[Emergent pathogens, international surveillance and international health regulations (2005)]

Lassa virus

Lassa virus belongs to the family Arenaviridae. Arenaviruses are classified as segmented negative-strand RNA viruses. The genes are oriented in both negative and positive senses on the two RNA segments, a coding strategy which is called ambisense. Arenaviridae are phylogenetically closely related to other segmented negative-strand RNA viruses such as the Bunyaviridae and Orthomyxoviridae with which they share basic features of the replication cycle. According to a phylogeny obtained on the basis of conserved amino acid sequences of viral RNA polymerases, Arenaviridae seem to be most closely related to the nairovirus genus of Bunyaviridae. The family Arenaviridae currently comprises 23 virus species. It is serologically, phylogenetically, and geographically divided into two major complexes, the Old World complex (Africa, Europe, and Asia) and the New World complex (North and South America). The Old World complex consists of the prototype arenavirus lymphocytic choriomeningitis virus (LCMV), Lassa virus, Mopeia virus, Mobala virus, and Ippy virus. The New World complex is larger and includes for example Tacaribe virus, Pichinde virus, Junin virus, Machupo virus, Sabia virus, and Guanarito virus.

The arenaviruses have been classified according to their antigenic properties into two groups: the Tacaribe serocomplex (including viruses indigenous to the New World) and the Lassa-Lymphocytic choriomeningitis serocomplex (including the viruses indigenous to Africa and the ubiquitous Lymphocytic choriomeningitis virus [LCMV], recognized as the Old World group). Specific rodents are the principal hosts of the arenaviruses. Humans usually become infected through contact with infected rodents or inhalation of infectious rodent excreta or secreta. At least 9 arenaviruses are associated with human disease, of which five - Lassa (LASV), Junin, Machupo, Guanarito and Sabia - are known to cause severe hemorrhagic fever in western Africa, Argentina, Bolivia, Venezuela and Brazil, respectively. The other four arenaviruses are LCMV (causing acute central nervous system disease and congenital malformations), Flexal and Tacaribe viruses (febrile illnesses in laboratory workers) and, more recently, Whitewater Arroyo virus associated with fatal cases of infection in California. The five arenaviruses causing viral hemorrhagic fever are included in the Category A Pathogen List, considered as Select Agents as defined by the CDC, and listed as Biosafety Level 4 agents.

Phylogenetic analyses showed that Lassa viruses comprise four lineages, three of which are found in Nigeria and the fourth in Guinea, Liberia, and Sierra Leone.

Lassa virus (STRAIN GA391)

GA391 is of Nigerian origin.

Lassa virus (strain Josiah)

Strain Josiah was isolated in Sierra Leone.

Mopeia Lassa reassortant 29

Reassortants with a mixed phenotype were produced by combined inoculation of Vero cells with Lassa and Mopeya viruses. These reassortants produced small plaques (Mopeya virus phenotype) and were not pathogenic for newborn mice (Lassa virus phenotype). The genotype of the reassortants was studied by dot hybridization experiments on filters using cDNA-probes differentiating genome segments of these viruses. The reassortants were shown to have Mopeya virus L-RNA and Lassa virus S-RNA.

Lassa virus (LASV) and Mopeia virus (MOPV) are closely related Old World arenaviruses that can exchange genomic segments (reassort) during coinfection. Clone ML29, selected from a library of MOPV/LASV (MOP/LAS) reassortants, encodes the major antigens (nucleocapsid and glycoprotein) of LASV and the RNA polymerase and zinc-binding protein of MOPV. Replication of ML29 was attenuated in guinea pigs and nonhuman primates. In murine adoptive-transfer experiments, as little as 150 PFU of ML29 induced protective cell-mediated immunity. Thus, ML29 is a promising attenuated vaccine candidate for Lassa fever.

Morphologically, arenavirus virions consist of enveloped particles that vary in diameter from approximately 60 to more than 300 nm, with a mean particle size of 92 nm as determined by electron microscopy.

The virions are approximately spherical, enveloped particles that range in diameter from 50 to 300 nm. The surface of the virion is smooth with T-shaped spikes, composed of viral glycoproteins, extending 7-10 nm from the envelope.

Lassa virus enters the cell via the receptor molecule alpha-dystroglycan. Replication and transcription of the genome takes place in the cytoplasm of an infected cell. During genome replication, a full-length copy of the genomic S and L RNAs is synthesized yielding the corresponding antigenomic S and L RNAs. Expression of proteins requires transcription of mRNA from both the genomic and antigenomic RNA within a ribonucleoprotein complex. NP is the most abundant protein of the ribonucleocapsid, followed by Z protein and L protein. NP and L protein are sufficient for genome replication and transcription. Besides of a structural function-Z protein may function analogous to matrix proteins-it seems to have a regulatory function during infection due to its interaction with a variety of cellular proteins. The large L protein most likely represents the viral RNA-dependent RNA polymerase. Within a central domain, it shares conserved motifs with the catalytic domain of other viral RNA polymerases. GPC is directed posttranslationally into the endoplasmic reticulum. Cleavage of GPC into GP1 and GP2 occurs at a later stage of the secretory pathway. The cellular protease SKI-1/S1P was shown to be responsible for cleavage. Cleavage of GPC is required for incorporation of glycoproteins into the virion envelope and thus for release of infectious Lassa virus. The glycoproteins are transported to the cell membrane where budding and release of the virus takes place.

Arenaviruses belong to the segmented negative-strand RNA viruses. The genome of Lassa virus, like that of other arenaviruses, consists of two single-stranded RNA segments. The small (S) segment is 3.4 kb in length, and the large (L) segment is 7 kb in length. Each segment contains two genes, one in sense orientation and one in antisense orientation, a coding strategy that is called ambisense. The S RNA encodes the 75-kDa glycoprotein precursor (GPC) and the 63-kDa nucleoprotein (NP). GPC is posttranslationally cleaved into GP1 and GP2. The L RNA encodes the 11-kDa Z protein, which binds zinc and acts as a matrix protein, and the 200-kDa L protein, which is likely to function as the viral polymerase. The genes are separated on each RNA segment by an intergenic region (IGR) that predictably folds into a stable secondary structure. The terminal 19 nucleotides at the 3' and 5' ends of the RNA segments are complementary to each other and are highly conserved among all arenaviruses. The termini are essential for replication and transcription and are believed to function as a binding site of the viral polymerase. Replication and transcription of the genome occur in the cytoplasm of an infected cell and both take place within ribonucleoprotein complexes. During genome replication, a full-length copy of genomic S and L RNAs is synthesized, yielding the corresponding antigenomic S and L RNAs. Due to the ambisense coding strategy, both genomic and antigenomic RNA serve as templates for the transcription of viral mRNA. The transcripts contain a cap but are not polyadenylated. They terminate within the IGR, suggesting that this element plays a role in transcription termination.

There are minor differences in the lengths of the genomic RNA segments for the individual viruses (L approximately 7,200 bases and S approximately 3,400 bases), but the general organization of the viral genomes, based on current sequence information, is well preserved across the virus family.

7279 bp ss-RNA

2 genes

The large (L) genomic segment encodes the viral RNA-dependent RNA polymerase and a zinc-binding matrix protein, acting as a bona fide matrix protein. The genes on both S and L segments are separated by an intergenic non-coding region with the potential to form one or more hairpin configurations. The 5' and 3' ends of each RNA segment possess a relatively conserved reverse complementary sequence spanning 19 nucleotides at each extremity.

3402 bp ss-RNA

2 genes

The S segment encodes the nucleocapsid protein (NP) in negative, antimessage sense at the 3'-end and the viral glycoprotein precursor, GP-C in message sense at the 5'-end. Posttranslational modification of the cell-associated GP-C precursor yields the structural glycoproteins GP-1 (44 kd) and GP-2 (35 kd), which are assembled into a tetrameric virion spike. GP-1 contains determinants that interact with viral receptors and is recognized by neutralizing antibody. GP-2 contains sites that promote acid-dependent membrane fusion necessary for viral entry.

Reassortants with a mixed phenotype were produced by combined inoculation of Vero cells with Lassa and Mopeya viruses. The genotype of the reassortants was studied by dot hybridization experiments on filters using cDNA-probes differentiating genome segments of these viruses. The reassortants were shown to have Mopeya virus L-RNA and Lassa virus S-RNA.

ML29 contains the L RNA from MOPV and the S RNA segment from LASV.

7271 bp ss-RNA

2 genes

ML29 contains the L RNA from MOPV

3,402 bp ss-RNA

2 genes

ML29 contains the S RNA segment from LASV. The LASV S segment constitutes only a third of the entire ML29 genome and does not carry direct virulence determinants.

For many VHFs, primary infection of humans is not a common event. With the exception of the mosquito-borne flaviviruses (dengue and yellow fever), which has an entirely different epidemiology, the common feature among the viruses that cause the largest epidemics is their capacity for person-to-person spread, particularly in medical settings where hygiene practices are poorly applied or ignored.

Lassa fever is most commonly diagnosed in parts of West Africa where it is endemic. The number of Lassa virus infections per year in West Africa is estimated at 100 000 to 300 000, with approximately 5000 deaths.

The disease and the virus are named after a small town in the North of Nigeria, where the virus has been isolated and described as the causative agent of Lassa fever. It is surprising how precisely the first report described symptoms, transmission route, incubation time, and public health implications of the disease based on three cases. The disease is endemic in several countries of West Africa, namely Sierra Leone, Guinea, Liberia, and Nigeria. A case of Lassa fever imported to Europe in the year 2000 indicates that the virus (and probably the disease) is endemic in larger areas of West Africa. Since the index patient traveled through Ghana, Cote D'Ivoire, and Burkina Faso during the incubation period, it was not possible to exactly determine the origin of the infection.

Lassa fever is endemic in West Africa and has been reported from Sierra Leone, Guinea, Liberia, and Nigeria. The geographically restricted occurrence of the disease is not well understood as its rodent host (Mastomys species) is prevalent in much larger areas of sub-Saharan Africa. The importation of Lassa virus into other regions, for example by travelers, is rare, with only a few cases documented.

