<?xml version="1.0"?>
<pathinfo pathogen-name="Ebola Virus" pathogen-ontology="UMLS:C0013480" curators="Wattam" xmlns:src="http://xml.apache.org/xindice/Query" src:col="/db/piml" src:key="Ebola_Virus_Info">
	<organism>
		<taxonomy>
			<species taxonID="Ebola" genbank-taxon-id="11268" refs="NCBI">
				<common-name>Ebola</common-name>
				<scientific-name>Ebola virus</scientific-name>
				<description>
					<ref-info refs="Nichol"> Ebola virus is a nonsegmented RNA virus, which, together with Marburg virus, makes up the filovirus family.</ref-info>
					<ref-info refs="NCBI">Members of the family filoviridae are negative-strand ssRNA viruses.</ref-info>
					<ref-info refs="Leroy">In contrast to most RNA viruses, EBOV is characterized by high genetic stability, which may be due to four main factors: low error rate of RNA polymerase, slow replication in the natural host, small number of natural hosts and weak immunological pressure.</ref-info>
				</description>
				<variant taxonID="Ebola_Zaire" parent="Ebola" genbank-taxon-id="186538" refs="ZaireA">
					<common-name>Zaire Ebola virus</common-name>
					<scientific-name>Zaire Ebola virus</scientific-name>
					<description>
						<ref-info refs="CDC">Ebola first occurred in Yambuku and surrounding area. Disease was spread by close personal contact and by use of contaminated needles and syringes in hospitals/clinics. This outbreak was the first recognition of the disease.</ref-info>
						<ref-info refs="Leroy">Ebola virus is subdivided into four subtypes, namely Zaire, Sudan, Cote-d&apos;Ivoire, and Reston.</ref-info>
					</description>
				</variant>
				<variant taxonID="Zaire_Eckron-76" parent="Ebola_Zaire" genbank-taxon-id="129000" refs="ZaireB">
					<common-name> Ebola virus strain Eckron-76 
			</common-name>
					<scientific-name>
						<ref-info refs="ZaireB"> Ebola virus strain Eckron-76 </ref-info>
					</scientific-name>
					<description>
						<ref-info refs="Volchkov2"> The EBOV strain Eckron, subtype Zaire, as EBOV strain Mayinga, was isolated from a case of the 1976 outbreak of Ebola hemorrhagic fever in Zaire and represents a wild-type strain.</ref-info>
					</description>
				</variant>
				<variant taxonID="Zaire_Gabon-94" parent="Ebola_Zaire" genbank-taxon-id="128947" refs="ZaireC">
					<common-name>Ebola virus strain Gabon-94</common-name>
					<scientific-name>Ebola virus strain Gabon-94</scientific-name>
					<description>
						<ref-info refs="Volchkov"> Gabon has recently been struck three times by Ebola hemorrhagic fever.</ref-info>
						<ref-info refs="CDC">This epidemic occurred in Mekouka and other gold-mining camps deep in the rain forest. Initially thought to be yellow fever; it was identified as Ebola hemorrhagic fever in 1995.</ref-info>
					</description>
				</variant>
				<variant taxonID="Zaire_Mayinga" parent="Ebola_Zaire" genbank-taxon-id="128952" refs="ZaireD">
					<common-name>Ebola virus strain Zaire Mayinga	</common-name>
					<scientific-name>Ebola virus strain Zaire Mayinga</scientific-name>
					<description>
						<ref-info refs="Volchkov2"> The EBOV strain Eckron, subtype Zaire, as EBOV strain Mayinga, was isolated from a case of the 1976 outbreak of Ebola hemorrhagic fever in Zaire and represents a wild-type strain.</ref-info>
					</description>
				</variant>
				<variant taxonID="Zaire-95" parent="Ebola_Zaire" genbank-taxon-id="128951" refs="ZaireE">
					<common-name>Ebola virus strain Zaire-95</common-name>
					<scientific-name>Ebola virus strain Zaire-95</scientific-name>
					<description>
						<ref-info refs="Ksiazek"> Ebola hemorrhagic fever (EHF) patients treated at Kikwit General Hospital during the 1995 outbreak were tested for viral antigen, IgG and IgM antibody, and infectious virus.  Virus was also isolated from patients during the course of their febrile illness.</ref-info>
					</description>
				</variant>
				<variant taxonID="Ebola_Sudan" parent="Ebola" genbank-taxon-id="186540" refs="SudanA">
					<common-name>Sudan Ebola virus</common-name>
					<scientific-name>Sudan Ebola virus	</scientific-name>
					<description>
