Europe, Africa, and Asia, with the principal foci comprising the Mediterranean and Caspian littorals.

Mediterranean spotted fever (MSF) is also known as Boutonneuse fever, Kenya tick typhus, Indian tick typhus and Israeli spotted fever, reflecting different geographic regions of occurrence.

Epidemiological features such as season (summer essentially), presence of a dog, and travel in an endemic area (the Mediterranean Basin) are important in the diagnosis. In such cases fever associated with rash have to be considered and treated as MSF.

This is the widest distributed rickettsioses of the Spotted Fever group in the Mediterranean, in the area of the Caspian and Black Sea, and in countries of northern, central and southeast Africa and southeast Asia.

It is endemic in the south of France, Italy and Spain.

In the Mediterranean region most cases occur during warm months with the peak incidence in July through September.

Italy: MSF is endemic in Italy, where it is a reportable disease. The Italian Ministry of Health received reports of 890 cases of human rickettsioses presumed to be MSF in 2002. MSF is more common in some central and southern regions of Italy, reaching an average of 10 cases for every 100,000 inhabitants in Sicily in 2002, compared with a national average of 1.6. Rickettsia conorii is thought to be the only pathogenic rickettsia of the spotted fever group (SFG) in Italy, as well as in the Western Mediterranean area, even if the possible circulation of strains different from classical R. conorii has been proposed, mainly for clinical reasons (different degrees of severity). Israel: Mediterranean spotted fever is a noticeable disease in Israel, with an annual incidence of 6.2 cases per 100,000 persons (range 0.7-10.3). Most cases occur in children and in rural settlements. Moreover, this disease is especially endemic in the Bedouin settlements in the Negev Region where an antibody prevalence as high as 10-25% in healthy subjects was reported. Endemic settlements in Israel are characterized by a large number of tick infected domestic animals living in close proximity to humans. Although, usually this disease has a benign course, a rapidly fatal outcome can occur even in young healthy adults, with an average case-fatality rate of 2.5% (range 0.7-3.5) Russia (Astrakhan): Authors indicted that rickettsiosis (spotted fever) was endemic in the region of Astrakhan between 1970 and 1980 and caused by Rickettsia conorii. A seasonal occurrence was noted, with the majority of cases being diagnosed between May and September 95-98%. Patients were from 20 to 500 years old, and most were males (61.35-72.3%) and children less than 14 years old (5.9%). The risk factor for acquisition of Astrakhan fever in this population was exposure to Rhipicephalus pumilio ticks. Rhipicephalus pumilio ticks were collected from dogs in Astrakhan region. No person to person transmission has been reported. Spain: Rickettsia typhi and Rickettsia conorii, the etiologic agents of, respectively, murine typhus and Mediterranean spotted fever, are recognized as frequent causes of fever of intermediate duration in southern Spain. The prevalence of past infection due to R. conorii among 504 total subjects was 8.7%. the factors associated with R. conorii infection were a high-risk occupation (p less than 0.001; OR equals 9.3, 95%CI 3.7-23.2) and, in subjects who resided in urban areas, participation in outdoor activities (p equals 0.021; OR equals 7.2, 95%CI 1.4-38.5) France: Infections with C. burnetti and R. conorii are endemic in southern France including the French Alps. The most important vector is R. sanguineus, but other Rhipicephalus species like R. pusillus and R. turanicus are considered as vectors; they feed on dogs and humans.

Marseilles area: The incidence is 56 to 77 cases per year for a population of 3 million, i.e. 2.2 per 100,000 inhabitants. Among the demographic parameters, males were more frequently ill than females (43%). The increase of the prevalence of the tick Rhipicephalus sanguineus could be an explanation for an increasing incidence in the last 10 years.

Invertebrate Vertebrate

Infection is introduced into humans through the skin by the vector's mouth parts, through the pulmonary system through aerosols of vector feces, or by contact with ectoparasites or their feces in broken skin or mucous membranes.

Ticks transmit microbes by several routes including salivary secretions, coxal fluids, regurgitation and faeces.

Vertebrate Vertebrate

Several of the tick-borne infections that affect dogs can cause serious disease in humans, notably borreliosis, ehrlichiosis, RMSF, R. conorii infection and tick-borne encephalitis. However, the potential zoonotic threat posed by dogs is strongly influenced by the natural cycle of the specific agent with which the dog is infected. Three general epidemiological scenarios can be described. First, if transmission of an infectious agent involves ticks with a broad host range (such as I. ricinus), dogs can act directly as sentinels for infection of humans. Second, by acting as natural hosts for certain nidicolous ticks (such as R. sanguineus and Ixodes canisuga), dogs significantly increase contact between these species and humans, thereby increasing the risk of transmission. Finally, there is a limited risk of transmission by exposure to infected-tick contents following damage to ticks during grooming of infested animals. This scenario has been reported for R. conorii. In dogs, coinfection with combinations of Ehrlichia, Bartonella, Babesia, occurs in endemic area. Rickettsia conorii, the agent of boutonneuse fever in humans in southern Europe, the Middle East and southern Africa, is reported to infect dogs, but clinical signs of disease have not been reported.

Tick Tick

The nature of the relationship between rickettsiae and arthropods suggests that their evolution is likely to be influenced far more by arthropod factors than those of transient warm-blooded hosts because rickettsiae are mainly maintained by transovarial transmission between tick generations. However, horizontal transfer of rickettsiae between vectors certain occurs, as proven by the multiplicity of vectors for R. conorii or R. rickettsii.

Pathogens ingested by ticks can be spread trans-stadially and/or trans-ovarially. As female ticks are extremely fecund, this allows effective dissemination of infectious agents in reservoir populations with which pets and their owners interact.

Rickettsiae are transmitted to humans through the bite of the tick Rhipicephalus sanguineus (family Ixodidae), which parasitizes mainly dogs. Rickettsiae are also transmitted by ticks in a transovarian manner. Therefore ticks represent both a reservoir and a vector of the infection.

Ticks transmit microbes by several routes including salivary secretions, coxal fluids, regurgitation and faeces. Among the biological factors that contribute to the high vector potential of ticks are their living habits and characteristic properties of their saliva secretions and blood digestion.

The major reservoir for these agents is the dog, although other species, such as Lagomorpha (herbivorous mammals resembling rodents, such as rabbits), may play a role. These diseases display a seasonal variation when the ticks are most numerous-that is, during the warm months in temperate areas and throughout the year in tropical areas. Studies suggest that contact with dogs is reported in more than 90% of cases of boutonneuse fever. In central Spain, R. sanguineus ticks removed from dogs tested positive for R. conorii by immunofluorescence in 43% of samples, and 58.6% of the dogs had significant immunofluorescence titers in their serum as well.

Tick-transmitted infections are an emerging problem in dogs. In addition to causing serious disease in traditional tropical and semi-tropical regions, they are now increasingly recognized as a cause of disease in dogs in temperate climates and urban environments. Furthermore, subclinically infected companion animals could provide a reservoir for human tick-transmitted infectious agents, such as Ehrlichia chaffeensis, Ehrlichia ewingii, the Ehrlichia phagocytophila group and Rickettsia conorii.

In 1996, a law was enacted in the United States to thwart terrorists from gaining access to dangerous infectious agents. 57 R. priwazekii [sic] and R. rickettsii, along with 10 other bacteria, were listed as hazardous agents with severe restrictions on their study and transfer to other laboratories. There are several characteristics of potential biologic agents used for terrorism: high and stable infectivity, especially by small-particle aerosol; high level of virulence; low minimum infectious dose; clinical similarity of the bioterrorism agent to more common diseases; difficulty in distinguishing between bioterrorism and natural transmission; low level of immunity in the target population; easy person-to-person communicability; the diagnosis strikes terror in the population; and difficulty of therapy. Furthermore, aerosols containing R. prowazekii, R. typhi, R. conorii, and R. rickettsii have resulted many laboratory infections. Rickettsia can also be preserved stably in a lyophilized state, milled to 1-5 um particles, and treated to prevent electrostatic clumping for aerosol dispersal. The minimum infectious dose (ID50) for some pathogenic rickettsiae is only one or two organisms.

Aerosol: The pathogenic rickettsiae can be aerosolized and illegimately used to inflict severe disease.

The problem of biohazard containment is both technical and architectural. Because rickettsiae are transmissible by parenteral and aerosol routes, these organisms must be handled in a closed room under relative negative pressure with an antechamber. Work should be performed in an appropriate biohazard containment hood, and the laboratory worker should wear mask, gloves, and protective clothing.