The first documented outbreak of Lassa fever was hospital associated and took place in 1969 in Jos, northern Nigeria. Subsequently Lassa virus antibodies were detected in 357 of 1677 (21.3%) serum samples from Nigeria. Sporadically, patients with Lassa fever are admitted to local hospitals. The seeding of Lassa infection in hospital patients that initiated several generations of amplification, culminating in infection and death of medical staff was observed during the outbreak. These outbreaks illustrate the high price exacted by introducing modern medicine, particularly parenteral drugs and surgery, without due attention to good medical practice.

In 1997, the World Health Organization (WHO) reported that Lassa fever outbreak was continuing in the Kenema District (Sierra Leone). Between January 1996 and 19 April 1997, a total of 799 cases were admitted to hospital in the Kenema District and 148 (18.5%) died. Of these cases, 267 had occurred since 1 January 1997. This outbreak was first reported in May 1996 in an area where Lassa fever is endemic and coincided with an increase in the rat population of the affected towns. A WHO mission investigated the situation in the Kenema District from 14 to 21 February to redirect control activities, review existing surveillance activities, identify future needs and prepare a plan of action.

The Kenema Government Hospital, Sierra Leone, reported an outbreak of Lassa fever in the winter of 2004, affecting patients from the paediatric ward, and claiming the lives of several health-care workers. The majority of cases occurred in young children, many of whom were referred directly from the paediatric ward, a pattern not previously observed. WHO sent a field investigation team to Kenema to assist Ministry of Health and Sanitation officials in assessing the situation and containing further spread. Between 1 January and 24 April 2004, 95 paediatric cases were admitted, 78% of whom were patients referred from the paediatric ward to the Lassa ward, compared with only 17% in 2003. The mean age of cases was 18 years, with half of all cases aged under 15 years; 50% were female. The case fatality rate was 30-50% in children aged under 5 years and 71% in children aged under 1 year.

Mastomys

Human

Lassa fever is caused by Lassa virus, a member of the arenavirus group, which is transmitted to human beings from the rodent reservoir host, Mastomys natalensis, by direct contact with infected tissues or indirectly, possibly by food contaminated with excreta, and possibly by aerosols arising from these animals.

The host, Mastomys natalensis, is a common commensal rodent in village houses, and therefore primary human infections are common.

Mastomys shed the virus in urine and contamination of unprotected food is a likely mode of transmission. Lassa virus can be transmitted via air between laboratory animals, and aerosol stability of Lassa virus has been proven experimentally. Rodents serve as a food source in Lassa fever endemic regions. Hunting and consumption of the animals, which is associated with a close contact with the rodent, is a risk factor for Lassa virus transmission.

The infection is thought to spread to the human population by inhalation of dust infected urine.

Human Human

Lassa fever may also spread through person-to-person contact. This type of transmission occurs when a person comes into contact with virus in the blood, tissue, secretions, or excretions of an individual infected with the Lassa virus. The virus cannot be spread through casual contact (including skin-to-skin contact without exchange of body fluids). Person-to-person transmission is common in both village and health care settings, where, along with the above-mentioned modes of transmission, the virus also may be spread in contaminated medical equipment, such as reused needles. This is called nosocomial transmission.

In Africa, secondary infections from human to human occur frequently in the hospital setting causing epidemics with high fatality. Poor medical practice is one reason for nosocomial spread of the virus.

Nosocomial epidemics are often associated with high case fatality rates. Strains with increased virulence may be involved, although there is no evidence supporting this speculation. Poor medical practice is one reason for nosocomial spread of the virus, and hospital staff is often affected by the epidemic. This is consistent with an increased prevalence of Lassa virus antibodies in ward aids. The virus is probably transmitted via body fluids; there is so far no evidence that aerosols play a role in humanto-human transmission. In agreement with this assumption, introduction of simple barrier nursing techniques (gloves, paper masks, and gowns) and adherence to minimal standards of hygiene (disinfection with bleach) can effectively prevent transmission of Lassa virus in the hospital setting in Africa. Political conflicts in West Africa, like the civil unrest in Sierra Leone, facilitate outbreaks of Lassa fever (improper food storage, break-down of the health system). Under these circumstances, foreign military personnel, peacekeepers, and aid workers who are on duty in these regions are also at risk of contracting the disease.

Mastomys

Lassa virus, like LCMV, induces chronic viremic infection in neonatal Mastomys and transient, immunizing infection in adults. This type of infection, which is also efficiently transmitted to the fetus, would favor a maintenance cycle in which congenital, vertical transmission is the major feature.

The natural hosts for the virus are multimammate rats (Mastomys natalensis), which breed frequently and are distributed widely throughout west, central, and east Africa. They are probably the most common rodent in tropical Africa and are found predominantly in rural areas, and in dwellings more often than in surrounding countryside. Members of the genus are infected persistently and shed the virus in their excreta. Humans are infected by contact with the rats or by eating them (they are considered a delicacy and are eaten by up to 90% of people in some areas). Rats found in houses of infected people are seropositive for the virus 10 times more often than those in control houses.

The natural hosts for the virus are multimammate rats (Mastomys natalensis), which breed frequently. Members of the genus are infected persistently and shed the virus in their excreta.

Studies of wild-caught Mastomys show that over half the captured animals in some foci may be chronically infected, and antibody and virus may be present at the same time in about one-third of these.

Hemorrhagic fever viruses have been weaponized by the former Soviet Union, Russia and the United Staes. Several studies have demonstrated successful infection of nonhuman primates by aerosol preparations of Ebola, Marburg, Lassa, and New World Arenaviruses.

Severe multi-organ involvement occurs in 5-10% of infections and case fatality rates for hospitalized patients range from 15% to 25%. The virus is transmitted by the respiratory route and by direct contact with contaminated materials. The potential use of hemorrhagic fever (HF) viruses as agents of biological warfare (BW) is a growing concern. Because of the ability of Lassa virus to spread from person to person, risk of its importation by international travel, and renewed threats about the potential use of HF viruses for BW.

If clinicians feel that VHF is a likely diagnosis, they should take two immediate steps: 1) isolate the patient, and 2) notify local and state health departments and CDC. Report incidents to state health departments and the CDC (telephone {404} 639-1511; from 4:30 p.m. to 8 a.m., telephone {404} 639-2888). Information on investigating and managing patients with suspected viral hemorrhagic fever, collecting and shipping diagnostic specimens, and instituting control measures is available on request from the following persons at Centers for Disease Control (CDC) in Atlanta, Georgia; for all telephone numbers, dial 404-639 + extension: Epidemic Intelligence Service (EIS) Officer, Special Pathogens Branch (ext. 1115), Division of Viral Diseases, Center for Infectious Diseases (ext. 1344); Chief, Special Pathogens Branch, Division of Viral Diseases, Center for Infectious Diseases: Joseph B. McCormick, M.D. (ext. 3308); Senior Medical Officer, Special Pathogens Branch, Division of Viral Diseases, Center for Infectious Diseases: Susan P. Fisher-Hoch, M.D. (ext. 3308); Director, Division of Viral Diseases, Center for Infectious Diseases (ext. 3574). After regular office hours and on weekends, the persons named above may be contacted through the CDC duty officer (ext. 2888).

The Global Outbreak Alert and Response Network (GOARN) was established in April 2000. In 2001, the World Health Assembly recognizing the threats to public health posed by epidemic prone and emerging infections, adopted the resolution "global health security - epidemic alert and response" urging WHO and its Member States to improve national and global efforts in communicable disease surveillance and control. The Global Outbreak Alert and Response Network (GOARN), coordinated from the operations centre based at the WHO Geneva, is a technical collaboration of some 110 international institutions and networks which pool human and technical resources for the rapid identification, confirmation and response to outbreaks of international importance. The Network provides an operational framework to bring expertise and skill to affected populations, thereby improving epidemic response to keep the international community constantly alert to the threat of outbreaks and ready to respond. GOARN to date is primarily a response mechanism, identification and verification is done by WHO.

The VHF agents are all highly infectious via the aerosol route, and most are quite stable as respirable aerosols. This means that they satisfy at least one criterion for being weaponized, and some clearly have the potential to be biological warfare threats. Most of these agents replicate in cell culture to concentrations sufficiently high to produce a small terrorist weapon, one suitable for introducing lethal doses of virus into the air intake of an airplane or office building. Some replicate to even higher concentrations, with obvious potential ramifications. Since the VHF agents cause serious diseases with high morbidity and mortality, their existence as endemic disease threats and as potential biological warfare weapons suggests a formidable potential impact on unit readiness. Further, returning troops may well be carrying exotic viral diseases to which the civilian population is not immune, a major public health concern.

Patients with VHF syndrome generally have significant quantities of virus in their blood, and perhaps in other secretions as well (with the exceptions of dengue and classic hantaviral disease). Well-documented secondary infections among contacts and medical personnel not parenterally exposed have occurred. Thus, caution should be exercised in evaluating and treating patients with suspected VHF syndrome. Over-reaction on the part of medical personnel is inappropriate and detrimental to both patient and staff, but it is prudent to provide isolation measures as rigorous as feasible. At a minimum, these should include the following: stringent barrier nursing; mask, gown, glove, and needle precautions; hazard-labeling of specimens submitted to the clinical laboratory; restricted access to the patient; and autoclaving or liberal disinfection of contaminated materials, using hypochlorite or phenolic disinfectants. For more intensive care, however, increased precautions are advisable. Members of the patient care team should be limited to a small number of selected, trained individuals, and special care should be directed toward eliminating all parenteral exposures. Use of endoscopy, respirators, arterial catheters, routine blood sampling, and extensive laboratory analysis increase opportunities for aerosol dissemination of infectious blood and body fluids. For medical personnel, the wearing of flexible plastic hoods equipped with battery-powered blowers provides excellent protection of the mucous membranes and airways.