						<ref-info refs="CDC"> The first outbreak in Sudan occurred in Nzara, Maridi and the surrounding area. Disease was spread mainly through close personal contact within hospitals.</ref-info>
						<ref-info refs="Leroy">Many medical care personnel were infected. Ebola virus is subdivided into four subtypes, namely Zaire, Sudan, Cote-d&apos;Ivoire, and Reston.</ref-info>
					</description>
				</variant>
				<variant taxonID="Sudan_Boniface" parent="Ebola_Sudan" genbank-taxon-id="128948" refs="SudanB">
					<common-name>Ebola virus strain Sudan Boniface</common-name>
					<scientific-name>Ebola virus strain Sudan Boniface</scientific-name>
					<description>
						<ref-info refs="Sanchez"> Ebola viruses-Sudan (S/Sudan/Maridi/1976/VCP2D11 and S/Sudan/Nzara/1979/015176) are also known a Boniface and Maleo, respectively.</ref-info>
						<ref-info refs="Knobloch"> A new viral disease (Maridi haemorrhagic fever) occurred in the South Sudan in 1976. It was obviously identical with an epidemic which occurred at the same time in Zaire.</ref-info>
					</description>
				</variant>
				<variant taxonID="Sudan_Maleo-79" parent="Ebola_Sudan" genbank-taxon-id="128949" refs="SudanC">
					<common-name>Ebola virus strain Sudan Maleo-79</common-name>
					<scientific-name>Ebola virus strain Sudan Maleo-79</scientific-name>
					<description>
						<ref-info refs="CDC"> Occurred in Nzara. Recurrent outbreak at the same site as the 1976 Sudan epidemic. </ref-info>
					</description>
				</variant>
				<variant taxonID="Ebola_Ivory_Coast" parent="Ebola" genbank-taxon-id="186541" refs="IvoryCoastA">
					<common-name>Cote d&apos;Ivoire Ebola virus</common-name>
					<scientific-name>Cote d&apos;Ivoire Ebola virus</scientific-name>
					<description>
						<ref-info refs="Leroy">Ebola virus is subdivided into four subtypes, namely Zaire, Sudan, Cote-d&apos;Ivoire, and Reston (Leroy et al., 2002).</ref-info>
						<ref-info refs="CDC">In this instance a scientist became ill after conducting an autopsy on a wild chimpanzee in the Tai Forest. The patient was treated in Switzerland.</ref-info>
					</description>
				</variant>
				<variant taxonID="Ivory_Coast_94" parent="Ebola_Ivory_Coast" genbank-taxon-id="128999" refs="IvoryCoastB">
					<common-name>Ebola virus strain Ivory coast-94</common-name>
					<scientific-name>Ebola virus strain Ivory coast-94</scientific-name>
					<description>
						<ref-info refs="Le_Guenno"> A new strain of Ebola virus was isolated from a non-fatal human case infected during the autopsy of a wild chimpanzee in the Cote-d&apos;Ivoire. The wild troop to which this animal belonged had been decimated by outbreaks of haemorrhagic syndromes. This is the first time that a human infection has been connected to naturally-infected monkeys in Africa.</ref-info>
					</description>
				</variant>
				<variant taxonID="Ebola_Reston" parent="Ebola" genbank-taxon-id="186539" refs="RestonA">
					<common-name>Reston Ebola virus</common-name>
					<scientific-name>Reston Ebola virus</scientific-name>
					<description>
						<ref-info refs="Leroy"> Ebola virus is subdivided into four subtypes, namely Zaire, Sudan, Cote-d&apos;Ivoire, and Reston.</ref-info>
						<ref-info refs="Leroy CDC">Ebola-Reston virus was introduced into quarantine facilities in Virginia, Texas, and Pennsylvania by monkeys imported from the Philippines. Four humans developed antibodies to Ebola-Reston virus but did not become ill.</ref-info>
					</description>
				</variant>
				<variant taxonID="Reston_Siena" parent="Ebola_Reston" genbank-taxon-id="129004" refs="RestonB">
					<common-name>Ebola virus strain Reston Siena/Philippine-92</common-name>
					<scientific-name>Ebola virus strain Reston Siena/Philippine-92</scientific-name>
					<description>
						<ref-info refs="CDC"> Ebola-Reston virus was introduced into quarantine facilities in Sienna by monkeys imported from the same export facility in the Philippines that was involved in the episodes in the United States. No humans were infected. </ref-info>
					</description>
				</variant>
			</species>
		</taxonomy>
		<lifecycle name="Ebola Virus Information">