Human

Homo sapiens

The worldwide incidence of these R. conorii-mediated diseases is increasing, from 3.28 cases per 100,000 in 1979 to 19.04 per 100,000 in 1984. This may be occurring both from development in endemic areas and from increasing travel to areas where the potential of tick exposure is high, such as on safaris. Although patients may not recall a specific tick bite, they often report a history of travel to an endemic area or exposure to a dog.

The average hospitalization was 10 days. Patients were hospitalized on an average on the 5th day of disease; the correct antibiotic was prescribed on the 6th day; and apyrexia was obtained within 3 days of treatment.

The minimum infectious dose is less than 10 organisms. Pathogenic rickettsiae have a variable incubation period ranging from 3-15 days depending upon the route of rickettsial entry and rickettsial load. Rickettsial species have a minimum infectious dose making them a potential bioterror agent.

It is known that the minimum infective dose for guinea pigs is about 50 organisms for seroconversion, but about 300 organisms are needed to cause a febrile reaction

After introduction into the skin at the site of the infective tick bite or through the conjunctiva contaminated by blood or excretions from an infective tick, the primary multiplication occurs at the site of infection. In the skin, the reaction to the local multiplication of the rickettsiae in the endothelial cells of the capillaries leads to the formation of a raised red papule. The inflammation and thrombosis of the affected capillaries and the effects of the rickettsiae themselves in turn lead to necrosis of the center of the papule and the formation of the typical red lesion with a black center, the tache noire.

The mainstay of prevention entails the avoidance of activity in tick-infested areas and keeping household pets or domestic animals tick free. Tick repellents such as diethyltoluamide or dimethyl phthalate may be helpful, as are protective garments. Ticks require prolonged skin exposure for feeding and disease transmission, so careful skin examination, followed by tick removal without crushing, at least twice a day is recommended in endemic areas.

Clothes and blankets: Ticks survive for many weeks on clothes and blankets. Deticking dogs: Patients will tell of deticking their dogs, sometimes of crushing the tick between their thumb and fingers or between their thumbnails, and sometimes recalling that blood spurted into one of their eyes while doing so.

Due to the grave potential of the disease during pregnancy and the difficulties concerning its treatment, the best strategy to deal with this disease still remain primary prevention. Primary prevention strategies might include avoiding heavily infected areas, restricting domestic animals from living quarters and when necessary covering the person's body with proper clothing.

Tick control using an effective long-acting acaricide, for example fipronil, permethrin or amitraz in spot-on, spray or collar formulation according to manufacturers instructions, remains the most effective preventative measure for this group of diseases. This is particularly the case where unexposed dogs are travelling [sic] into endemic areas or where they are involved in activities where exposure to ticks can be high, such as hunting and herding. Tick eradication is impossible in most situations because of maintenance of the tick life cycle on reservoir hosts.

The best preventive measure against rickettsioses is to avoid typical risk settings when traveling in areas of endemicity. For instance, rodents, dogs, and domestic livestock should not be touched, and bush vegetation likely to be infested with ticks or mites should not be entered. Travelers to regions in which rickettsioses are highly endemic, such as scrub bushes in Southeast Asia and game parks in southern Africa, should be recommended to use protective clothing, preferably impregnated with permethrin or another pyrethroid. Topical repellents should be used on any exposed skin, but because of short-lasting effect against many of the implicated vectors (only 1-2 h for many products, frequent application is recommended. Daily self-checking and removal of ticks and mites during travel should be encouraged.

Weekly 200-mg doses of doxycycline can prevent scrub typhus in military personnel deployed to areas of endemicity and is also likely to be a valuable option for backpackers, trekkers, and other visitors at high risk.

The rickettsiae of tick typhus are not massed together in the cytoplasm of the infected cells as in infections due to R. prowazekii and R. mooseri, but occur evenly scattered in the cytoplasm; R. conorii also invades the nucleus of the host cells, occurring singly or in small clumps.

Once infection has been introduced, local replication occurs at the inoculation site and the organisms spread by lymphohematogenous routes throughout the body. Rickettsiae attach to receptors on endothelial cell membranes, induce phagocytosis, and escape from the phagosome into the cytosol and replicate there by binary fission. The cytopathic effects are in part related to the presence of high quantities of intracellular rickettsiae, which pass into long cell projections and exit by cell lysis distally. Induced phagocytosis of rickettsia has been demonstrated to occur within 3 to 20 minutes of bacterium cell contact, in a study using serial electron microscopy. In addition, within 12 minutes 90% of the rickettsia had escaped from the phagocytic vacuole and were free in the cytosol, presumably by vacuole lysis. In animal models, the spotted fever group of rickettsiae interact with the host cells' intracellular actin pool, based on NBD-phallacidin labeling, to gain motility and the ability to spread intra and extracellularly. Actin polymerization results in propulsion of the rickettsiae and random movements in the cytoplasm, as well as expulsion of the rickettsiae from the cell and infection of adjacent cells. This is in contrast with typhus group rickettsiae, which do not acquire motility and remain sequestered in the cytoplasm until cell lysis.

The clinical manifestations of this group are essentially similar in that typically they show a primary lesion, the tache noire, which develops at the site of the infective bite followed by regional lymphadenitis and systemic manifestations, including headache back-ache, muscle pains, and photophobia, and the development of a maculopapular rash on the third to the fifth day of fever, which lasts 1 to 2 weeks in untreated cases. The rickettsiae of tick typhus are not massed together in the cytoplasm of the infected cells as in infections due to R. prowazekii and R. mooseri, but occur evenly scattered in the cyotplasm; R. conorii also invades the nucleus of the host cells, occurring singly or in small clumps. After introduction into the skin at the site of the infective tick bite or through the conjunctiva contaminated by blood or excretions from an infective tick, the primary multiplication occurs at the site of infection. In the skin, the reaction to the local multiplication of the rickettsiae in the endothelial cells of the capillaries leads to the formation of a raised red papule. The inflammation and thrombosis of the affected capillaries and the effects of the rickettsiae themselves in turn lead to necrosis of the center of the papule and the formation of the typical red lesion with a black center, the tache noire. When the infection is introduced through the conjunctiva, marked inflammation with dilatation of the capillaries associated with swelling and edema of the tissues of the eyelids takes place. The swelling may be so marked as to cause chemosis or closure of the eye. Shallow ulcers may form on the conjunctiva. From the primary site of infection, the rickettsiae then flow with the lymph through the lymph vessels to the regional lymph glands which become enlarged. Microscopic examination may reveal rickettsiae within endothelial cells and macrophages associated with an infiltration of inflammatory cells, mostly mononuclear cells, and a few neutrophil leukocytes in the lymph nodes. The infection then flows into the general circulation, and a rickettsemia ensues with the establishment of numerous foci in the capillaries and vessels of the blood vascular system. Platelets and white cells, especially mononuclear cells, adhere to the vascular surface of the infected endothelial cells, often followed by thrombosis of the affected capillary. This is accompanied by a perivascular infiltration of inflammatory cells, including mononuclear cells, histiocytes, neutrophil leukocytes, and an occasional eosinophil leukocyte. The whole lesion constitutes a "typhus node", which is the unit lesion of the typhus group of fevers in which the pathogenesis and pathology result essentially from vasculitis. In tick typhus the typhus nodes are relatively large than those of epidemic louse-born typhus fever due to R. prowazekii. These nodes are found in the skin and their presence manifests as the rash characteristic of the disease. The individual elements of this rash tend to be coarser than those observed in epidemic typhus fever. In fatal cases numerous nodes are seen in the brain, and their presence and associated inflammation and edema presumably are responsible for the intense headache, delirium, stupor, and coma which may occur in severe cases of tick typhus.

Mediterranean spotted fever usually starts after an incubation period of 7 days followed by a febrile period.

The average time was 6 days (range 1-16 days).

The incubation period from the time of infection to the onset of the general symptoms is usually about 1 week. The patient may complain of intense irritation caused by numerous tick bites, especially on the lower limbs, but more often the patient is unaware of the infecting by numerous tick bites, especially on the lower limbs, but more often the patient is unaware of the infecting bite. During the incubation period of the systemic illness, one or more of these tick bites, the infective tick bite, will develop first into an inflamed red papule, the center of which becomes necrotic and black, to form the characteristic primary sore or tache noire of these diseases. It may be situated anywhere on the surface of the body, but in adults and older children it is most often found on the lower limbs or in the groin or lower abdomen, and in infants and babies it is often in the scalp where it may be difficult to detect because of the hair and relatively dense tissues of the scalp.