Human

Homo sapien

The proportion of hospital admissions due to Lassa fever is 10%-16% in Sierra Leone, 0%-15% in Guinea and 14.3% in Liberia. In the endemic situation, the case fatality rate in hospitalized patients with Lassa fever ranges from 9.3% to 18%. However, during a community-based or nosocomial outbreak, the case fatality rate is higher, ranging from 36% to 65%. The prevalence of antibodies to Lassa virus in the general population varies greatly (from 1.9% to 55%) among different regions or even villages within the endemic countries. Longitudinal studies in selected villages in Sierra Leone revealed a high incidence of Lassa virus-specific seroconversion (5%-20% per year) in susceptible (i.e., antibody negative) individuals. However, the majority of these subjects did not report a febrile illness temporally associated with seroconversion. This is in agreement with the high seroprevalence of Lassa virus-specific antibodies in the general population, and indicates that most Lassa virus infections are mild or even asymptomatic. Based on these data, it was estimated that about 100,000-300,000 people become infected annually in the endemic regions with an overall fatality rate of 1-2%; much lower than the fatality rate among hospital admissions. However, two aspects should be taken into account in these estimates. First, about 6% of Lassa virus antibody positive patients become antibody-negative per year. Thus, a fraction of asymptomatic seroconversions may be in fact reinfections of subjects with at least partial immunity rather than de novo infections. Secondly, because of the extensive crossreactivity among African arenaviruses, Lassa virus-based serological tests are likely to detect also antibodies elicited by closely related viruses. Although there is no evidence for co-circulation of other arenaviruses in the Lassa virus endemic regions, it could be that infections with related viruses contribute to prevalence and incidence determined serologically with Lassa virus antigen.

1 -10 organisms

Under natural circumstances, infection with Lassa virus occurs through contact with M. natalensis or its excreta, probably within the household. Subsequent person-to-person transmission occurs, although it is difficult to distinguish epidemiologically between these two modes of infection. Person-to-person spread requires close personal contact or contact with blood or excreta. Careful follow-up of household and other close contacts of cases imported into western Europe and North America has not shown any evidence of secondary transmission from casual contact. Early reports of Lassa fever stressed the high infectivity of the condition and the risks of nosocomial transmission. Recent evidence shows that avoiding direct contact with infected tissue, blood, secretions, and excretions, even in poorly equipped rural African hospitals, virtually eliminates the risk of infection.

Despite Lassa fever being endemic over a large area for centuries or longer, the earliest cases of Lassa fever reported were associated with hospital transmission. Contact in households with persons ill, or recently ill with Lassa fever, as well as sexual contact with someone convalescent with Lassa fever is also an important risk factor for human-to-human transmission. Nosocomial transmission to hospital staff or other patients has been frequently recorded. It is well documented that person-to-person transmission in a hospital setting may be effectively prevented with simple barrier nursing techniques, available to most hospitals or clinics in many rural areas. These basic rules, however, may not be observed or even understood. Hospital outbreaks of Lassa fever have been consistently associated with inadequate disinfection, ill-advised surgery on patients with abdominal pain and fever, direct contact with infected blood and contaminated needles, indiscriminate use of needles for intravenous therapy or intramuscular injections along with inadequate needle and syringe sterilization. These epidemics can be devastating, resulting in the deaths not only of patients but also of medical staff, surgeons, nurses and other scarce personnel.

As the chief mechanism of transmission to humans involves contamination of food with virus-containing urine from the wild rodent reservoir, preventive measures must include both rodent control and protection of stored foods. Rodent control may generally be achieved by trapping or poisoning. Great care must be exercised when handling trapped animals which may have urinated in fright and, in the process, contaminated the traps with Lassa virus. In a case-control study it was shown that a 2 to 3 fold reduction of rodents obtained by trapping was insufficient to significantly reduce the Lassa seroconversion rate of people in the houses where trapping had been done. The use of rodenticides may be preferred but is associated with danger to children and domestic animals if not practiced with care. Rodent-proofing of food storage facilities may be more successful in the long term. This requires education, appropriate technology, and materials.

Trapping of rodents in half of the case and control houses resulted in a Mastomys reduction ranging from 2.2- to 3.3-fold. This reduction failed to significantly reduce the seroconversion rate to Lassa virus in the people of trapped houses compared to those in untrapped ones.

Strict barrier-nursing techniques should be enforced: all persons entering the patient's room should wear disposable gloves, gowns, masks, and shoe covers. Protective eye wear should be worn by persons dealing with disoriented or uncooperative patients or performing procedures that might involve the patient's vomiting or bleeding (for example, inserting a nasogastric tube or an intravenous or arterial line). Protective clothing should be donned and removed in the anteroom. Only essential medical and nursing personnel should enter the patient's room and anteroom. Isolation signs listing necessary precautions should be posted outside the anteroom (MMWR 1988).

In recent years an increasing number of outbreaks of filovirus infections have occurred in Africa and in 2000, 5 cases of Lassa fever were brought from Sierra Leone to Europe. Therefore European physicians should consider the possibility of a viral haemorrhagic fever in an acutely ill patient just returning from Africa or South-America with fever for which there is no obvious cause. Such patients should be questioned for risk factors for viral haemorrhagic fever. Using universal precautions for handling blood and body fluids and barrier nursing techniques there is little risk that if a patient with viral haemorrhagic fever arrives in Belgium there will be secondary cases.

Pathogenesis of arenavirus diseases is believed to involve initial replication at the site of infection, in nonreservoir hosts usually following aerosol deposition in the lung. The hilar lymph nodes are an important site of virus growth, as are the lung, and later, other parenchymal organs. Pneumonic foci are usually not present, although interstitial infiltrates and edema may occur during the course of infection. In infections by any route, the macrophage is usually identified as an early and prominent cell involved. As infection spreads, additional cell types reach equal prominence. Many epithelial structures are readily identified as containing antigen and nucleic acids. Widespread infection of the marginal zone and necrosis of lymphoid follicles of the spleen and lymph nodes is a common lesion with the potential to blunt an effective curative immune response and is associated, at least in the adult-infected LCM mouse, with CTL destruction of critical antigen-presenting lymphoid cells. In spite of the extensive involvement of different cell types throughout the body, the pathologic changes are relatively subtle with comparatively little frank necrosis.

The pathogenesis of Lassa fever is still poorly understood. Humans often die without bleeding, and pathological and histopathological lesions do not appear severe enough to explain organ failure and death. Macroscopic changes include pulmonary edema, pleural effusion, ascites, and signs of hemorrhage from the gastrointestinal mucosa. Microscopic lesions include hepatocellular necrosis (1%-50% of hepatocytes) with a phagocytic macrophage reaction but with absent or minimal lymphocyte infiltration, splenic necrosis, renal tubular injury, interstitial nephritis, interstitial pneumonitis, and myocarditis. No lesions were detected in the central nervous system. Similar, though not identical, pathological changes are seen in animal models of Lassa fever, Lassa virus-infected monkeys (baboons, rhesus and squirrel monkeys) and inbred guinea pigs (strains 2 and 13). Pathological and histopathological investigation in these animal models did not provide a clue as to the cause of death due to Lassa virus. Histopathologically the liver is a major and most consistently affected target organ in humans. This is also evidenced by elevations of aspartate transaminas (AST) and alanine transaminase (ALT) in serum. However, unlike a typical acute viral hepatitis, the AST is much higher than the ALT both in humans and monkeys, suggesting that the enzyme elevations do not solely reflect liver cell damage. Indeed, the virus shows a broad tropism. It can be isolated from virtually all organs (liver, lung, spleen, kidney, adrenal, pancreas, heart) in humans and animals models, with the lowest titers being found in the central nervous system. The pantropism may be explained by the high affinity of Lassa virus for the receptor alpha-DG that is expressed in most tissues. Lassa fever seems not to be associated with a decrease in the coagulation factors or disseminated intravascular coagulation in humans and animal models. However, some functional haematologic disturbances have been found by in vitro tests, namely suppressed platelet and neutrophil function due to unknown inhibitor(s) in the plasma of patients with severe Lassa fever. The titer of virus in serum correlates with the risk of death, suggesting that the level of virus replication is involved in the pathophysiology. In view of the paucity of pathological changes it is likely that virus replication does not directly cause shock and death, but rather triggers a pathophysiological cascade. One hypothesis is that deregulated cytokine expression similar to what is seen in sepsis or severe inflammatory response syndrome (SIRS) is involved in the pathogenesis. This view is supported by longitudinal measurements of cytokines in a case of imported Lassa fever. In this patient, who died from organ failure and hemorrhagic shock, death was preceded by a rise in the proinflammatory cytokines tumor necrosis factor alpha (TNF-alpha) and IFN-gamma , while the plateau of viremia was reached earlier. However, another study that sampled twice during the course of the disease found no evidence for elevated TNF-alpha and IFN-gamma levels in fatal Lassa fever. The results of these studies suggest that TNF-alpha and IFN-gamma are elevated only in a fraction of patients with fatal Lassa fever or only during a short window period before death (requiring sampling in short intervals). In vitro experiments suggest that virus-induced immunosuppression might play a role in the pathogenesis of Lassa fever. Human monocyte-derived dendritic cells are infectable by Lassa virus, but fail to secrete proinflammatory cytokines (TNF-alpha, IFN-gamma , interleukin [IL]-1b, IL-2, IL-6, IL-10, IL-12), do not up-regulate costimulatory molecules (CD40, CD80, CD86), and poorly stimulate proliferation of T cells. However, the relevance of these findings for pathogenesis is difficult to assess since apathogenic arenaviruses were not included as a control. In a similar set of experiments, Lassa virus replication in monocytes/ macrophages also failed to stimulate TNF-alpha gene expression and suppressed IL-8 expression, but the same effect was seen with the apathogenic Mopeia virus. In contrast to monocytes, IL-8 release by human endothelial cells was specifically suppressed by Lassa virus replication in these cells. This effect was not observed upon infection with Mopeia virus. A factor that might further modulate the effects of Lassa virus replication in monocytic cells could be Lassa virus-specific antibodies. Specific antiserum dramatically enhanced virus replication in a monocytic cell line, probably due to enhanced uptake of antibody-complexed virus particles. These in vitro experiments, suggesting downregulation of the immune response due to Lassa virus infection, are consistent with a study in Lassa fever patients which found that fatal outcome of Lassa fever correlates with low levels of circulating IL-8 and IFN-inducible protein-10. Furthermore, there is evidence of impaired B cell response in patients who die from Lassa fever. Lethally infected patients produce significantly lower titers of specific antibodies than those who survive, or they do not show an antibody response at all. Testing of different Lassa virus strains in guinea pigs suggests that Lassa virus isolates differ in virulence potential. With the exception of isolates from pregnant women and newborns, the spectrum of virulence that was observed in the animal model correlated approximately with the disease severity observed in the human patients. Some isolates from lethally infected pregnant women and infants were totally benign for guinea pigs, indicating that in these cases host factors (immunosuppression) are more important for the outcome of infection than virulence factors. The genetic determinants of the differences of Lassa virus virulence are not known. The L RNA segment, encoding proteins important for replication and transcription, is a potential candidate. Taken together, the currently available data are not sufficient to reconstruct the chain of pathophysiological events in Lassa fever. However, some mechanisms are likely to play a role: i) early during infection Lassa virus may target immune cells and interfere with their activation; ii) the high affinity of Lassa virus for the receptor alpha-DG may allow virus replication in several organs; iii) the relatively low susceptibility of the virus to IFN may facilitate virus spread; iv) a continuous and uncontrolled rise in virus load in several organs may eventually trigger a fatal inflammatory syndrome in the terminal stage of the disease.