			<stage name="Virion" stageID="virion">
				<size>
					<ref-info refs="Beer"> Marburg and Ebola viruses are pleomorphic particles which vary greatly in length, but the unit length associated with peak infectivity is 790 nm for Marburg virus and 970 nm for Ebola virus.</ref-info>
				</size>
				<shape> The virions appear as either long filamentous (and sometimes branched) forms or in shorter U-shaped, 6-shaped (mace-shaped), or circular (ring) configurations.  Virions have a uniform diameter of 80 nm and a density of 1.14 g/ml (Beer and Kurth, 1999). </shape>
				<picture refs="website30" name="Ebola virus from the first passage in Vero cells">
					<URL>http://staff.vbi.vt.edu/pathport/pathinfo_images/Ebola_Virus/Ebola_virus_1.jpg</URL>
					<description>Ebola virus, diagnostic specimen from the first passage in Vero cells of a specimen from a human patientthis image is from the first isolation and visualization of Ebola virus, 1976. This image has been &quot;borrowed&quot; so often for various public uses that many people think that all Ebola virions look just like thisindeed, in the film Outbreak every virion seen looked just like this. In fact, Ebola virions are extremely varied in appearance  they are flexible filaments with a consistent diameter of 80 nm (nanometers), but they vary greatly in length (although their genome length is constant) and degree of twisting. Negatively stained virions. Magnification: approximately x60,000. Micrograph from F. A. Murphy, School of Veterinary Medicine, University of California, Davis.</description>
				</picture>
			</stage>
		</lifecycle>
		<genome-summary taxon="Ebola_Zaire">
			<description>
				<ref-info refs="CDC"> The first incidence of Ebola Zaire occurred in Yambuku and surrounding area. Disease was spread by close personal contact and by use of contaminated needles and syringes in hospitals/clinics. This outbreak was the first recognition of the disease.  318 people were infected and 88% of them died. </ref-info>
			</description>
			<genome-component name="Chromosome" type="chromosome" genbank-access-number="AY142960 AF499101 NC_002549 AF086833" refs="ZGenomeA ZGenomeB ZGenomeC ZGenomeD">
				<size>
					<ref-info refs="ZGenomeA ZGenomeB ZGenomeC ZGenomeD"> 18959 base pairs </ref-info>
				</size>
				<gene-count>
					<ref-info refs="ZGenomeA ZGenomeB ZGenomeC ZGenomeD"> 7 genes </ref-info>
				</gene-count>
				<description>
					<ref-info refs="Volchkov3"> The genomes of filoviruses display linear arranged genes on a single negative-stranded RNA molecule that encode the seven structural proteins in the order nucleoprotein, virion structural protein (VP) 35, VP40, glycoprotein (GP), VP30, VP24, and RNA-dependent RNA polymerase (L). </ref-info>
				</description>
			</genome-component>
		</genome-summary>
		<genome-summary taxon="Ebola_Reston">
			<description>
				<ref-info refs="Groseth"> The Reston species of EBOV is unique in that it originated in Asia, while the other filoviruses have their origins in Africa. EBOV Reston emerged in 1989/90 as the causative agent of an epizootic among a group of cynomolgus monkeys (Macaca fascicularis) imported from the Philippines into the United States. Subsequently, at least two more introductions of EBOV Reston have occurred in the United States and Italy. Epidemiological investigations in the Philippines have documented active virus transmission in the primate export facility which was the source of all the shipments of infected monkeys. Despite pathogenicity for non-human primates, EBOV Reston has never been associated with any notable disease in man. However, serological investigations documented at least eight seroconversions among exposed animal handlers, which suggests that EBOV Reston infections in humans are infrequent and lead to either asymptomatic or subclinical courses. </ref-info>
			</description>
			<genome-component name="Chromosome" type="chromosome" genbank-access-number="AB050936 AF522874 NC_004161" refs="RGenomeA RGenomeB RGenomeC">
				<size>
					<ref-info refs="RGenomeA RGenomeB RGenomeC"> 18890 or 18891 base pairs </ref-info>