Usually this disease has a benign course, a rapidly fatal outcome can occur even in young healthy adults, with an average case-fatality rate of 2.5% (range 0.7-3.5).

The mean age of R. conorii subsp. conorii MSF patients was 54 (range, 26 to 74 years). About 6% of the cases are severe, and fatal cases do occur even in young, healthy adults, with a reported death rate of about 2.5%.

The overall fatality rate is approximately 2%.

A severe form of the disease was observed in 12 cases (6%) and 5 patients died (2.5%). The average hospitalization was 10 days. Patients were hospitalized on an average on the 5th day of disease; the correct antibiotic was prescribed on the 6th day; and apyrexia was obtained within 3 days of treatment.

The mean age was 43.4 years. The risk of MSF detection appeared to be positive for patients under 10 years and over 50 years of age. Risk factors: 37% of the cases lived in rural areas. Patients had direct contact with dogs in 79% of the cases and reported tick contact in 123 cases. The mean hospitalization time was 10.5 days.

Clinical diagnosis of MSF relies on the following symptoms: fever, tache noire, and rash. The absence of tache noire, the characteristic eschar at the site of the tick bite, has been described for Israeli spotted fever.

Most infected individuals do not remember being bitten by a tick. R. conorii infection causes dermal and epidermal necrosis and perivascular edema. Systemic symptoms that are associated with infection typically occur 7 days after incubation and include fever, headache, and myalgias. Disseminated vascular infections and injury can lead to mortality with meningoencephalitis and vascular lesions in the kidneys, lungs, gastrointestinal tract, heart, liver, pancreas, skin, and spleen. Biopsy specimens of the liver show focal hepatocellular necrosis and granuloma- like lesions. R. conorii is associated with a procoagulant state. Consequently, 9.6% of infected patients develop deep venous thrombosis. In some areas of the world, death rates of up to 5.6% of hospitalized patients have been reported. One study analyzed 55 variables regarding epidemiologic, laboratory, clinical, and therapeutic factors in fatal arid nonfatal boutonneuse fever among 105 hospitalized patients. Patients who presented with dehydration, diabetes, uremia, and vomiting had a statistically significant higher risk of death.

The clinical data recovered for the 19 patients suffering from classical Rickettsia conorii subsp. conorii MSF showed that all but 2 had mild forms of disease and 12 had a typical eschar. The mean age of R. conorii subsp. conorii MSF patients was 54 (range, 26 to 74 years). About 6% of the cases are severe, and fatalcases do occur even in young, healthy adults, with a reported death rate of about 2.5%.

There is a high prevalence of antibodies reactive to R. conorii in healthy populations in endemic regions.

The first general symptom of tick typhus is a feeling of unusual tiredness and malaise first noted in the evening. The following morning the patient may feel better but that evening he feels worse and experiences chills, slight anorexia, muscle and joint pains, and headache and develops fever. The fever reaches its highest point on the second or third day and then in typical untreated cases continues for 10 days.

Clinical symptoms of MSF resemble those of Rocky Mountain spotted fever and include fever headache, myositis, myalgia and rash. Severe disease can cause death, mainly in high-risk groups.

Symptoms at onset of MSF 9171 patients)- Fever alone (44%), fever and headache (12%), fever, headache and myalgias (17%), fever and myalgias (8%). Signs and symptoms present during illness, percent of 199 MSF patients, fever (100%), fever greater than 39 (degree C) (80%).

15(100%)

During fever, the outstanding symptom of which the patient complains is an excruciating headache.

Clinical symptoms of MSF resemble those of Rocky Mountain spotted fever and include headache, myositis, myalgia and rash. Severe disease can cause death, mainly in high-risk groups.

56%

87%

Mediterranean spotted fever usually starts after an incubation period of 7 days followed by a febrile period (up to 40 C, usually continuous in type) associated with a maculopapular rash. The rash usually appears within 5 days of fever and is the main clinical feature of the patients. It usually begins on the limbs and then spreads towards the trunk (centripetal). Palms and soles can also be involved. The rash, which is maculopapular, initially may evolve into a petechial form.

In tick typhus the papules of the rash are first noticed on the third to fifth day of illness, and they come out in crops and are palpable as small nodules in the skin. In sever cases the macules are prominent on the skin which has a dusky cyanotic appearance. Characteristically, the rash involves the palms of the hands, the soles of the feet, and to a lesser extent the face.

Any rash (97%); Rash, palms/soles (79%); Rash, petechial (10%); Maculopapular rash (96%).

ISF (5/5), MSF 19/19.

100%.

Cutaneous necrosis caused by rickettsial vascular infection at the tick bite site of inoculation, known as an eschar or tache noire, is observed in less than half of the patients with MSF.

The typical eschar at the site of tick bite may also be seen within first few days of the fever. The typical eschar, the tache noire, is elevated from the surrounding skin, red in color with a black, crusted center, and measures approximately 5 mm. Tache noire results from epidermo-dermal necrosis and the perivascular edema of R. conorii endothelitis.

ISF (2/5), MSF (12/19)

Tache noire (72%), on head (6%), on trunk (30%), on legs and arms (33%), on scrotum (3%).

2(13%).

Myalgia and/or arthralgia and headache were observed in the majority.

36%.

93%.

9.6% of infected patients develop deep venous thrombosis. In some areas of the world, death rates of up to 5.6% of hospitalized patients have been reported.

Clinical symptoms of MSF resemble those of Rocky Mountain spotted fever and include fever, headache, myositis, myalgia and rash. Severe disease can cause death, mainly in high-risk groups.

ISF (2/5), MSF (1/19)

ISF (3/5), MSF (1/19).

ISF (1/5), MSF (1/19).

9%.

20%.

6%.

10%.

11%.

10%.

21%.

13%.

6%.

13%.

0%.

11%.

6%.

The face is flushed, the conjunctivae congested, the tongue coated, and the throat is often slightly inflamed associated with some cervical lymphadenopathy as part of a slight general lymphadenopathy.

2.5%

Hyperemia of tonsillae and pharynx

27%.

Our patients generally had a continuous type of fever and a centripetal type of rash, usually appearing during the second day of the fever. The involvement of the palms and soles and the evolution into the petechial form were observed in nearly one-third of the patients.

27%.

20%.

Thrombocytopenia has been reported in one third of MSF cases.

33%.

A diagnostic scoring system with microbiological, epidemiologic, and clinical parameters has been proposed. This scoring system found that a total score greater than 25 confirms the diagnosis of boutonneuse fever. One study evaluated clinical and epidemiologic factors to help clinicians diagnose boutonneuse fever more efficiently. It was found that a score of 18 corresponded to a low sensitivity (60%) but a high specificity (84.6%), and a score of 17 corresponded to a high sensitivity (85%) but a lower specificity (30%). Since a delay in treatment is directly proportional to increased morbidity, this scoring system may be an excellent tool for difficult diagnoses. The diagnosis is based on careful clinical examination and laboratory studies. Finding a black spot known as tache noire, an eschar at the site of the bite, is very suggestive of R. conorii infection. Biopsy and immunofluoresecent staining of these lesions are the best methods to diagnose boutonneuse fever. Another method of diagnosis is the isolation of R. conorii in a shell vial cell culture system. During the convalescent phase, infection can be determined by serology using microimmunofluorescence, latex agglutination, complement fixation, enzyme immunoassay, or Western blot. A diagnostic scoring system with microbiological, epidemiologic, and clinical parameters has been proposed. This scoring system found that a total score greater than 25 confirms the diagnosis of boutonneuse fever. One study evaluated clinical and epidemiologic factors to help clinicians diagnose boutonneuse fever more efficiently.27 It was found that a score of 18 corresponded to a low sensitivity (60%) but a high specificity (84.6%), and a score of 17 corresponded to a high sensitivity (85%) but a lower specificity (30%). Since a delay in treatment is directly proportional to increased morbidity, this scoring system may be an excellent tool for difficult diagnoses.

Because there is no reliable diagnostic method during the initial phase, clinical diagnosis is essential. In endemic areas, the disease should be considered when a patient is admitted with fever, maculopapular rash, headache, myalgia and/or arthralgia, especially in summer or spring.