The incubation period is generally between 7 and 10 days, but may be as short as 3 or as long as 17 days.

10-14 days

5-16 days

Death occurs after a mean period of 2 weeks after the onset of illness. The virus can also be transmitted from human to human, giving rise to nosocomial Lassa fever epidemics with fatality rates of up to 65%. There is no vaccination available for use in humans. The only drug with a proven therapeutic efficacy in humans with Lassa fever is the broad-spectrum nucleoside analogue ribavirin. However, the drug is only effective if given early during the course of disease. Cases of Lassa fever recently imported into Europe show that even state-of-the-art intensive care cannot prevent a fatal outcome.

Lassa fever was responsible for 10%-16% of all adult medical admissions and for approximately 30% of adult deaths in the two hospitals studied. The case-fatality ratio for 441 hospitalized patients was 16.5%.

The overall case fatality rate in hospital in the endemic situation is about 15%. There exist a number of risk factors that reduce the chance of survival. Among the clinical signs, sore throat, vomiting, and bleeding are highly correlated with a poor outcome. Survival rate is also significantly lower in patients with high viremia (>103 TCID50/ml), in particular if combined with high AST values (greater than or equal to150 U/l) (case fatality rate 78%). A specific clinical picture that was observed in children of all age groups is the "swollen baby syndrome." It is characterized by widespread edema, abdominal distension, and bleeding, and has a case fatality rate of about 80%. Lassa fever in pregnant women is associated with infection of the fetus and loss of the fetus or newborn in 90% of the cases. The risk of death is also higher for mothers in the third trimester. Evacuation of the uterus significantly improves the mother's chance of survival.

The clinical symptoms in the early phase of a VHF are very similar irrespective of the causative virus and resemble a flu-like illness or a common enteritis. Headache, myalgia, gastrointestinal symptoms, and symptoms of the upper respiratory tract dominate the clinical picture.

Usually asymptomatic or mild illness. The onset of the disease is insidious with fever and general malaise over a 2- to 4-day period. In more severe cases; weakness, retroorbital pain, joint and lumbar pain, myalgia, headache, pharyngitis, cough and conjunctival injection. In the most severe form of the disease; prostration, abdominal pain, facial and neck oedema, haemorrhages (conjunctival haemorrhages, mucosal bleeding, melaena, haematochezia, haematuria, vaginal bleeding, haematemesis), encephalitis, capillary leak syndrome and shock. Hepatitis is frequent. Pulmonary manifestations can be significant with ARDS. Long-term sequelae of Lassa infection; sensorineural deafness.

The illness develops fairly rapidly but is not as abrupt in onset as in some other hemorrhagic fevers, notably Congo hemorrhagic fever. The patient complains of chills, fever and malaise, headache, myalgia and arthralgia, neck pain and sore throat. There may also be difficulty in swallowing, and vomiting and diarrhea may develop followed by pains in the chest and abdomen.

Over 2,000 infections are estimated to occur annually, with several thousand deaths.

In addition to fever, flu-like and gastrointestinal symptoms are usually present and the disease can clinically hardly be distinguished from other febrile illnesses seen inWest African hospitals.

Abnormal electrocardiograms, including non-specific ST-segment and T-wave abnormalities, ST-segment elevation, generalized low voltage complexes, and changes reflecting electrolyte disturbance, but none of these correlate with clinical or other measures of disease severity or out come and are not associated with clinical manifestations of myocarditis.

Over 70% of patients may have abnormal electrocardiograms.

The abdomen is tender in 50% of the patients, but bowel sounds are usually normal to marginally reduced.

Bilateral or unilateral eighth-nerve deafness.

Long-term sequelae of Lassa infection; sensorineural deafness.

Onset of deafness among patients with Lassa fever is a feature of the convalescent phase rather than the acute phase of the illness. Deafness was first reported as a complication of Lassa fever by White and Henderson in 1972. White noted that during a 1970 nosocomial hospital outbreak in Jos, Nigeria, deafness occurred in 4 of 23 hospitalized patients; a fifth patient reported intermittent tinnitus, and 3 patients experienced dizziness.

Bleeding and edema, late symptoms occurring only in a small fraction of patients, are not sensitive (approximately 20%), but highly specific for Lassa fever (approximately 90%).

Bleeding is seen in only 15% - 20% of patients, limited primarily to the mucosal surfaces or occasionally manifest as conjunctival hemorrhages or gastrointestinal or vaginal bleeding.

About a third of patients will have conjuctivitis; a few with conjunctival hemorrhages have a poor prognosis.

33%

There may also be difficulty in swallowing, and vomiting and diarrhea may develop followed by pains in the chest and abdomen.

Acute loss of hearing in one or both ears. The onset is nearly always during the convalescent phase of illness, and its development and degree are unrelated to the severity of the acute disease.

Nearly 30% of patients with Lassa virus infection suffer an acute loss of hearing in one or both ears.

Some patients develop facial edema during the advanced stage of the disease, which is associated with poor prognosis.

Edema of the face and neck, conjunctival hemorrhages, mucosal bleeding, central cyanosis, encephalopathy, and shock characterize the most severe cases.

Lassa fever in pregnant women is associated with infection of the fetus and loss of the fetus or newborn in 90% of the cases. The risk of death is also higher for mothers in the third trimester. Evacuation of the uterus significantly improves the mother's chance of survival.

Fetal loss is near 90% and does not seem to vary by trimester.

After an incubation period of 1-3 weeks, illness begins insidiously, with early symptoms of fever, sore throat, weakness, and malaise.

9%-26%.

They patient may have a headache and then develop a series of other body pains such as abdominal pain, chest pain, general muscle pains or pains in the joints.

50%

The excess maternal mortality in the third trimester may be related to the relative immunosuppression of pregnancy at that time.

Lassa fever may be a common cause of maternal mortality in many areas of West Africa, with a case fatality about 20%.

Among the clinical signs, sore throat, vomiting, and bleeding are highly correlated with a poor outcome.

17%

Neurological sign are infrequent, but carry a poor prognosis, ranging from confusion to severe encephalopathy with or without general seizures but without focal signs.

Infrequent

60%

Pharyngitis (often exudative), sore throat, vomiting, cough, AST elevations with a high AST/ALT ratio, and proteinuria are frequent signs. Among these signs, the frequent symptom pharyngitis is the most sensitive indicator of Lassa fever (70% sensitivity), but is not very specific (60%).

More than two-thirds have pharyngitis, half with exudates, diffusely inflamed and swollen posterior pharynx and tonsils, but few if any ulcers or palatal petechiae.

Severe pulmonary edema and adult respiratory distress syndrome is common in fatal cases with gross head and neck edema, pharyngeal stridor, and hypovolemic shock.

Diffuse rales may be heard by auscultating the chest, and pleural and pericardial friction rubs may sometimes be detected.

A specific clinical picture that was observed in children of all age groups is the "swollen baby syndrome." It is characterized by widespread edema, abdominal distension, and bleeding, and has a case fatality rate of about 80%.

Swollen baby syndrome. In very young babies, marked edema has been described in those with severe disease, and uniform mortality.

Among the clinical signs, sore throat, vomiting, and bleeding are highly correlated with a poor outcome.

Virological testing plays an important role in the diagnosis of Lassa fever because of the difficulty in diagnosing the disease on the basis of clinical parameters. The classical method to detect Lassa virus is inoculation of Vero cells with serum, CSF, throat washing, pleural fluid, or urine of the patient. The virus often induces a cytopathic effect in culture that can disappear upon further passage. Specific detection of the isolate is done by detection of virus antigen in cells by immunofluorescence using virus-specific antibodies. Despite the availability of novel molecular techniques for Lassa virus detection, conventional virus culture has still major advantages. Growth in cell culture and immune detection are hardly affected by the variability of the virus, a problem that is relevant for Lassa virus PCR. Furthermore, virus isolation facilitates a detailed geno- and phenotypic characterization of the isolate. Major disadvantages are the long period of time (days to weeks) required to isolate a virus as well as the need for BSL-4 facilities. Virus antigen can be detected by enzyme-linked immunosorbent assays (ELISA) using Lassa virus-specific antibodies. These tests are easy to handle, rapid, and can be performed with inactivated specimens, which is advantageous in the field if sophisticated equipment is not available. The minimal concentration of infectious virus required for detection by ELISA ranges from 10(2) to 10(5) PFU/ml depending on the material tested. However, for unknown reasons the antigen ELISA becomes increasingly insensitive concomitant with the appearance of specific antibodies. Accordingly, antigen ELISA is clinically less sensitive than virus isolation (36%), although the high concentration of virus early in the course of Lassa fever often allows antigen detection in serum.

IgM and IgG antibodies are detectable in about half of the patients during the first days of illness, with about 15% being only IgM-positive. Therefore, serological testing is not suitable for early diagnosis of Lassa fever. Furthermore, patients with fatal Lassa fever show lower antibody titers or may not develop antibodies at all. The fraction of seropositive patients increases further during the course of disease and is close to 100% by day 18, when viremia is already decreasing. Therefore, serological assays are the methods of choice for diagnosis of Lassa fever in the convalescence phase. Specimens can be inactivated by heat to facilitate testing under standard laboratory conditions.