				</size>
				<gene-count>
					<ref-info refs="RGenomeA RGenomeB RGenomeC"> 7 genes </ref-info>
				</gene-count>
				<description>
					<ref-info refs="Volchkov3"> The genomes of filoviruses display linear arranged genes on a single negative-stranded RNA molecule that encode the seven structural proteins in the order nucleoprotein, virion structural protein (VP) 35, VP40, glycoprotein (GP), VP30, VP24, and RNA-dependent RNA polymerase (L). </ref-info>
				</description>
			</genome-component>
		</genome-summary>
	</organism>
	<epidemiology>
		<outbreak>
			<ref-info refs="Jahrling"> Ebola viruses are taxonomically related to Marburg viruses; they were first recognized in association with explosive outbreaks that occurred almost simultaneously in 1976 in small communities in Zaire and Sudan.</ref-info>
			<ref-info refs="Jahrling">Sporadic cases occurred subsequently. In 1989, a third strain of Ebola virus appeared in Reston, Virginia, in association with an outbreak of VHF among cynomolgus monkeys imported to the United States from the Philippines.</ref-info>
			<ref-info refs="Jahrling">Recently, small outbreaks involving new strains of Ebola virus occurred in human populations in Cote d&apos;Ivorie in 1994 and Gabon in 1995; a larger outbreak involving the Ebola-Zaire strain involved more than 300 people, with 75% mortality, in Zaire in 1995.</ref-info>
			<ref-info refs="Monath">On the basis of serological evidence, the geographic distribution of EBO viruses may include other parts of Asia and Madagascar. </ref-info>
		</outbreak>
		<transmission refs="CDC-Ebola" transmissionID="Human-Human">
			<from host="Human">
				<ref-info refs="CDC-Ebola">Human</ref-info>
			</from>
			<to host="Human">
				<ref-info refs="CDC-Ebola">Human</ref-info>
			</to>
			<destination host="Human">
				<ref-info refs="CDC-Ebola">Human</ref-info>
			</destination>
			<mechanism>
				<ref-info refs="Jaax"> The source of infection or mode of transmission of Ebola virus to human index cases of Ebola fever has not been established. Field observations in outbreaks of Ebola fever indicate that secondary transmission of Ebola virus is linked to improper needle hygiene, direct contact with infected tissue or fluid samples, and close contact with infected patients. While it is presumed that the virus infects through either breaks in the skin or contact with mucous membranes, the only two routes of exposure that have been experimentally validated are parenteral inoculation and aerosol inhalation.</ref-info>
				<ref-info refs="CDC-Ebola ">While all Ebola virus species have displayed the ability to be spread through airborne particles (aerosols) under research conditions, this type of spread has not been documented among humans in a real-world setting, such as a hospital or household. </ref-info>
			</mechanism>
		</transmission>
		<transmission refs="Formenty2" transmissionID="Primate-Human">
			<from host="Primates">
				<ref-info refs="Formenty2">Primates</ref-info>
			</from>
			<to host="Human">
				<ref-info refs="Formenty2">Human</ref-info>
			</to>
			<destination host="Human">
				<ref-info refs="Formenty2">Human</ref-info>
			</destination>
			<mechanism>
				<ref-info refs="Formenty2"> The chimpanzee organs from the implicated necropsy were shown by immunohistochemistry to be infected with Ebola.  During necropsy, all 3 researchers had worn gloves but not masks or gowns.  No wounds or punctures had been noted.  Two researchers had worn latex examination gloves, but the case-patient had worn household gloves.  Therefore, it is highly probable that she became contaminated during the necropsy by direct contact with chimpanzee blood on her hand or by projection of droplets onto her face.</ref-info>
				<ref-info refs="Monath">Human infections resulting from exposure to wild, infected chimpanzees butchered for meat (in Gabon, 1996) or autopsied because of illness (in Cote d&apos;Ivorie, 1994) have provided the most direct clues to the source of EBO virus in nature. </ref-info>
			</mechanism>
		</transmission>
		<transmission refs="Monath" transmissionID="Bat-Human">