A diagnosis of rickettsial disease is based on two or more of the following: 1) compatible clinical symptoms and epidemiologic history, 2) the development of specific convalescent-phase antibodies reactive with a given pathogen or antigenic group, 3) a positive polymerase chain reaction test result, 4) immunohistologic detection of a microorganism, or 5) isolation of a rickettsial agent. Ascertaining the place and the nature of potential exposures is particularly important for accurate diagnosis, as many rickettsial diseases have strong geographic links or are associated with exposure to specific animal reservoir species or arthropod vectors.

The mainstay of treatment of rickettsial infections is prompt recognition and treatment, usually before laboratory diagnosis. The antimicrobials for most rickettsial diseases, including the spotted fever group, are the tetracyclines, with chloramphenicol and the quinalones as second-line agents. With appropriate antimicrobial treatment, fever and acute symptoms should resolve.

Tetracylines are used for the treatment of rickettsial infections and are considered drugs of choice for most rickettsial infections. The US Centers for Disease Control and Prevention (CDC) and some clinicians state that doxycycline is the preferred tetracycline for the treatment of typhus fevers (epidemic typhus, murine typhus), spotted fevers (Rocky Mountain spotted fever, Mediterranean spotted fever, African tick-bite fever, Queensland tick typhus, North Asian tick fever, oriental spotted fever, rickettsialpox, cat flea typhus), scrub typhus, Q fever, and ehrlichiosis (ehrlichosis, Sennetsu fever). For seriously ill patients with suspected rickettsial disease, anti-infective therapy should be initiated based on clinical and epidemiologic evidence while laboratory confirmation is pending. For typhus and spotted-fever group rickettsioses, chloramphenicol may be used if tetracyclines are contraindicated. Tetracyclines in appropriate dosage forms are administered orally, IV, or by deep IM injection.

The initial dose of chloramphenicol is 50 mg/kg and that of tetracycline is 25 mg/kg, followed by a daily dose of the same amount divided into four doses given every 6 hr, or three doses given every 8 hr, and continued for 1 further day after defervescene.

First-line therapy for R. conorii infection is similar to those of other rickettsial infections: tetracycline (25mg/kg/day) or doxycycline (200 mg/day). Other effective regimens are ciprofloxacin (1.5 g/day for 5-7 days) or chloramphenicol (2 g/day for 7-10 days).

Tetracyclines are contraindicated in patients hypersensitive to any of the tetracyclines. Tetracyclines should not be used in children younger than 8 years of age unless other appropriate drugs are ineffective or contraindicated. Tetracyclines can cause fetal toxicity when administered to pregnant women but potential benefits from use of the drugs may be acceptable in certain conditions despite the possible risks to the fetus. Tetracyclines are distributed into milk. Some clinicians recommend that tetracyclines not be used in nursing women, if possible, because of the potential for dental staining in the infant.

All tetracyclines form a stable calcium complex in any bone-forming tissue. As a result, tetracyclines may cause permanent yellow-gray-brown staining of the teeth as well as enamel hypoplasia.

The first-line antibiotics to treat rickettsial diseases are tetracyclines. However, alternatives may be required in the event of tetracyclines intolerance, allergy or contraindications. Tetracyclines are contraindicated during pregnancy for maternal reasons and fetal complications

Although tetracycline is the antibiotic of choice, there may be cases in which its administration is contraindicated, such as patients allergic to tetracycline, pregnant women, infants and children whose teeth have not yet fully developed, and patients exposed to and sensitive to sunlight.

Dizziness, headache, and vertigo have also been reported rarely with other tetracycline derivatives. Some commercially available tetracycline preparations (e.g. doxycycline, minocycline oral suspension, oxytetracycline and tetracycline) contain sulfites that may cause allergic-type reactions, including anaphylaxis and life-threatening or less severe asthmatic episodes, in certain susceptible individuals. Liver toxicity has occurred following IV administration of tetracycline to pregnant women. Some commercially available preparations of tetracycline hydrochloride contain the dye tartrazine which may cause allergic reactions including bronchial asthma in certain susceptible individuals.

2 to 3 days may be necessary to achieve therapeutic concentrations of tetracycline

Resistance to tetracyclines may be natural or acquired. Resistance is usually caused by decreased permeability of the cell surface as a result of mutation or the presence of an inducible plasmid-mediated resistance factor which is acquired via conjugation. Plasmid-mediated resistance can be transferred between organisms of the same or different species. Complete cross resistance usually occurs between demeclocycline, doxycycline

The standard regimen consists of doxycycline, 200 mg daily for 3-14 days, depending on the clinical course. Most patients will improve within the first 24 h after the start of therapy. Chloramphenicol and the newer macrolides are probably good alternatives to doxycycline, whereas fluoroquinolones may fail clinically despite exhibiting good in vitro activity against most rickettsial species, as has been suggested in cases of travel-associated epidemic typhus and murine typhus.

Doxycycline calcium, doxycycline hyclate, and doxycycline monohydrate are administered orally. When oral therapy is not feasible, doxycycline hyclate may be administered by slow IV infusion. To reduce the risk of esophageal irritation and ulceration, capsules containing doxycycline should be administered with adequate amounts of fluids. The usual oral dosage of doxycycline for adults and children older than 8 years of age weighing more than 45 kg is 200 mg on the first day of treatment followed by 100 mg daily given in 1 or 2 divided doses. For severe infections, these patients may receive 100 mg every 12 hours. The usual oral dosage of doxycycline for children older than 8 years of age weighing 45 kg or less is 4.4 mg/kg given in 2 divided doses on the first day of treatment followed by 2.2 mg/kg daily given in 1 or 2 divided doses. For severe infections, oral dosages up to 4.4 mg/kg daily may be used in these children.

All tetracyclines form a stable calcium complex in any bone-forming tissue. As a result, tetracyclines may cause permanent yellow-gray-brown staining of the teeth as well as enamel hypoplasia. Therefore, use of tetracyclines is not recommended in patients in infants and children 8 years of age and younger age unless other medications are unlikely to be effective or are contraindicated.

Doxycycline has replaced Chloramphenicol as the drug of choice. Nonetheless, despite the lack of proven permanent harm with the use of doxycycline during pregnancy, it remains contraindicated

Although, among pregnant women with MSF the treatment of choice is Chloramphenicol, we suggest alternative treatment with Azithromycin as an alternative to Chloramphenicol in pregnant MSF patients due the following characteristics: (1) a proven clinical and laboratory effectiveness in non-pregnant women; (2) its safety when used in pregnant patients and children; (3) the high rate of penetration through the placenta; (4) the increased compliance related to the use of single doses. Likewise, Cohen et al., recommend the use of new generation of macrolides, like Josamycin, as the drug of choice for this indication.

Chloramphenicol should be used only for the treatment of serious infections caused by susceptible bacteria or Rickettsia when potentially less toxic drugs are ineffective or contraindicated. The usual IV dosage of chloramphenicol for adults and children with normal renal and hepatic function is 50 mg/kg daily given in equally divided doses every 6 hours. The IV dosage of chloramphenicol for neonates and children in whom immature hepatic and/or renal function is suspected is 25 mg/kg daily.

Chloramphenicol crosses the placenta. No studies have established the safety and efficacy of chloramphenicol use in pregnancy. Caution should be used in the therapy of premature and full-term infants to avoid toxicity, including gray syndrome.

Some clinicians suggest that the risk of serious, sometimes fatal, adverse effects associated with chloramphenicol therapy be weighed against the risk of tetracycline therapy in children younger than 8 years of age and in pregnant women.

The following regimens are considered equivalent: Ciprofloxacin conventional tablets 250 mg every 12 hours- ciprofloxacin 200 mg IV every 12 hours; ciprofloxacin conventional tablets 500 mg every 12 hours- ciprofloxacin 400 mg IV every 12 hours; ciprofloxacin conventional tablets 750 mg every 12 hours- ciprofloxacin 400 mg IV every 8 hours. The duration of ciprofloxacin therapy depends on the type and severity of infection, and should be determined by the clinical and bacteriologic response of the patient. Ciprofloxacin is administered orally as conventional tablets containing the hydrochloride, as an oral suspension containing the base. IV therapy with the drug is generally reserved for patients who do not tolerate or are unable to take the drug orally.

Ciprofloxacin has been used with some success in a limited number of patients for the treatment of various rickettsial infections. Although tetracyclines generally are the drugs of choice for the treatment of rickettsial infections, some clinicians suggest that either ciprofloxacin or ofloxacin may be considered an alternative for the treatment of these infections when tetracycline cannot be used.