Indirect immunofluorescence using virus-infected cells is the most common test for detecting IgM and IgG antibodies to Lassa virus. IgG seroconversion with a greater than 4-fold increase in the IgG titer or detection of IgM together with an IgG titer greater than or equal to256 was considered evidence of acute infection. Although the interpretation of immunofluorescence requires some experience, the assay has advantages over other methods. First, there is a long experience with this technique, which is important when only a limited number of sera are available to evaluate new assays. Second, all Lassa virus proteins expressed in the infected cell serve as antigen, and third, Lassa virus antibodies generate a characteristic fluorescence pattern (cytoplasmic dots) which adds specificity to the assay compared to an ELISA readout. The distinction of specific signals from non-specific fluorescence can be further improved by counterstaining Lassa virus antigen using monoclonal antibodies (double-labeling procedure). However, the immunofluorescence test probably is not completely specific for Lassa virus because of the extensive crossreactivity among African arenaviruses. This aspect should be taken into consideration if the laboratory diagnosis is solely based on serology.

ELISA or immuno blot tests using recombinant protein (NP, GPC, and Z protein) as antigen have also been developed and used for seroprevalence studies or for diagnosis of acute infection. The great advantage of these assays is that their preparation does not require BSL-4 laboratories. On the other hand, the high background in African sera of antibodies against components of bacterial or insect cell expression systems complicates the use of recombinant proteins for serological diagnostics in endemic regions. IgG and IgM ELISA were also developed using gamma irradiated virus from infected cells as an antigen. The clinical sensitivity of these assays is comparable to indirect immunofluorescence. The IgM ELISA detected acute Lassa virus infection in 72% of confirmed cases, and when combined with ELISA for antigen detection, sensitivity reached 88%. Despite these achievements, immunofluorescence using Lassa virus infected cells can still be regarded as the gold standard for the serological diagnosis of Lassa fever.

RT-PCR is currently the method of choice for rapid and early diagnosis of Lassa fever. Since Lassa virus is an RNA virus, its RNA must be reverse transcribed into cDNA prior to PCR. In the early PCR assays published for Lassa virus, cDNA synthesis was performed in a separate step (2-step RT-PCR). Furthermore, in order to reach high sensitivity and specificity, nested PCR steps were included in the assay or the PCR products were subjected to Southern blotting. The disadvantages of these assays are the long processing time and the increased risk of cross-contamination due to the additional manipulations. Recently, 1-step RT-PCR systems became available that are based on an optimized mixture of a retroviral RT and a Taq polymerase that is heat-activated only following the reverse transcription step. Using this system, high analytical sensitivity of the Lassa virus PCR was achieved without the need of nested steps or Southern hybridization. Detection is also faster and the risk of contamination is reduced. Unfortunately, Lassa virus is too variable for the design of reliable detection probes currently used in quantitative real-time PCR (TaqMan or fluorescence resonance energy transfer [FRET] probes). It is possible that future developments in this field will allow probe detection. Meanwhile, Lassa virus PCR products can be detected in realtime using intercalating dyes, like SybrGreen. This technique allows rapid measurement of virus RNA concentration in serum or other body fluids. The RNA concentration could be important as a prognostic parameter, in therapy monitoring, and in the risk assessment of virus transmission to contact persons.

All diagnostic Lassa virus PCRs published so far target the S RNA segment encoding GPC and NP. Clinical evaluation data show equal or higher sensitivity of PCR than virus isolation. Virus is detectable by PCR in 80% to 100% of patients between day 3 and day 9 of illness; thereafter the fraction of PCR-positive patients decreases. Quantitative real-time PCR was used to monitor virus RNA concentrations during the course of disease in two imported cases of Lassa fever. The RNA concentrations in serum of these patients were 5 x10(2) - 2 x10(6) fold above the detection limit of the assay Thus, both clinical and analytical sensitivity data indicate that PCR is well suited to diagnose acute Lassa fever. Unfortunately, in the past some of the S RNA-specific PCR assays had to be established on the basis of few sequences, and it was soon noted that some Lassa virus strains escape detection by PCR. Indeed, extensive sequence information on the S RNA segment of Lassa virus has recently become available, showing that some PCR primers published for diagnostic use will not reliably detect all Lassa virus strains. Compared to some Lassa virus sequences, these primers contain 5 or more mismatches, a state of affairs which is known to drastically reduce PCR efficiency.

Very recently, sequence information on the L RNA segment of arenaviruses became available. The L gene, encoding the viral RNA polymerase, may be particularly suited as a PCR target because RNA polymerases share conserved amino acid motifs even between different virus families. Indeed, the L gene was found to contain highly conserved regions that have been used to develop a Lassa virus-specific PCR assay. Due to the high degree of conservation at these sites, this assay is also able to detect other Old World arenavirus species such as LCMV, Mopeia virus, and Ippy virus, and may therefore be more robust with regard to virus variability than assays that solely detect Lassa virus. A PCR assay has been developed that predictably amplifies any member of the Arenaviridae by targeting the highly conserved termini of the S RNA segment. This assay amplifies the whole 3.4-kb S RNA. Although it is clearly less sensitive than other diagnostic PCR assays, it was able to detect Lassa virus RNA in clinical samples and facilitated sequencing of the S RNA in a short period of time. Due to their broad reactivity, the L gene specific assay and the long-range PCR assay are also useful to detect as yet unknown members of the arenavirus family. A set of consensus primers has been published for S RNA sequencing of unknown arenaviruses. PCR inhibition due to substances circulating in blood appears to be a particular problem with samples from patients with VHF. Complete inhibition was observed with diagnostic serum samples from critically ill patients with Lassa fever, yellow fever, and Ebola hemorrhagic fever. It is conceivable that tissue damage in VHF patients leads to the release of inhibiting substances. To prevent false negative results, appropriate inhibition controls must be implemented in VHF PCR diagnostics.

Ribavirin has been effective when used orally and/or IV for the treatment of Lassa fever and is considered the drug of choice for the disease. Ribavirin therapy has been associated with decreased mortality in patients with naturally occurring Lassa fever. Ribavirin is most effective when initiated early in the course of the infection (within 6-7 days of onset of symptoms).

Fisher-Hoch outlined the principles of management-early antiviral therapy, intensive care, strict isolation, rigorously controlled barrier nursing and avoidance of needlestick injuries. McCormick reported ribavirin more effective than convalescent plasma and recommended this drug at all stages of the illness, as well as for post-exposure prophylaxis. Highly concentrated convalescent plasma might be effective but is not easily stocked in sufficient quantities to treat large numbers. Intravenous ribavirin for first four days followed by oral ribavirin may be the best policy. It is expensive but stable and easy to administer. Haemolytic anaemia may occur but is reversible. Johnson endorsed universal precautions against nosocomial infections, with surveillance of known contacts for 21 days. He thought that virus neutralizing antibodies might add to the effect of ribavirin and recommended that antibody should be banked and made available for treatment anywhere.

A serum aspartate aminotransferase level greater than or equal to 150 IU per liter at the time of hospital admission was associated with a case-fatality rate of 55 percent (33 of 60). Patients with the same risk factor who were treated for 10 days with intravenous ribavirin, begun within the first 6 days after the onset of fever, had a case-fatality rate of 5 percent (1 of 20) (P = 0.0002 by Fisher's exact test). Patients whose treatment began seven or more days after the onset of fever had a case-fatality rate of 26 percent (11 of 43) (P = 0.01). Viremia with levels greater than or equal to 10(3.6) TCID50 per milliliter on admission was associated with a case-fatality rate of 76 percent (35 of 46). Patients with this risk factor who were treated with intravenous ribavirin within the first six days after onset of fever had a case-fatality rate of 9 percent (1 of 11) (P = 0.006), whereas those treated after seven days or more of illness had a fatality rate of 47 percent (9 of 19) (P = 0.035). Oral ribavirin was also effective in patients at high risk of death. Lassa-convalescent plasma did not significantly reduce mortality in any of the high-risk groups. We conclude that ribavirin is effective in the treatment of Lassa fever and that it should be used at any point in the illness, as well as for postexposure prophylaxis.

Oral ribavirin is contraindicated in patients with known hypersensitivity to ribavirin or any component of the formulations. The drug should be discontinued immediately and appropriate therapy initiated if an acute hypersensitivity reaction (urticaria, angioedema, bronchoconstriction, anaphylaxis) occurs. Transient rash does not necessitate interruption of treatment.

Oral ribavirin is contraindicated in women who are or may become pregnant and also is contraindicated in male partners of such women.

Oral ribavirin is contraindicated in patients with hemoglobinopathies (thalassemia sickle-cell anemia).

Oral ribavirin is contraindicated in patients with creatinine clearances less than 50mL/minute.

The only important adverse effect of ribavirin in humans is manageable, reversible anemia.

In Lassa fever patients, brief episodes of rigor toward the end of the treatment course were reported.

A clinical trial showed a therapeutic effect of the drug in humans with Lassa fever. In patients who had risk factors for a fatal outcome of the disease at admission, like high liver enzyme levels, and were treated within the first 6 days after the onset of fever, the case fatality rate decreased from 55 to 5%. Similarly, in patients showing high viremia as a risk factor, the therapy reduced the case fatality from 76 to 9%. Even in patients treated at day 7 or later, the case fatality could be reduced in these risk groups from 55 to 26% and from 76 to 47%, respectively.

Treatment is supportive and may require all the modern intensive-care facilities, including renal dialysis and mechanical ventilation. It is essential to pay attention to fluid and electrolyte balance, maintenance of blood pressure and circulatory volume, and control of seizures (MMWR 1988).

Guinea pig, inbred strain 13 and outbred (Hartley)

A rodent model for human Lassa fever was developed which uses inbred (strain 13) and outbred (Hartley) guinea pigs. Strain 13 guinea pigs were uniformly susceptible to lethal infection by 2 or more PFU of Lassa virus strain Josiah. In contrast, no more than 30% of the Hartley guinea pigs died regardless of the virus dose. In lethally infected strain 13 guinea pigs, peak titers of virus (10(7) to 10(8) PFU) occurred in the spleen and lymph nodes at 8 to 9 days, in the salivary glands at 11 days, and in the lung at 14 to 16 days. Virus reached low titers (10(4) PFU) in the plasma and brain and intermediate titers in the liver, adrenal glands, kidney, pancreas, and heart. In moribund animals, the most consistent and severe histological lesion as an interstitial pneumonia. In contrast, the brain was only minimally involved. The immune response of lethally infected strain 13 guinea pigs, as measured by the indirect fluorescent antibody test, was detectable within 10 days of infection and was similar in timing and intensity to the fluorescent antibody test response of both lethally infected and surviving outbred animals. In contrast to the fluorescent antibody response, neutralizing antibody developed late in convalescence and was thus detected only in surviving outbred guinea pigs. The availability of a rodent model for human Lassa fever in uniformly susceptible strain 13 guinea pigs should facilitate detailed pathophysiological studies and efficacy testing of antiviral drugs, candidate vaccines, and immunotherapy regimens to develop control methods for this life-threatening disease in humans.