			<from host="Bats">
				<ref-info refs="Monath">Bats</ref-info>
			</from>
			<to host="Human">
				<ref-info refs="Monath">Human</ref-info>
			</to>
			<destination host="Human">
				<ref-info refs="Monath">Human</ref-info>
			</destination>
			<mechanism>
				<ref-info refs="Monath"> Evidence implicating bats is circumstantial and includes the transcontinental geographic distribution of EBO virus subtypes, the association between infection and potential roosting sites for bats in caves (Marburg virus; Kitum cave) or in man-made structures (EBO-S virus; cotton factory, Nzara, Sudan), and the association between bats a rhabdoviruses and paramyxoviruses. </ref-info>
			</mechanism>
		</transmission>
		<intentional-release>
			<description />
			<emergency-contact>
				<ref-info refs="MMWR"> If clinicians feel that VHF is a likely diagnosis, they should take two immediate steps: 1) isolate the patient, and 2) notify local and state health departments and CDC (MMWR, 1998).  Report incidents to state health departments and the CDC (telephone {404} 639-1511; from 4:30 p.m. to 8 a.m., telephone {404} 639-2888).   Information on investigating and managing patients with suspected viral hemorrhagic fever, collecting and shipping diagnostic specimens, and instituting control measures is available on request from the following persons at Centers for Disease Control (CDC) in Atlanta, Georgia; for all telephone numbers, dial 404-639 + extension: Epidemic Intelligence Service (EIS) Officer, Special Pathogens Branch, Division of Viral Diseases, Center for Infectious Diseases (ext. 1344); Chief, Special Pathogens Branch, Division of Viral Diseases, Center for Infectious Diseases: Joseph B. McCormick, M.D. (ext. 3308);  Senior Medical Officer, Special Pathogens Branch, Division of Viral Diseases, Center for Infectious Diseases: Susan P. Fisher-Hoch, M.D. (ext. 3308);   Director, Division of Viral Diseases, Center for Infectious Diseases (ext. 3574).  After regular office hours and on weekends, the persons named above may be contacted through the CDC duty officer (ext. 2888). </ref-info>
			</emergency-contact>
			<delivery-mechanism>
				<ref-info refs="Jahrling"> The VHF agents are all highly infectious via the aerosol route, and most are quite stable as respirable aerosols. This means that they satisfy at least one criterion for being weaponized, and some clearly have the potential to be biological warfare threats. Most of these agents replicate in cell culture to concentrations sufficiently high to produce a small terrorist weapon, one suitable for introducing lethal doses of virus into the air intake of an airplane or office building. Some replicate to even higher concentrations, with obvious potential ramifications. Since the VHF agents cause serious diseases with high morbidity and mortality, their existence as endemic disease threats and as potential biological warfare weapons suggests a formidable potential impact on unit readiness. Further, returning troops may well be carrying exotic viral diseases to which the civilian population is not immune, a major public health concern. </ref-info>
			</delivery-mechanism>
			<containment>
				<ref-info refs="Jahrling"> Patients with VHF syndrome generally have significant quantities of virus in their blood, and perhaps in other secretions as well (with the exceptions of dengue and classic hantaviral disease). Well-documented secondary infections among contacts and medical personnel not parenterally exposed have occurred. Thus, caution should be exercised in evaluating and treating patients with suspected VHF syndrome. Over-reaction on the part of medical personnel is inappropriate and detrimental to both patient and staff, but it is prudent to provide isolation measures as rigorous as feasible.  At a minimum, these should include the following: stringent barrier nursing; mask, gown, glove, and needle precautions; hazard-labeling of specimens submitted to the clinical laboratory; restricted access to the patient; and autoclaving or liberal disinfection of contaminated materials, using hypochlorite or phenolic disinfectants. 