Because of the risk of crystalluria, the manufacturer recommends that the usual dosage of the drug not be exceeded.

Recently, fluoroquinolones have been reported to be effective against rickettsial diseases.

Recently, fluoroquinolones have been reported to be effective against rickettsial diseases. The Image-isomer of ofloxin, levofloxin, is approximately as twice as active as ofloxacin and has improved intracellular pharmacokinetic properties.

However, fluoroquinolones should not be used during pregnancy, because of their mechanism of action (inhibition of nucleic acid formation).

Erythromycin which is a safe drug during pregnancy, was not found effective as an alternative for treatment of rickettsial diseases. Recently, Cohen et al., successfully treated a pregnant MSF patient with a combination of Erythromycin and Rifampicin.

One study showed that azithromycin had similar efficacy and safety compared with doxycycline in children with boutonneuse fever. One study determined that azithromycin and clarithromycin had similar efficacy and safety in children with boutonneuse fever.

Although, among pregnant women with MSF the treatment of choice is Chloramphenicol, we suggest alternative treatment with Azithromycin.

Macrolides, Azithromycin and Clarithromicin, were found to be effective against rickettsial diseases. These drugs inhibit above 50% of the growth of R. conorii at concentration of 1.0mg/l. Azithromycin was successfully used during pregnancy against chlamydial infections and was found to be associated with significantly fewer gastrointestinal side effects as compared to Erythromycin.

These authors believed that azithromycin should be considered since it had a short duration of therapy and could be given in a single daily dose, which would increase compliance in children. A randomized clinical trial has shown that one dose of azithromycin is very efficacious for the prophylaxis of boutonneuse fever.

Another study found that clarithromycin was more effective than chloramphenicol in children with boutonneuse fever. One study determined that azithromycin and clarithromycin had similar efficacy and safety in children with boutonneuse fever.

Macrolides, Azithromycin and Clarithromicin, were found to be effective against rickettsial diseases. These drugs inhibit above 50% of the growth of R. conorii at concentration of 1.0 mg/l.

In particular, treatment of the severe headache is indicated, and this may be alleviated by the administration of aspirin or other analgesics. However, the headache as well as the other signs and symptoms respond within 48 hours of the institution of specific treatment.

Report a model that more closely mimics human rickettsioses and could serve as a faithful model for the study of immunity to intraendothelial infection. C3H/HeN mice inoculated intravenously with either 2.25 x 10(3) or 2.25 x 10(5) Rickettsia conorii (Malish 7 strain) were observed for illness with sacrifice of animals for evaluation of pathologic lesions and host responses by light and electron microscopy, rickettsial content and location by plaque assay, immunohistology, and electron microscopy, and immune response by cytokine analyses and serology. Mice inoculated with a high dose of rickettsiae established disseminated endothelial infection on day 1, became ill with progressive increase in rickettsiae on day 4, and died with vascular injury-based meningoencephalitis and interstitial pneumonia on day 5 or 6. No animals survived the high dose infection. Uninoculated control mice did not become ill. Mice inoculated with the low rickettsial dose became ill on day 5 and recovered by day 10. Examination of the tissues revealed that rickettsial infection was established on day 1, lesions had developed on day 3, and marked reduction of rickettsiae on day 10 was associated with lymphohistiocytic vasocentric infiltrates that had increased further by day 15. Clearance of rickettsiae was associated with lymphohistiocytic perivasculitis. Rickettsial infection of Kupffer cells and hepatocytes led to the formation of transient hepatic granulomas. Infection-associated loss of the ability of spleen cells to secrete interleukin-2 on stimulation with concanavalin A suggested transient immunosuppression. Titration of sera for antibodies to R. conorii by Immunofluorescence antibody assay showed that mice infected with the high dose of inoculum had no antibodies on day 1, a titer of 160 on day 3, and a titer of 640 on day 5. Mice infected with the low dose of rickettsiae had a titer of only 80 on day 5, but the titer rose briskly to 5,120 on day 10 and 10,240 on day 15. Uninoculated control mice had no detectable antibodies to R. conorii. The presence of alpha/beta IFN in the serum on days 1 and 3 and serum antibodies to R. conorii at titers of 160 on day 3 and 640 on day 5 did not prevent the high dose animal's deaths. Infection with 2.25 x 10(3) rickettsiae provides a model of rickettsial disease from which the animals predictably recover. The low dose model of R. conorii infection in mice offers the opportunity to determine the importance of IFN-gamma, tumor necrosis factor-alpha, T helper and t cytotoxic/suppressor lymphocytes, natural killer cells, and other factors by depletion experiments employing monoclonal antibodies. The high dose model in inbred C3H/HeN mice offers the opportunity to evaluated the importance of various cell types and rickettsial epitopes by adoptive transfer of T lymphocyte clones and selected populations of immune lymphocytes. The last time point examined, day 15, rickettsial clearance was associated with regenerative hypertrophy of endothelial cells and evidence of tissue repair such as organizing thrombi. This experimental infection provides the best available model for rickettsial disease with endothelial infection and injury, immune rickettsial clearance, regeneration of endothelium, and repair of the vascular lesions.

Experimental infection model to test the ability of body lice to transmit two prevalent tick-borne rickettsiae. Each of two rabbits was made bacteremic by injecting intravenously 2 x 10(6) plaque-forming units of either R. rickettsii or R. conorii. Four hundred body lice were infected by feeding on the bacteremic rabbit and were compared with 400 uninfected lice. Each louse group was fed once a day on a separate seronegative rabbit. The survival of infected lice was not different from that of uninfected controls. Lice remained infected for their lifespan, excreted R. rickettsii and R. conorii in their feces, but did not transmit the infection to their progeny. The nurse rabbit of uninfected lice remained asymptomatic and seronegative. Those rabbits used to feed infected lice developed bacteremia and seroconverted. Although the body louse is not a known vector of spotted fevers, it was able in our study to acquire, maintain, and transmit both R. rickettsii and R. conorii. Rickettsia rickettsii and R. conorii are principally transmitted to humans by infected ticks, in addition to aerosol transmission and blood transfusion. The infection occurs when humans are bitten by ticks, usually via their saliva. During feeding, the ticks inject virulent rickettsiae contained in their salivary glands. In connection with the important role of the body louse as a vector of rickettsial disease, our objective was to evaluate whether the body louse could acquire a persistent infection with R. rickettsii, R. conorii, or both. Blood was used in PCR assays with primers directed against the ompA gene, which encodes the rickettsial outer membrane protein A. The ompA PCR results were consistently positive until day 21 post-infection on blood drawn from R. rickettsii-infected rabbits and until day 24 post-infection on blood drawn from R. conorii-infected rabbits. All rabbits remained symptomatic throughout the experiment. The results of the ompA PCR performed on blood of nurse rabbits upon which infected lice fed was positive on days 7 and 14 and negative from days 21 to 42. The mean survival of lice infected with R. rickettsii (41.5 days) or R. conorii (40.5 days) did not differ from that of uninfected controls (41.5 days). All surviving and dead lice in all groups were physically indistinguishable, except on days 7 and 8 when 7.5% of R. rickettsii-infected lice and 8.5% of R. conoriii nfected lice died while showing a diffuse reddening throughout the body. We demonstrated for the first time that the transmission of R. rickettsii and R. conorii by the body louse can occur during louse feeding. The nurse rabbits used to feed infected lice developed a bacteremia on days 7 and 14 and seroconverted with an antibody titer of 1:200 on day 42. The intravenously infected rabbits remained bacteremic for 24 hours postinfection, which was surprisingly shorter than what was observed in nurse rabbits. This may be due to consistent reinfection of these nurse rabbits with the infected lice during the daily feedings. We showed for the first time that body lice infected with R. rickettsii or R. conorii are capable of acquiring, maintaining, and transmitting the organisms to naive rabbits during feeding. The nurse rabbits became bacteremic and seroconverted. Moreover, the infected lice excreted these rickettsial cells in their feces. Although the human body louse is not the natural vector of R. rickettsii and R. conorii and its presence does not perfectly coincide with the season of peak occurrence of RMSF or MSF, it may play a role, under favorable epidemiologic circumstances, in their transmission to humans

Dog

Canis familiaris

Rickettsiae are transmitted to humans through the bite of the tick Rhipicephalus sanguineus (family Ixodidae), which parasitizes mainly dogs.