To test the validity of plasma therapy for Lassa virus infections in an animal model, and to develop biologically relevant criteria for selection of protective immune plasma, inbred, strain 13 guinea pigs were infected with a lethal dose of Lassa virus and treated with various Lassa-immune plasmas obtained from guinea pigs, primates, and convalescent human patients. Neutralizing antibody titers were determined in a virus dilution, plaque reduction test, and were expressed as a log10 plaque-forming units (PFU) neutralization index (LNI). All guinea pigs treated with immune plasma 6 ml/kg/treatment on days 0, 3, and 6 after virus inoculation were protected, provided the LNI exceeded 2.0. Plasmas obtained from donors in early convalescence (32-45 days) had low titers of N-antibody (LNI less than 2) and failed to confer protection, despite high titers of Lassa antibody measured in the indirect fluorescent antibody (IFA) test. Higher doses of marginally titered plasma conferred increased protection. The degree of protection and suppression of viremia was closely associated with LNI an not IFA titers. Administration of low-titered plasma did not result in immune enhancement. A high dose of human plasma from Liberia (12 ml/kg/treatment) was required to confer complete protection to guinea pigs infected with a Lassa virus strain from Sierra Leone (LNI = 1.6), while a lower dose (3 ml/kg/treatment) was sufficient for protection against a Liberian strain (LNI = 2.8), suggesting that a geographic matching of immune plasma and Lassa virus strain origin may increase treatment success. These studies support the concept of plasma therapy for Lassa infection and suggest that the plaque reduction neutralization test is more appropriate than the IFA test for predicting protective efficacy of passively administered plasma.

Rhesus monkeys

Fisher-Hoch and coworkers tested as potential vaccines in rhesus monkeys a closely related virus, Mopeia virus (two monkeys), and a recombinant vaccinia virus containing the Lassa virus glycoprotein gene, V-LSGPC (four monkeys). Two monkeys vaccinated with the New York Board of Health strain of vaccinia virus as controls died after challenge with Lassa virus. The two monkeys vaccinated with Mopeia virus developed antibodies measurable by radioimmunoprecipitation prior to challenge, and they survived challenge by Lassa virus with minimal physical or physiologic disturbances. However, both showed a transient, low-titer Lassa viremia. Two of the four animals vaccinated with V-LSGPC had antibodies to both Lassa glycoproteins, as determined by radioimmunoprecipitation. All four animals survived a challenge of Lassa virus but experienced a transient febrile illness and moderate physiologic changes following challenge. Virus was recoverable from each of these animals, but at low titer and only during a brief period, as observed for the Mopeia-protected animals. We conclude that V-LSGPC can protect rhesus monkeys against death from Lassa fever.

CBA mice

The therapeutic effect of Zidampidine (30-azidothymidine-50-[p-bromophenyl methoxyalaninyl phosphate]) in CBA mice challenged with intracerebral injections of the Josiah strain of Lassa virus was examined. Mice were treated either with vehicle or non-toxic doses of Zidampidine administered intraperitoneally 24 h prior, 1 h prior, and 24, 48, 72, and 96 h after virus inoculation. The probability of survival following the Lassa challenge was significantly improved for Zidampidine-treated mice (Kaplan Meier, Log-Rank p value < 0.0001). This pilot study provides the basis for future preclinical evaluation of Zidampidine and its potential as a new agent for the treatment of viral hemorrhagic fevers caused by Lassa virus.

Multimammate rats

Mastomys

The reservoir, or host, of Lassa virus is a rodent known as the "multimammate rat" of the genus Mastomys. It is not certain which species of Mastomys are associated with Lassa; however, at least two species carry the virus in Sierra Leone. Mastomys rodents breed very frequently, produce large numbers of offspring, and are numerous in the savannas and forests of West, Central, and East Africa. In addition, Mastomys generally readily colonize human homes. All these factors together contribute to the relatively efficient spread of Lassa virus from infected rodents to humans.

African soft-furred rat

Mastomys natalensis

Lassa fever virus has been associated in the literature with the multimammate mouse, M. natalensis. Although generally found in fields, the species reputedly is broadly distributed in all habitats from South Africa to sub-Saharan Africa. However, taxonomic problems exist associated with the assignation of LAS to M. natalensis. In fact, M. natalensis does not occur in the two disjunct hotbeds of Lassa Fever in West Africa: Nigeria on the one hand, and Guinea, Sierra Leone, and Liberia on the other. The species potentially occurs in Senegal, although the taxonomic status of the Senegal population (and other populations) should be carefully scrutinized.

The natural host species of Lassa virus are African rodents of the genus Mastomys. Originally, Mastomys natalensis was identified as the primary host species. However, the taxonomy of the genus is poorly understood and it is currently uncertain which species or subspecies of this genus actually is the reservoir of Lassa virus. One study reported a smaller size and a higher frequency of inflammatory lesions in Lassa virus-infected versus uninfected Mastomys, while another study found no influence of persistent Lassa virus infection on the fitness of the animals. Upon experimental inoculation, neonatal Mastomys natalensis develop a persistent virus carrier state without significant histopathological alterations, as would be expected for a natural reservoir host. The animals live in close contact to humans. In highly endemic regions between 50% and 100% of all rodents caught in houses are Mastomys with a large fraction being infected by Lassa virus.

Like Lassa virus, Junin, Machupo, Guanarito, and Sabia viruses are infectious by aerosol and the human and rodent specimens should be processed with appropriate precautions in BSL 4 laboratories.

LASV is a category A biothreat agent (CDC, Select Agent Program).

Due to the high pathogenicity of Lassa virus and the limitations to the prevention or treatment of infections, the virus is classified as a level 4 pathogen and must be handled under biosafety level 4 (BSL-4) conditions.

The patient should be isolated in a single room with an adjoining anteroom serving as its only entrance. The anteroom should contain supplies for routine patient care, as well as gloves, gowns, and masks for the staff. The Appendix lists suggested supplies for the anteroom. Hand-washing facilities should be available in the anteroom, as well as containers of decontaminating solutions. If possible, the patient's room should be at negative air pressure compared with the anteroom and the outside hall, and the air should not be recirculated. However, this is not absolutely required, and does not constitute a reason to transfer the patient. If a room such as described is not available, use adjacent rooms to provide safe and adequate space . Strict barrier-nursing techniques should be enforced: all persons entering the patient's room should wear disposable gloves, gowns, masks, and shoe covers. Protective eye wear should be worn by persons dealing with disoriented or uncooperative patients or performing procedures that might involve the patient's vomiting or bleeding (for example, inserting a nasogastric tube or an intravenous or arterial line). Protective clothing should be donned and removed in the anteroom. Only essential medical and nursing personnel should enter the patient's room and anteroom. Isolation signs listing necessary precautions should be posted outside the anteroom. Lipid-containing viruses, including the enveloped viruses, are among the most readily inactivated of all viral agents. Suitable disinfectant solutions include 0.5% sodium hypochlorite (10% aqueous solution of household bleach), as well as fresh, correctly prepared solutions of glutaraldehyde (2% or as recommended by the manufacturer) and phenolic disinfectants (0.5%-3%). Soaps and detergents can also inactivate these viruses and should be used liberally. Laboratory personnel accidentally exposed to potentially-infected material (for example, through injections or cuts or abrasions on the hands) should immediately wash the infected part, apply a disinfectant solution such as hypochlorite solution, and notify the patient's physician. The person should then be considered as a high-risk contact and placed under surveillance. Accidental spills of potentially contaminated material should be liberally covered with disinfectant solution, left to soak for 30 minutes, and wiped up with absorbent material soaked in disinfectant.

The patient should use a chemical toilet. All secretions, excretions, and other body fluids (other than laboratory specimens) should be treated with disinfectant solution. All material used for patients, such as disposable linen and pajamas, should be double-bagged in airtight bags. The outside bags should be sponged with disinfectant solution and later incinerated or autoclaved. Disposable items worn by staff, such as gowns, gloves, etc., should be similarly treated. Disposable items used in patient care (suction catheters, dressings, etc.) should be placed in a rigid plastic container of disinfectant solution. The outside of the container should be sponged with disinfectant, and the container should be autoclaved, incinerated, or otherwise safely discarded. All unnecessary handling of the body, including embalming, should be avoided. Persons who dispose of the corpse must take the same precautions outlined for medical and laboratory staff. The corpse should be placed in an airtight bag and cremated or buried immediately.

Disposable items, such as pipette tips, specimen containers, swabs, etc., should be placed in a container filled with disinfectant solution and incinerated. Clothes and blankets that were used by the patient should be washed in a disinfectant, such as hypochlorite solution. Nondisposable items such as endoscopes used in patient care must be cleaned with decontaminating fluids (for example, gluteraldehyde or hypochlorite). Laboratory equipment must be treated similarly. All non- disposable materials that withstand autoclaving should be autoclaved, after they have been soaked in disinfectant solution. The patient's bed and other exposed surfaces in the hospital room, or in vehicles used to transport the patient, should be decontaminated with disinfectant solution.

The specific diagnosis is readily made by the isolation and identification of the virus. This is usually done by the inoculation of blood from the patient into Vero cell cultures. The virus is also readily isolated from urine, throat washings, and from pleural, peritoneal and pericardial effusions. The viremia may persist for 2 to 3 weeks, and virus may be detected in the urine of some patients for as long as 32 days after the onset of illness.

Arenaviruses are most often quantitated in vitro by plaque or quantal assay on Vero or L cells. Plaque formation may require long incubation periods of up to 7 days for members of the Tacaribe group. More commonly however, 4-5 days are sufficient for plaque development followed by neutral red vital staining or formalin fixation and crystal violet staining to visualize plaques. Plaques may vary widely in size and appearance. Plaques obtained from a high multiplicity of inoculum or persistent infections in cell culture, both of which lead to high concentrations of defective interfering virus, may be turbid or may even exhibit a 'bull's-eye' appearance, presumably resulting from alternating cycles of interfering virus production as the plaque expands. Cytopathic effect (CPE) in cell monolayers is not typical of arenavirus/cell interactions. Assay on Vero monolayers in screw cap tissue culture tubes has been utilized occasionally where the plaque assay is impracticable or when assaying slow-growing or highly virulent arenaviruses. This assay offers a higher degree of containment and greater resistance to dehydration than the plaque assay. Cytopathic effect is evident as cell rounding and detachment from the substrate, in exceptional cases proceeding to total exfoliation of the culture.