     For more intensive care, however, increased precautions are advisable. Members of the patient care team should be limited to a small number of selected, trained individuals, and special care should be directed toward eliminating all parenteral exposures. Use of endoscopy, respirators, arterial catheters, routine blood sampling, and extensive laboratory analysis increase opportunities for aerosol dissemination of infectious blood and body fluids. For medical personnel, the wearing of flexible plastic hoods equipped with battery-powered blowers provides excellent protection of the mucous membranes and airways. </ref-info>
			</containment>
		</intentional-release>
	</epidemiology>
	<host name="Human" hostID="human">
		<taxonomy>
			<species taxonID="Human" genbank-taxon-id="9606" refs="Hsapiens">
				<common-name>Human</common-name>
				<scientific-name>
					<ref-info refs="Hsapiens"> Homo sapiens</ref-info>
				</scientific-name>
				<description>
					<ref-info refs="Leroy"> Ebola virus (EBOV) is one of the most virulent human pathogens, killing up to 70-80% of patients within 5-7 days. </ref-info>
				</description>
			</species>
		</taxonomy>
		<infection>
			<infectious-dose>
				<ref-info refs="Franz">1 -10 organisms</ref-info>
			</infectious-dose>
			<description>
				<ref-info refs="Jaax"> The source of infection or mode of transmission of Ebola virus to human index cases of Ebola fever has not been established. Field observations in outbreaks of Ebola fever indicate that secondary transmission of Ebola virus is linked to improper needle hygiene, direct contact with infected tissue or fluid samples, and close contact with infected patients. While it is presumed that the virus infects through either breaks in the skin or contact with mucous membranes, the only two routes of exposure that have been experimentally validated are parenteral inoculation and aerosol inhalation. </ref-info>
				<ref-info refs="CDC-Ebola">While all Ebola virus species have displayed the ability to be spread through airborne particles (aerosols) under research conditions, this type of spread has not been documented among humans in a real-world setting, such as a hospital or household. </ref-info>
			</description>
		</infection>
		<prevention name="Barrier nursing" type="other" refs="Khan Kerstiens">
			<description>
				<ref-info refs="Khan"> This outbreak demonstrated once again the propensity for this disease to affect health care workers when proper nursing-barrier procedures are absent (25% of all new cases were among health care providers), and it demonstrated the potential for this disease to be amplified in health care settings, even with little or no needle reuse.  Moreover it reaffirmed that education and the use of personal protective equipment can rapidly interrupt on going disease transmission.  These features emphasize the necessity of rudimentary public health surveillance coupled with adherence to barrier-nursing precautions and infection control practices, such as elimination of needle and syringe reuse or proper sterilization of these items between uses.</ref-info>
			</description>
			<efficacy>
				<rate>
					<ref-info refs="Kerstiens"> Before 12 May 1995, 67 health workers had been infected, of which 47 died.  After the start of the distribution of the protective equipment and the organization of the isolation ward on 12 May, just 3 cases of Ebola hemorrhagic fever (EHF) were reported among staff, and none were reported among Red Cross volunteers involved in body burial.</ref-info>
				</rate>
			</efficacy>
		</prevention>
		<disease medical-name="Ebola hemorrhagic fever" common-name="Ebola">
			<pathogenesis>
				<description>
					<ref-info refs="Bray2"> After gaining access to the body, filoviruses initially infect monocytes, macrophages and other cells of the mononuclear phagocytic system (MPS), probably in regional lymph nodes. Some infected MPS cells migrate to other tissues, while virions released into the lymph or bloodstream infect fixed and mobile macrophages in the liver, spleen and other tissues throughout the body. Virions released from these MPS cells proceed to infect neighboring cells, including hepatocytes, adrenal cortical cells and fibroblasts.</ref-info>