Rickettsia conorii, the agent of boutonneuse fever in humans in southern Europe, the Middle East and southern Africa, is reported to infect dogs, but clinical signs of disease have not been reported.

As part of a study of tick-bite fever in Zimbabwe, the prevalence of antibodies to Rickettsia conorii in dogs and humans was examined. Blood samples were obtained from 184 dogs in different parts of the country and tested by indirect immunofluorescence. In all, 150 (82%) were positive at a titer of 1/40 or higher. Dogs from the south and east of the country showed very high seroprevalence compared with dogs from the main urban centre, Harare. The exact role of dogs and their ticks (Rhipicephalus sanguineus, R. simus and Haemaphysalis leachi) in the epidemiology of human tick-bite fever remains unclear, since dog ticks were seldom found to harbour rickettsia-like organisms and man is not one of their preferred hosts. While dogs may be of little importance in disease transmission, their value as sentinels of spotted-fever group rickettsias in the environment was confirmed. Previous reports have suggested that the dog is a sensitive sentinel for the presence of SFG rickettsias in the USA and Europe but no such studies have been carried out in Africa. Since the causative agent of tick bite fever has been shown to be transmitted by the dog ticks Haemaphysalis leachi and Rhipicephalus sanguineus in South Africa, dogs might similarly be sentinels of the disease in man in Africa. The role of the dog in the epidemiology of tick-bite fever has never been clearly defined. Although there is some evidence that dogs can become rickettsaemic with R. conorii, it is not known whether sufficient organisms are present during the rickettsaemia to infect ticks. Therefore it is uncertain whether dogs actually amplify the infection rate in ticks or merely bring infected ticks into contact with man. Antibodies to R. conorii were found in a high proportion of dogs in each of the area, rural and urban, from which samples were obtained. therefore dogs appear to be readily infected with R. conorii and so can act as sensitive indicators of the presence of SFG rickettsial organisms in an area. In some instances a good correlation was noted between the seroprevalence in dogs and man, while in others the correlation was poor. This suggests that dog seroprevalence should not be used to predict the disease situation in man.

Rabbit

Oryctolagus cuniculus

Wild rabbits--Oryctolagus cuniculi--living in large numbers in a protected zone of Tuscany, the park of Migliarino--San Rossore--Massaciuccoli, showed to be carriers of the hard tick Rhipicephalus pusillus, previously observed in North Africa and Sicily. Antibodies to Rickettsia conorii and R. slovaca were detected in 78.9 per cent of the wild rabbits captured in that area. Seroconversion towards R. conorii was also observed in guinea pigs inoculated with homogenates of R. pusillus parasitizing the wild rabbits. These results identify an ecological niche of rickettsiae of the Spotted fever group in the host-parasite system O. cuniculi/R. pusillus. Attempts to isolate rickettsiae from the ticks and the wild rabbits were unsuccessful both in the egg yolk sac and in the guinea pig. This failure probably shows the low pathogenicity of the rickettsiae parasitizing the biosystem O. cuniculi/R. pusillus

Brown dog tick

Rhipicephalus sanguineus

The major vector of R. conorii in the Mediterranean area is the brown dog tick Rhipicephalus sanguineus.

Rickettsia conorii is transmitted in Europe by Rhipicephalus sanguineus. This dog brown tick is prevalent in Southern Europe and it has been shown that the immature stages (i.e., larva and nymphs) are generally the source of contamination. In fact, immature stages have a maximum activity during the summer in France, Spain, and Crimea, while adults are active in spring. The monthly distribution of cases shows that the apparition of the disease parallels the maximal activity of the immature stages of R. sanguineus.

Rhipicephalus simus

East African tick typhus caused by Rickettsia conorii and transmitted by ixodid ticks, especially by Rhipicephalus simus and Hemaphysalis leachi.

Polymerase chain reaction followed by restriction fragment-length polymorphism analysis on samples of hemolymph-positive ticks showed the agent of Rickettsia conorii to be present in Rhipicephalus simus and Haemaphysalis leachi.

In order to facilitate the isolation and identification of spotted fever group (SFG) rickettsiae from their tick vectors, we used the centrifugation shell vial technique or traditional isolation procedures and genotypic identification using the restriction fragment length polymorphism analysis of polymerase chain amplified fragments. The presence of Rickettsia conorii both in Rhipicephalus sanguineus ticks collected in southern France, and in Rhipicephalus simus and Haemaphysalis leachi from Zimbabwe was demonstrated.

Rhipicephalus pusillus

Haemaphysalis leachi

South African tick-bite fever, the variety of tick typhus occurring in southern Africa caused by Rickettsia conorii var. pijperi and transmitted by ixodid ticks, including species of Rhipicephalus and Amblyomma, the common veld ticks, and H. leachi, the common dog tick in the region. Indian tick typhus caused by rickettsia closely related to R. conorii and transmitted by ixodid ticks, especially species of Hemaphysalis.

Rhipicephalus turanicus

The vectors of R. conorii are the brown dog ticks, Rhipicephalus sanguineus and Rhipicephalus turanicus.

Rhipicephalus pumilio

Astrakhan fever is a summer spotted fever resembling Mediterranean spotted fever, endemic in Astrakhan, a region of Russia located by the Caspian sea. Its agent is a spotted fever group rickettsia, member of the Rickettsia conorii complex, transmitted to humans by Rhipicephalus sanguineus and Rhipicephalus pumilio ticks.

Bont tick

Amblyomma hebraeum

A. hebraeum is known to feed readily on humans and feeding experiments on susceptible hosts have demonstrated that A. hebraeum can maintain spotted fever group rickettsiae transtadially and transovarially and that each feeding stage can transmit the organisms.

The cattle tick, Amblyomma hebraeum, has also been described as a vector of tick-bite fever. Studies at present being carried out in Zimbabwe indicate that A. hebraeum are naturally infected with an RLO (rickettsia-like organism) indistinguishable from R. conorii, and that they are capable of transmitting the infection to rabbits. Since the immature stages of this tick will readily feed on man there is a strong possibility that A. hebraeum is a more important vector of tick-bite fever in Africa than dog ticks.

RLO could be readily isolated from A. hebraeum ticks. These RLO caused a typical febrile and scrotal reaction in guinea pigs and, when inoculated into mice, stimulated antibodies that were indistinguishable from antibodies to a known strain of R. conorii by comparative IFA tests. We would emphasize that we could not in the present experiments unequivocally confirm the isolate to be R. conorii. However, in view of the characteristic fever and scrotal reaction in guinea pigs, the cross-reactivity of our isolate in IFA tests with R. conorii, and the fact that R. conorii is the only spotted fever group rickettsia thus far reliably reported from Africa, we regard, for the purposes of this report, our isolate to be a strain of R. conorii. All stages of A. hebraeum readily feed on cattle and the larval stage is often found on humans.

Biosafety Level 2 practices and facilities are recommended for nonpropagative laboratory procedures, including serological and fluorescent antibody procedures, and for the staining of impression smears. Biosafety Level 3 practices and facilities are recommended for all other manipulations of known or potentially infectious materials, including necropsy of experimentally infected animals and trituration of their tissues, and inoculation, incubation, and harvesting of embryonate eggs or cell cultures. Animal Biosafety Level 2 practices and facilities are recommended for the holding of experimentally infected mammals other than arthropods. Level 3 practices and facilities are recommended for animal studies with arthropods naturally or experimentally infected with rickettsial agents of human disease. Because of the proven value of antibiotic therapy in the early stages of infection, it is essential that laboratories working with rickettsiae have an effective system for reporting febrile illnesses in laboratory personnel, medical evaluation of potential cases and, when indicated, institution of appropriate antibiotic therapy. Vaccines are not currently available for use in humans.

Rickettsial agents can be handled in the laboratory with minimal danger to life when an adequate surveillance system complements a staff which is knowledgeable about the hazards of rickettsial infections and uses the safeguards recommended.

Patients with tick typhus are not infectious, although their blood may be, and quarantine measures are not necessary. however, clothes worn or the blankets used on picknicking or camping expeditions in the bushveld or rural areas may be infested with larval ticks which survive for many weeks and thus may transmit the infection to their wearers or those handling them. ironing with a sufficiently hot iron will kill them and eliminate the danger of infection.