Vero cells (ATCC, CCL 81) were grown in Minimum Essential Medium with Earle's salts supplemented with non-essential amino acids, 1% penicillin, 1% streptomycin, 1% -glutamine and 10% heat-inactivated fetal bovine serum and were maintained in the same medium containing 2% fetal bovine serum.

When the identity of a VHF agent is totally unknown, isolation in cell culture and direct visualization by electron microscopy, followed by immunological identification by immunohistochemical techniques is often successful.

Yellow fever, dengue (types 1, 2 and 4), Chikungunya, Rift Valley fever, Ebola, Marburg, and Lassa viruses were inoculated into susceptible cell cultures and daily investigated by indirect immunofluorescence (IFA) and electron microscopy (EM) with a view to achieve an early detection-identification of these agents. Compared to the other cell lines tested (Vero, BHK-21 and Aedes albopictus), CV-1 cells were found to be more sensitive. Viral antigens were detected by IFA from a few hours post inoculation (CHIK and RVF) to a maximum of 3 days (YF and EBO). For most of the viruses studied, the cytopathic effect (CPE) commenced 2-3 days after the detection of viral antigens. Virus particles were detected by EM only in the case of EBO, MBG and LAS, before any CPE was observed in cell cultures.

A method is described for preparation of polyvalent antigens for use in rapid screening for immunofluorescent antibodies to Lassa, Marburg, and Ebola viruses. The technique uses mixtures of specifically infected Vero cells placed on Teflon-templated microscopy slides. It was found to be as sensitive as the use of monovalent antigens for detection and quantitation of antibodies to these highly hazardous human pathogen.

The most reliable and safe routine method for the laboratory at present is detection of virus-specific antibody by IFA. The advantages of IFA are its simplicity, low cost, ease of manipulation, its ability to control the background reaction, its overall reliability, and its flexibility, since it allows screening for several antigens in one test. Its disadvantages are slightly, but not significantly, lower sensitivity than ELISA, its modest subjectivity for the complete novice, and the cross-reactivity of the reagents with IgM, IgG, and IgA. Where conditions are optimal and reagents are available, ELISA should be used. Where the simplicity and reliability of IFA are advantageous, it remains a functional and reasonable alternative.

About two-thirds of clinical infections with Lassa fever could be accurately diagnosed by measuring IgM antibodies on the day of admission.

Conditions were defined for functional covalent coupling of anti-Lassa virus globulins to glutaraldehyde-fixed chicken erythrocytes. Tolylene-2,4-diisocyanate in a reaction mixture containing not more than 0.01 M NaCl produced uniformly good conjugates which were used in reversed passive hemagglutination (RPH) and reversed passive hemagglutination inhibition (RPHI) tests to detect Lassa virus antigens in infected cell cultures and specific antigens in Vero cell cultures. Identical results were obtained with this method and with immunofluorescent-antibody (IFA) staining in the detection and identification of Lassa virus isolated from human and rodent specimens from West Africa. The RPHI method was equal to IFA for serological diagnosis of acute human Lassa virus infection and superior to IFA, complement fixation, and a radioimmunoassay procedure for detection of Lassa virus antibodies in a human population where this infection is endemic.

The nucleoprotein of Lassa virus, strain Josiah, was expressed in Escherichia coli as an N-terminally truncated, histidine-tagged recombinant protein. Following affinity purification the protein was completely denatured and spotted onto nitrocellulose membrane. A total of 1 ug of protein was applied for detection of Lassa virus antibodies (LVA) in a simple immunoblot assay. Specific anti-Lassa immunoglobulin M (IgM) antibodies could be detected by increasing the amount of protein to 5 ug. A panel of 913 serum specimens from regions in which Lassa virus was endemic and from regions in which Lassa virus was not endemic was used for evaluating the sensitivity and specificity of the LVA immunoblot in comparison to those of an indirect immunofluorescence (IIF) assay. The sera originated from field studies conducted in the Republic of Guinea (570 serum samples) and Liberia (99 serum samples), from in patients of the clinical department of the Bernhard-Nocht-Institute, Hamburg, Germany (94 serum samples), and from healthy German blood donors (150 serum samples). In comparison to the IIF assay the LVA immunoblot assay had a specificity of 90.0 to 99.3%, depending on the origin of the specimens.

One serum sample from the 244 German controls (area of nonendemicity) reacted weakly (faint 1+ reaction) in the LVA blot. This 0.41% rate of false positivity closely parallels the rate of 1% recently reported for an immunoblot assay for hantavirus.

Of the IIF-positive sera from Guinea and Liberia, 9.3 and 25%, respectively, did not react in the LVA blot. Lack of reactivity did not depend on the LVA titer measured in the IIF assay, as sera with a low titer of 1/20 and with a high titer of 1/160 tested negative.

We compared ELISA and IFA testing on sera from 305 suspected cases of Lassa fever by using virus isolation with a positive reverse transcription-PCR (RT-PCR) test as the "gold standard." Virus isolation and RT-PCR were positive on 50 (16%) of the 305 suspected cases. Taken together, Lassa virus antigen and IgM ELISAs were 88% (95% confidence interval [CI], 77 to 95%) sensitive and 90% (95% CI, 88 to 91%) specific for acute infection. Due to the stringent gold standard used, these likely represent underestimates. Diagnosis could often be made on a single serum specimen. Antigen detection was particularly useful in providing early diagnosis as well as prognostic information. Level of antigenemia varied inversely with survival. Detection by ELISA of IgG antibody early in the course of illness helped rule out acute Lassa virus infection. The presence of IFA during both acute and convalescent stages of infection, as well as significant interobserver variation in reading the slides, made interpretation difficult. However, the assay provided useful prognostic information, the presence of IFA early in the course of illness correlating with death. The high sensitivity and specificity, capability for early diagnosis, and prognostic value of the ELISAs make them the diagnostic tests of choice for the detection of Lassa fever.

The use of ELISA in Africa is replete with problems resulting in a significant misrepresentation of reality. Where conditions are optimal and reagents are available, ELISA should be used. Where the simplicity and reliability of IFA are advantageous, it remains a functional and reasonable alternative.

ELISA of IgM proved to be the single most sensitive assay in detecting acute infection overall, identifying 36 (72%) of the 50 cases. However, antigen detection was more sensitive early in the course of the disease, identifying 15 (30%) of the 50 on the first blood draw. In practice, ELISAs for antigen and IgM are used in tandem, with a case considered positive if ELISA antigen and/or IgM are present. Preformed on all 305 suspected cases, ELISA for antigen and IgM (ELISA Ag/IgM) detected 44 (88%) of the 50 culture-confirmed cases for a sensitivity and specificity of 88% (95% confidence interval, 77 to 95%) and 90% (95% confidence interval, 88 to 91%), respectively.

Sequential serum samples, beginning on the day of hospital admission, from three patients with Lassa fever were tested for the presence of Lassa-virus antigens and antibodies by means of an enzyme-linked immunosorbent assay. Lassa-virus antigens were detected in the first serum sample from each patient, thus providing an early definitive diagnosis. In contrast, seroconversion was not detectable by ELISA or indirect fluorescent antibody techniques until 3 days or more after admission. The antigen-detection ELISA has important advantages over conventional infectivity titrations; it takes only hours to carry out and can be accomplished safely, with beta-propiolactone-inactivated samples. Development of antibodies coincided with a decline in antigenaemia. All acute-phase Lassa-fever sera contained either antigen or IgM antibody, and most contained both, thus allowing early diagnosis with single serum samples. More extensive testing of these ELISA techniques is recommended in field hospitals where Lassa fever is endemic and rapid diagnostic tools are needed.

We evaluated the polymerase chain reaction (PCR) and hybridization procedures for diagnosis of Lassa fever. Primers were derived from a region of the small RNA segment of Lassa virus coding for the glycoprotein. Serum samples stored for a 14-year period from patients in Sierra Leone, West Africa were examined retrospectively. Blinded samples were then tested prospectively. Eighty-eight virus isolation-negative control sera were negative by PCR and hybridization. In the retrospective study, virus was isolated from 51 of 98 specimens from patients with Lassa fever, and 33 of these were positive for Lassa virus RNA by PCR, and 42 by PCR and hybridization. Fifteen were positive by PCR and hybridization but isolation-negative, and nine were positive by isolation but PCR/hybridization-negative. Thirty-two were negative by all methods (sensitivity by PCR/hybridization compared with virus isolation 0.82, specificity 0.68). In a prospective blinded study of 195 patient sera, 51 were positive by PCR and virus isolation, and 24 were PCR positive but virus isolation-negative (sensitivity 0.66, specificity 0.71). After hybridization, 66 virus isolation-positive sera were positive. The sensitivity was 0.86 and the specificity was 0.59, and the probability of false-positive results compared with virus isolation was 32%, (chi 2 = 21.9, by McNemar's test). Since some specimens may not have contained viable virus, we re-analyzed the data of individual patients using laboratory-confirmed case definitions for Lassa fever. All specimens from patients in whom Lassa fever was excluded by serologic tests were negative by PCR/hybridization.

cagaatctgacagtgtcca(ag)

gtgtgcagtacaacatgagt(g)

gctcccaccccaagccatcc(p)

Suitable oligonucleotide primers and probes were synthesized to amplify Lassa virus (Josiah strain)-specific nucleoprotein and glycoprotein gene fragments by using reverse transcription combined with the polymerase chain reaction (PCR). Our primers did not amplify the related lymphocytic choriomeningitis virus. By using PCR, about 50% tissue culture infective doses could be detected in the supernatant of infected cells. Furthermore, in all five serum specimens and four of five urine specimens of patients with acute Lassa fever, viral RNA could be demonstrated. Negative results were obtained with all serum and urine specimens of healthy subjects. Our data suggest that PCR may be applied as an alternative to virus isolation in the rapid diagnosis of Lassa fever.