					<ref-info refs="Bray2">Infected MPS cells become activated and release large quantities of cytokines and chemokines, including TNF-, which increases the permeability of the endothelial lining of blood vessels. Endothelial cells apparently become infected by virus only in the later stages of disease. Circulating cytokines contribute to the development of disseminated intravascular coagulation (DIC) by inducing expression of endothelial cell-surface adhesion and procoagulant molecules and tissue destruction results in the exposure of collagen in the lining of blood vessels and the release of tissue factor.</ref-info>
					<ref-info refs="Bray2">Massive lysis of lymphocytes occurs in the spleen, thymus and lymph nodes in the late stages of filovirus infection. There is no sign that the lymphocytes themselves are infected, rather they die through apoptosis, perhaps induced by cell-surface binding of chemical mediators released by MPS cells or by a viral protein. Massive cytolysis, immune dysfunction, fluid shifts, microvascular coagulation and interstitial hemorrhage all play a role in the development of shock and death. </ref-info>
				</description>
			</pathogenesis>
			<incubation>
				<ref-info refs="MMWR"> The incubation period ranges from 2 to 21 days; the average is approximately 1 week. In the cases resulting from a needle stick, the incubation period was 6 days; however, this may not characterize the natural illness.</ref-info>
			</incubation>
			<prognosis>
				<ref-info refs="King"> Prognosis is poor.  Patients surviving for two weeks often make a slow recovery. </ref-info>
			</prognosis>
			<symptomology>
				<syndrome name="Viral Hemorrhagic Fever">
					<description>
						<ref-info refs="MMWR"> The term viral hemorrhagic fever (VHF) refers to the illness associated with a number of geographically restricted viruses. This illness is characterized by fever and, in the most severe cases, shock and hemorrhage . Although a number of other febrile viral infections may produce hemorrhage, only the agents of Lassa, Marburg, Ebola, and Crimean-Congo hemorrhagic fevers are known to have caused significant outbreaks of disease with person-to-person transmission.</ref-info>
					</description>
					<observed>
						<ref-info refs="MMWR"> The illness-to-infection ratio for Ebola virus is unknown, but seroepidemiologic investigations suggest that mild or asymptomatic infections can occur. </ref-info>
					</observed>
					<symptom name="Ebola Hemorrhagic Fever">
						<description>
							<ref-info refs="MMWR"> The onset of illness is abrupt, and initial symptoms resemble those of an influenza-like syndrome. Fever, headache, general malaise, myalgia, joint pain, and sore throat are commonly followed by diarrhea and abdominal pain. A transient morbilliform skin rash, which subsequently desquamates, often appears at the end of the first week of illness. Other physical findings include pharyngitis, which is frequently exudative, and occasionally conjunctivitis, jaundice, and edema. After the third day of illness, hemorrhagic manifestations are common and include petechiae as well as frank bleeding, which can arise from any part of the gastrointestinal tract and from multiple other sites. </ref-info>
						</description>
						<observed>
							<ref-info refs="MMWR"> The illness-to-infection ratio for Ebola virus is unknown, but seroepidemiologic investigations suggest that mild or asymptomatic infections can occur. </ref-info>
						</observed>
					</symptom>
				</syndrome>
				<symptom name="Headache" refs="Khan">
					<description>
						<ref-info refs="Khan"> Headache </ref-info>
					</description>
					<observed>
						<ref-info refs="Khan"> 73% </ref-info>
					</observed>
				</symptom>
				<symptom name="Nausea/Vomiting" refs="Khan">
					<description>
						<ref-info refs="Khan"> Nausea/Vomiting </ref-info>
					</description>
					<observed>
						<ref-info refs="Khan"> 70% </ref-info>
					</observed>
				</symptom>