This laboratory has adapted a centrifugation cell culture system, the shell vial assay for isolation of bacteria. This technique is routinely in a biosafety level equipped laboratory for the isolation of rickettsiae and other strictly or facultative intracellular bacteria from tissue biopsies especially tick-bite eschars and blood samples. This study reports the isolation of rickettsiae in clinical specimens using the shell vial culture system. Culture was performed as follows: heparinized blood was sedimented for 1 hour, and 1 ml of the supernatant was collected for inoculation in shell vials; skin biopsy specimens were homogenized in 1 ml of sterile brain heart infusion broth, and the homogenate was aspirated into a 1 ml syringe through a 27 gauge needle to filter out coarse material. Samples were inoculated into shell vials containing a monolayer of human embryonic lung (HEL) fibroblasts grown on a 1 cm(2) coverslip. Three shell vials were inoculated and then centrifuged for 1 hours at 700 x g and 22(degree)C. The brain heart infusion was discarded and replaced with culture medium (Eagle's minimal essential medium with 4% fetal calf serum and 2 mM L- glutamine) and shell vials were incubated at 32(degree)C. Detection of rickettsial organisms on the coverslip was carried out, while it remained inside the shell vial by Gimenez staining and indirect immunofluorescence assay after 3, 6 and 14 days. Immunofluorescence was positive, the culture was reported as positive and culture supernatants were sampled in order to identify the isolate by a specific PCR assay. The remaining supernatants of positive shell vials as well as the third shell vial were inoculated on confluent layers of HEL cells in 25 cm(2) culture flasks in order to propagate isolates. Strains were also adapted to Vero cells and/or L929 cells, which are more conventional for the cultivation of rickettsiae.

Grows in Vero cells at 32 C in antibiotic-free Minimal Essential Medium supplemented with 2 % fetal calf serum and 2mg/ml L-glutamine.

Brain heart infusion broth and Eagle's minimal essential medium

Shell vials were incubated at 32 (degree) C.

Serum samples were tested by indirect immunofluorescence assay (IFA) using commercially available antigens (for R. conorii ref. no. 75901; BioMerieux, marcy l'toile, France). Twofold dilutions of human sera were applied to the antigens. The slides were incubated in a humidified chamber at 37 degrees C for 30 minutes. After washes in PBS-Tween and water to remove unbound immunoglobulins, binding sera was detected by using fluorescein isothiocynate-labelled goat anti-human IgG (BioMerieux). Slides were incubated and washed as described above and were examined with a fluorescence microscope at x400. Endpoint titers were obtained by serial dilution on positive specimens, with titers 1/64 or higher considered indicative of past infection. With respect to R. conorii there is a general consensus in Spain, where R. conorii infection is the most prevalent rickettsiosis, to classify infections as acute when a compatible clinical picture is present together with a single titer of greater than or equal to 1/512, when a fourfold increase in titers is detected between acute and convalescent sera (IFA IgG); past infections are diagnosed when single titers below 1/512 are found.

The serological data we recovered showed that specific antirickettsial Ig determinations had been performed for all of the patients. With the single exception of the patient who died the day after admission, at least two serum samples per patient had been obtained and tested during hospitalization. For four patients, serological tests showed evidence of acute rickettsial infection, e.g., the presence of IgM antibodies, seroconversion, or a fourfold rise in antibody titer against SFG rickettsial antigens. In three cases, sera reacted at high titers with the R. conorii subsp. conorii MAVI strain used for these tests. The two serological tests used were generally in agreement, but the IgG titer (slightly increasing in paired samples) revealed by ELISA for patient 1 was not detected by IIF. The serological data of our patients showed that R. conorii subsp. israelensis produces a clear immunological response, providing evidence for acute rickettsial infection, and that serological tests using R. conorii subsp. conorii antigens are able to detect it, confirming that cross-reactions are common among rickettsiae of the two subspecies. However, in some cases antibodies could be detected only several days after the onset of the disease. Confirmatory diagnosis in the acute phase must rely either on the detection of rickettsiae in the clinical specimens by culture isolation with the shell vial technique, followed by identification using immunohistochemistry or the indirect fluorescent antibody test, or on the detection of rickettsial DNA by PCR. The serological data we recovered showed that specific antirickettsial Ig determinations had been performed for all of the patients. With the single exception of the patient who died the day after admission, at least two serum samples per patient had been obtained and tested during hospitalization.

The laboratory diagnosis is essentially founded on serology. The Weil-Felix test can no longer be considered a desirable test in developed countries because it has been evaluated and considered lacking in sensitivity and specificity. The MIF is sensitive, specific and allows the determination of IgG and IgM. It is necessary to obtain paired sera or to determine IgM levels because antibodies are still present 2 or 3 years after the disease. In this work all the patients were seropositive. Fifty percent were positive (greater than 1:80) on day 10 of the disease, 80% on day 15, and 100% on day 30. However, due to the fact that antibodies appear in 50% of the cases after the 10th day of disease, we use an immunofluorescent technique to demonstrate R. conorii in skin biopsies. This technique is sensitive and specific if carried out before antibiotic treatment, and is useful in severe and atypical cases where diagnostic delay is a lethality factor as in RMSF.

ESS (erythrocyte-sensitizing substance) from R. conorii (Malish strain purified from yolk sacs by renografin density gradient was utilized for a Latex Agglutination (LA) test for Mediterranean spotted fever. Detection of antibodies to ESS coated onto latex beads is technically simple and test results are obtained in less than 1 hr. LA detects both IgG and IgM, but IgM agglutinates antigen-coated beads more effectively. Test results yielded a sensitivity rate of 88.5 to 92.5% and a specificity rate of 99.7 to 100%.

The ompA gene sequence of the Italian clinical isolates of R. conorii subsp. israelensis described in this study has been deposited in GenBank. Rickettsial isolates: Rickettsiae of the spotted fever group were isolated by the shell vial technique from blood samples collected from 24 patients hospitalized for MSF in Palermo, Sicily, Italy, in the years 1987 to 2001. Heavily infected Vero cell monolayers were harvested and stored at -80 C until use. R. conorii subsp. conorii type strain Malish (ATCC VR-613) was used as a control strain. Bacterial DNA was obtained from 200 ul of infected Vero cell suspensions by using the Wizard Plus SV Minipreps DNA Purification System. PCR was performed with the primer pair Rr 190.70p-190.701, which amplifies 632-bp portions of the ompA gene, under conditions described previously. Amplified products were submitted to restriction analysis with endonucleases PstI and RsaI. The observation of a peculiar 3-band PstI restriction profile allowed presumptive identification of five clinical isolates as belonging to R. conorii subsp. israelensis, while the remaining 19 rickettsial isolates were R. conorii subsp. conorii.

Rr 190.70pa:ATG-GCG-AAT-ATT-TCT-CCA-AAA

190-701a,b GTT-CCG-TTA-ATG-GCA-GCA-TCT

A nested polymerase chain reaction (PCR) assay has been developed and used in the diagnosis of fatal and benign cases of Mediterranean spotted fever (MSF). The test was based on specific primers derived from a Rickettsia conorii 17-kD protein gene. A positive signal was obtained from spotted fever group (SFG) and typhus group (TG) rickettsiae. Discrimination between SFG and TG rickettsiae was based on a restriction fragment length polymorphism test. Other gram-negative bacterial species tested did not generate a signal, attesting for the specificity of the assay. The SFG-specific DNA fragment was detected in four of 29 acute-phase sera from serologically confirmed patients with MSF, while acute-phase sera from 25 patients without MSF were PCR negative. Acute-phase sera samples (five of five) and tissue autopsies (six of seven) from fatal suspected cases of MSF were PCR positive. The results demonstrate that sera and tissue samples are suitable specimens for the nested PCR tests, especially in fatal cases.

rickP3 - GGAACACTTCTTGGCGGTG

rickP5 - GCATTACTTGGTTCTCAATTCGG

rickP2 -CATTGTCCGTCAGGTTGGCG

rickP4 - AACCGTAATTGCCGTTATCCGG

The primers rickP3 and rickP2 amplified a 371-basepair (bp) DNA fragment of the 17-kD protein gene of R. conorii (flanking positions 153-523). The primers rickP5 and rickP4 amplified a nested 214-bp DNA fragment (flanking positions 180-393). Other gram-negative bacteria species such as Coxiella burnetii, Ehrlichia canis, E. chaffeensis, HGE agent, Escherichia coli, and Salmonella sp. did not produce any specific DNA fragment with our PCR system, attesting to its high specificity for Rickettsia species.

The sensitivity based on rickP3/rickP2 primers was 100 and 10,000 particles per assay for R. conorii and R. typhi, respectively. The use of a nested PCR test with the rickP5/rickP4 primers increased the detection sensitivity for both Rickettsia species to less than 10 rickettsial particles per assay.