ctgcccctgttttgtcagacatgcc(g)

ggggctcgggctgggagagatggag(ag)

aatgcagagttgctcaataatcagttcgggacc(p)

ggatggcttggggtgggagctactact(g)

ataaccgatgggagatggtctcgag(ag)

ggcagtgatcttcccaggttgtattttggattatc(p)

Important VHF agents are Ebola and Marburg viruses (MBGV/EBOV), Lassa virus (LASV), Crimean-Congo hemorrhagic fever virus (CCHFV), Rift Valley fever virus (RVFV), dengue virus (DENV), and yellow fever virus (YFV). VHFs are clinically difficult to diagnose and to distinguish; a rapid and reliable laboratory diagnosis is required in suspected cases. We have established six one-step, real-time reverse transcription-PCR assays for these pathogens based on the Superscript reverse transcriptase-Platinum Taq polymerase enzyme mixture. Novel primers and/or 5'-nuclease detection probes were designed for RVFV, DENV, YFV, and CCHFV by using the latest DNA database entries. PCR products were detected in real time on a LightCycler instrument by using 5'-nuclease technology (RVFV, DENV, and YFV) or SybrGreen dye intercalation (MBGV/EBOV, LASV, and CCHFV). The inhibitory effect of SybrGreen on reverse transcription was overcome by initial immobilization of the dye in the reaction capillaries. Universal cycling conditions for SybrGreen and 5'-nuclease probe detection were established. Thus, up to three assays could be performed in parallel, facilitating rapid testing for several pathogens. All assays were thoroughly optimized and validated in terms of analytical sensitivity by using in vitro-transcribed RNA. The 95% detection limits as determined by probit regression analysis ranged from 1,545 to 2,835 viral genome equivalents/ml of serum (8.6 to 16 RNA copies per assay). The suitability of the assays was exemplified by detection and quantification of viral RNA in serum samples of VHF patients.

36E2 5'-ACCGGGGATCCTAGGCATTT-3' [5-24] 80F2 5'-ATATAATGATGA CTGTTGTTCTTTGTGCA-3' [339-311]

Virus genome equivalents (geq) per milliliter of plasma which could be detected with 95% probability were as follows: LASV, 2,445 geq/ml, greater than or equal to 95% confidence interval.

False-negative RT-PCR results are likely to occur for patients with severe viral hemorrhagic fevers, especially in the acute phase of the disease where a rapid confirmation is required. Their plasma may contain large amounts of RT-PCR inhibitors, probably resulting from the decay of tissue. These inhibitors can be detected by control reactions with spiked samples (low copy numbers of control RNA, 1 log10 above detection limit of the PCR). Control reactions to detect inhibitors of RT-PCR are mandatory for a safe diagnosis for patients with suspected VHF.

A method based on a coupled reverse transcription-PCR (RT-PCR) for the detection of Lassa virus using primers specific for regions of the S RNA segment which are well conserved between isolates from Sierra Leone, Liberia, and Nigeria was developed. The specificity of the assay was confirmed by Southern blotting with a chemiluminescent probe. The assay was able to detect 1 to 10 copies of a plasmid or an RNA transcript containing the target sequence. There was complete concordance between RT-PCR and virus culture for the detection of Lassa virus in a set of 29 positive and 32 negative serum samples obtained on admission to the hospital from patients suspected of having Lassa fever in Sierra Leone. Specificity was confirmed by the failure of amplification of specific products from serum samples collected from 129 healthy blood donors in Sierra Leone or from tissue culture supernatants from cells infected with related arenaviruses (Mopeia, lymphocytic choriomeningitis, Tacaribe, and Pichinde viruses). Sequential serum samples from 29 hospitalized patients confirmed to have Lassa fever were tested by RT-PCR and for Lassa virus-specific antibodies by indirect immunofluorescence (IF). RT-PCR detected virus RNA in 79% of the patients at the time of admission, comparing favorably with IF, which detected antibodies in only 21% of the patients. Lassa virus RNA was detected by RT-PCR in all 29 patients by the third day of admission, whereas antibody was detectable by IF in only 52% of the patients. These results point to an important role for RT-PCR in the management of suspected cases of Lassa fever.

80F2: 5' ATA TAA TGA TGA CTG TTG TTC TTT GTG CA 3'

36E2 5' ACC GGG GAT CTC TAG GCA TTT 3'

RT-PCR detected virus RNA in 79% of the patients at the time of admission, comparing favorably with IF, which detected antibodies in only 21% of the patients. Lassa virus RNA was detected by RT-PCR in all 29 patients by the third day of admission, whereas antibody was detectable by IF in only 52% of the patients.

Lassa virus is easily isolated from blood or serum during the febrile phase of the disease up to 14 days post onset, even after the appearance of antibody. Viremia is usually higher in fatal cases. Virus can also be detected in necropsy tissues.

Routine virus isolation may be accomplished easily from serum or tissues in cell cultures, but should be performed in BSL4 laboratory facilities.

Formenty

Roth C, Gonzalez-Martin F, Grein T, Ryan M, Drury P, Kindhauser MK, Rodier G.

[Emergent pathogens, international surveillance and international health regulations (2005)]

Med Mal Infect

2006 36 1 9 15

WHO.

Update on Lassa fever in West Africa

Wkly Epidemiol Rec

2005 80 10 86 88

Macher

Wolfe MS.

Historical Lassa fever reports and 30-year clinical update

Emerg Infect Dis

2006 12 5 835 837

Borio

Inglesby T, Peters CJ, Schmaljohn AL, Hughes JM, Jahrling PB, Ksiazek T, Johnson KM, Meyerhoff A, O'Toole T, Ascher MS, Bartlett J, Breman JG, Eitzen EM Jr, Hamburg M, Hauer J, Henderson DA, Johnson RT, Kwik G, Layton M, Lillibridge S, Nabel GJ, Osterholm MT, Perl TM, Russell P, Tonat K; Working Group on Civilian Biodefense.

Hemorrhagic fever viruses as biological weapons: medical and public health management

JAMA

2002 287 18 2391 2405

Huggins

JW.

Prospects for treatment of viral hemorrhagic fevers with ribavirin, a broad-spectrum antiviral drug

Rev Infect Dis

1989 11 Suppl 4 S750 S761

Jahrling

Smith S, Hesse RA, Rhoderick JB.

Pathogenesis of Lassa virus infection in guinea pigs.

Infect Immun

1982 37 2 771 778

Fisher-Hoch

McCormick JB, Auperin D, Brown BG, Castor M, Perez G, Ruo S, Conaty A, Brammer L, Bauer S.

Protection of rhesus monkeys from fatal Lassa fever by vaccination with a recombinant vaccinia virus containing the Lassa virus glycoprotein gene

Proc Natl Acad Sci U S A

1989 86 1 317 321

Richmond

Baglole DJ.

Lassa fever: epidemiology, clinical features, and social consequences

BMJ

2003 327 7426 1271 1275

Jeffs

A clinical guide to viral haemorrhagic fevers: Ebola, Marburg and Lassa

Trop Doct

2006 36 1 1 4

Jahrling

Niklasson BS, McCormick JB.

Early diagnosis of human Lassa fever by ELISA detection of antigen and antibody

Lancet

1985 1 8423 250 252

Drosten

Kummerer BM, Schmitz H, Gunther S.

Molecular diagnostics of viral hemorrhagic fevers

Antiviral Res

2003 57 1-2 61 87

Suresh

The enigmatic haemorrhagic fevers

J R Soc Med

1997 90 11 622 624

Colebunders

Van Esbroeck M, Moreau M, Borchert M.

Imported viral haemorrhagic fever with a potential for person-to-person transmission: review and recommendations for initial management of a suspected case in Belgium

Acta Clin Belg

2002 57 5 233 240

Fisher-Hoch

Lessons from nosocomial viral haemorrhagic fever outbreaks

Br Med Bull

2005 73-74 1 123 137

Bossi

Tegnell A, Baka A, Van Loock F, Hendriks J, Werner A, Maidhof H, Gouvras G.

Bichat guidelines for the clinical management of haemorrhagic fever viruses and bioterrorism-related haemorrhagic fever viruses

Euro Surveill

2004 9 12 E11 E12

Winn

WC Jr

Monath TP, Murphy FA, Whitfield SG.

Lassa virus hepatitis. Observations on a fatal case from the 1972 Sierra Leone epidemic

Arch Pathol

1975 99 11 599 604

Gunther

Lenz O.

Lassa virus

Crit Rev Clin Lab Sci

2004 41 4 339 390

Emonet

Lemasson JJ, Gonzalez JP, de Lamballerie X, Charrel RN.

Phylogeny and evolution of old world arenaviruses

Virology

2006 350 2 251 257

Drosten

Panning M, Guenther S, Schmitz H.

False-negative results of PCR assay with plasma of patients with severe viral hemorrhagic fever

J Clin Microbiol

2002 40 11 4394 4395

Uckun

Venkatachalam TK, Erbeck D, Chen CL, Petkevich AS, Vassilev A.

Zidampidine, an aryl phosphate derivative of AZT: in vivo pharmacokinetics, metabolism, toxicity, and anti-viral efficacy against hemorrhagic fever caused by Lassa virus

Bioorg Med Chem.13(9):-88

2005 13 9 3279 3288

Fisher-Hoch

Tomori O, Nasidi A, Perez-Oronoz GI, Fakile Y, Hutwagner L, McCormick JB.

Review of cases of nosocomial Lassa fever in Nigeria: the high price of poor medical practice

BMJ

1995 311 7009 857 859

McCormick

King IJ, Webb PA, Johnson KM, O'Sullivan R, Smith ES, Trippel S, Tong TC.

A case-control study of the clinical diagnosis and course of Lassa fever

J Infect Dis

1987 155 3 445 455

Gunther

Emmerich P, Laue T, Kuhle O, Asper M, Jung A, Grewing T, ter Meulen J, Schmitz H.

Imported lassa fever in Germany: molecular characterization of a new lassa virus strain

Emerg Infect Dis

2000 6 5 466 476

Lukashevich

Vasiuchkov AD, Stel'makh TA, Scheslenok EP, Shabanov AG.

[The isolation and characteristics of reassortants between the Lassa and Mopeia arenaviruses]

Vopr Vir