Hechemy

Oteo JA, Raoult D, Silverman DJ, Blanco JR.

New insights into rickettsioses: genomics, proteomics, pathobiology, and the international threat of rickettsial diseases: introduction

Ann N Y Acad Sci

2005 1063 xiii xx

Beati

Kelly PJ, Matthewman LA, Mason PR, Raoult D.

Prevalence of rickettsia-like organisms and spotted fever group rickettsiae in ticks (Acari: Ixodidae) from Zimbabwe

J Med Entomol

1995 32 6 787 792

Marquez-Jimenez

Hidalgo-Pontiveros A, Contreras-Chova F, Rodriguez-Liebana JJ, Muniain-Ezcurra MA.

Ticks (Acarina: Ixodidae) as vectors and reservoirs of pathogen microorganisms in Spain

Enferm Infecc Microbiol Clin

2005 23 2 94 102

Drancourt

Kelly PJ, Regnery R, Raoult D.

Identification of spotted fever group rickettsiae using polymerase chain reaction and restriction-endonuclease length polymorphism analysis

Acta Virol

1992 36 1 1 6

Kelly

Mason PR, Manning T, Slater S.

Role of cattle in the epidemiology of tick-bite fever in Zimbabwe

J Clin Microbiol

1991 29 2 256 259

Ciceroni

Pinto A, Rossi C, Khoury C, Rivosecchi L, Stella E, Cacciapuoti B.

Rickettsiae of the spotted fever group associated with the host-parasite system Oryctolagus cuniculi/Rhipicephalus pusillus

Zentralbl Bakteriol Mikrobiol Hyg [A]

1988 265 2 211 217

Houhamdi

Raoult D.

Experimentally infected human body lice (pediculus humanus humanus) as vectors of Rickettsia rickettsii and Rickettsia conorii in a rabbit model

The American Journal of Tropical Medicine And Hygiene

2006 74 4 521 525

Walker

Popov VL, Wen J, Feng HM.

Rickettsia conorii infection of C3H/HeN mice. A model of endothelial-target rickettsiosis

Laboratory Investigation

1994 70 3 358 368

Fournier

Roux V, Raoult D.

Phylogenetic analysis of spotted fever group rickettsiae by study of the outer surface protein rOmpA

International Journal of Systematic bacteriology

1998 48 839 849

Raoult

Tissot Dupont H, Caraco P, Brouqui P, Drancourt M, Charrel C.

Mediterranean spotted fever in Marseille: descriptive epidemiology and the influence of climatic factors

European Journal of Epidemiology

1992 8 2 192 197

Kelly

Mason PR.

Tick-bite fever in Zimbabwe. Survey of antibodies to Rickettsia conorii in man and dogs, and of rickettsia-like organisms in dog ticks

S Afr Med J

1991 80 5 233 236

Mert

Ozaras R, Tabak F, Bilir M, Ozturk R.

Mediterranean spotted fever: a review of fifteen cases

Journal of Dermatology

2006 2 103 107

Azad

Abdu F

Radulovic S.

Pathogenic Rickettsiae as Bioterrorism Agents

Ann.N.Y.Acad.Sci

2003 990 734 738

Huang DB, Pang KR, Tyring SK.

Rickettsial infections around the world, part 1: pathophysiology and the spotted fever group

J Cutan Med Surg

2005 9 2 54 62

Huang DB, Pang KR, Tyring SK.

Rickettsial infections around the world, part 2: rickettsialpox, the typhus group, and bioterrorism

J Cutan Med Surg

2005 9 3 105 115

Jensenius

Fournier PE, Raoult D.

Rickettsioses and the international traveler

Clin Infect Dis

2004 39 10 1493 1499

Shaw

Day MJ, Birtles RJ, Breitschwerdt EB.

Tick-borne infectious diseases of dogs

Trends Parasitol

2001 17 2 74 80

Kaplan

Other spotted fevers

Clin Dermatol

1996 14 3 259 267

Zhu

Fournier PE, Eremeeva M, Raoult D.

Proposal to create subspecies of Rickettsia conorii based on multi-locus sequence typing and an emended description of Rickettsia conorii

BMC Microbiol

2005 5 1 1 11

Hackstadt

The biology of rickettsiae

Infectious Agents and Disease

1996 5 3 127 143

Bernabeu-Wittel

Del Toro MD, Nogueras MM, Muniain MA, Cardenosa N, Marquez FJ, Segura F, Pachon J.

Seroepidemiological study of Rickettsia felis, Rickettsia typhi, and Rickettsia conorii infection among the population of southern Spain

Eur J Clin Microbiol Infect Dis

2006 25 6 375 381

Raoult

Weiller PJ, Chagnon A, Chaudet H, Gallais H, Casanova P.

Mediterranean spotted fever: clinical, laboratory and epidemiological features of 199 cases

Am J Trop Med Hyg

1986 35 4 845 850

Rehacek

Rickettsiae and their ecology in the Alpine region

Acta Virol

1993 37 4 290 301

Lukin

Vorob'ev AA, Balaeva NM.

Astrakhan fever--a rickettsiosis of the tick-borne spotted fevers caused by a new pathovar of rickettsiae, Rickettsia conorii

Zh Mikrobiol Epidemiol Immunobiol

1996 5 96 99

Vitale

Giustina

Di Stefano R, Damiani G, Mansueto S.

Characterization of Sicilian strains of spotted fever group rickettsiae by using monoclonal antibodies

J Clin Microbiol

1989 27 5 1081 1085

Bentov

Yaakov

Shlomit Kenigsbergb and Moshe Mazora.

Mediterranean spotted fever during pregnancy: case presentation and literature review

European Journal of Obstetrics & Gynecology and Reproductive Biology

2003 107 2 214 216

Leitner

Yitzhaki S, Rzotkiewicz S, Keysary A.

Polymerase chain reaction-based diagnosis of Mediterranean spotted fever in serum and tissue samples

Am J Trop Med Hyg

2002 67 2 166 169

Roux

Veronique

Fournier PE, Raoult D.

Differentiation of spotted fever group rickettsiae by sequencing and analysis of restriction fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein rOmpA

J Clin Microbiol

1996 34 9 2058 2065

Giammanco

Giovanni

Vitale G, Mansueto S, Capra G, Caleca MP, Ammatuna P.

Presence of Rickettsia conorii subsp. israelensis, the causative agent of Israeli spotted fever, in Sicily, Italy, ascertained in a retrospective study

J Clin Microbiol

2005 43 12 6027 6031

Ogata

Hiroyuki

Audic S, Renesto-Audiffren P, Fournier PE, Barbe V, Samson D, Roux V, Cossart P, Weissenbach J, Claverie JM, Raoult D.

Mechanisms of evolution in Rickettsia conorii and R. prowazekii

Science

2001 293 5537 2093 2098

Cory

Yunker CE, Ormsbee RA, Peacock M, Meibos H, Tallent G.

Plaque assay of rickettsiae in a mammalian cell line

Applied Microbiology

1974 27 6 1157 1161

Vestris

Rolain JM, Fournier PE, Birg ML, Enea M, Patrice JY, Raoult D.

Seven years' experience of isolation of Rickettsia spp. from clinical specimens using the shell vial cell culture assay

Annals Of The New York Academy Of Sciences

2003 990 371 374

Segura-Porta

Font-Creus B, Espejo-Arenas E, Bella-Cueto F.

New trends in Mediterranean spotted fever

Eur J Epidemiol

1989 5 4 438 443

McEvoy

Gerald K

Drug Information

McEvoy

Gerald K

AHFS Drug Information

2005 1 3746 Authority of the Board of the American Society of Health-System Pharmacists

Bethesda, Maryland, USA

MICROMEDEX

Drug Information for the Health Care Professional

2001 1 3068 MICROMEDEX

Englewood, Colorado, USA

Walker

David

Laboratory Diagnosis of Rickettsial Diseases

Walker

David H

Biology of Rickettsial Diseases

1988 135 147 CRC Press, Inc.

Boca raton, Florida, USA

Gear

J.H.S

Other spotted fever group rickettsioses: clinical signs, symptoms and pathophysiology

Walker

David H

Biology of Rickettsial Diseases

1988 101 113 CRC Press, Inc.

Boca raton, Florida, USA

Austin

Faye E.

Relationship of rickettsial physiology and composition to the rickettsia-host cell interaction