				<symptom name="Anorexia" refs="Khan">
					<description>
						<ref-info refs="Khan"> Anorexia </ref-info>
					</description>
					<observed>
						<ref-info refs="Khan"> 73% </ref-info>
					</observed>
				</symptom>
				<symptom name="Diarrhea" refs="Khan">
					<description>
						<ref-info refs="Khan"> Diarrhea </ref-info>
					</description>
					<observed>
						<ref-info refs="Khan"> 74% </ref-info>
					</observed>
				</symptom>
				<symptom name="Asthenia" refs="Khan">
					<description>
						<ref-info refs="Khan"> Asthenia </ref-info>
					</description>
					<observed>
						<ref-info refs="Khan"> 78% </ref-info>
					</observed>
				</symptom>
				<symptom name="Abdominal pain" refs="Khan">
					<description>
						<ref-info refs="Khan"> Abdominal pain </ref-info>
					</description>
					<observed>
						<ref-info refs="Khan"> 56% </ref-info>
					</observed>
				</symptom>
				<symptom name="Myalgia/arthralgias" refs="Khan">
					<description>
						<ref-info refs="Khan"> Myalgia/arthralgias</ref-info>
					</description>
					<observed>
						<ref-info refs="Khan"> 51% </ref-info>
					</observed>
				</symptom>
				<symptom name="Dysphagia" refs="Khan">
					<description>
						<ref-info refs="Khan"> Dysphagia </ref-info>
					</description>
					<observed>
						<ref-info refs="Khan"> 41% </ref-info>
					</observed>
				</symptom>
				<symptom name="Dyspnea" refs="Khan">
					<description>
						<ref-info refs="Khan"> Dyspnea </ref-info>
					</description>
					<observed>
						<ref-info refs="Khan"> 25% </ref-info>
					</observed>
				</symptom>
				<symptom name="Hiccups" refs="Khan">
					<description>
						<ref-info refs="Khan"> Hiccups </ref-info>
					</description>
					<observed>
						<ref-info refs="Khan"> 14% </ref-info>
					</observed>
				</symptom>
				<symptom name="Gingival hemorrhage" refs="Khan">
					<description>
						<ref-info refs="Khan"> Gingival hemorrhage </ref-info>
					</description>
					<observed>
						<ref-info refs="Khan"> 21% </ref-info>
					</observed>
				</symptom>
				<symptom name="Conjuctival inflammation/hemmorrhage" refs="Khan">
					<description>
						<ref-info refs="Khan"> Conjunctival inflammation/hemorrhage </ref-info>
					</description>
					<observed>
						<ref-info refs="Khan"> 34% </ref-info>
					</observed>
				</symptom>
				<symptom name="Petechiae" refs="Khan">
					<description>
						<ref-info refs="Khan"> Petechiae </ref-info>
					</description>
					<observed>
						<ref-info refs="Khan"> 15% </ref-info>
					</observed>
				</symptom>
				<symptom name="Melena" refs="Khan">
					<description>
						<ref-info refs="Khan"> Melena </ref-info>
					</description>
					<observed>
						<ref-info refs="Khan"> 14% </ref-info>
					</observed>
				</symptom>
				<symptom name="Hematamesis" refs="Khan">
					<description>
						<ref-info refs="Khan"> Hematamesis </ref-info>
					</description>
					<observed>
						<ref-info refs="Khan"> 13% </ref-info>
					</observed>
				</symptom>
			</symptomology>
			<diagnosis-summary />
			<treatment name="Supportive" refs="MMWR">
				<applicable />
				<description>
					<ref-info refs="MMWR"> Treatment is supportive and may require intensive care. Limited information exists on the efficacy of antiviral drugs or immune plasma to prevent or ameliorate Ebola hemorrhagic fever. Ribavirin shows no in vitro activity.  No vaccine exists against Ebola virus. </ref-info>
				</description>
			</treatment>
		</disease>
		<model-system name="Cavia">
			<model-host>
				<ref-info refs="Parren"> Cavia porcellus </ref-info>
			</model-host>
			<model-pathogen taxon="Zaire_Mayinga Ebola_Sudan">
				<ref-info refs="Parren" />
			</model-pathogen>
			<description>
				<ref-info refs="Parren"> An animal model for Ebola virus infection and pathogenesis has been developed in guinea pigs by infection of strain 13 guinea pigs with the Ebola Zaire virus (Mayinga) followed by four sequential passages of virus in naive guinea pigs, using homogenized spleens.</ref-info>
				<ref-info refs="Bray2">Guinea pigs develop a mild febrile illness after inoculation with Marburg virus or with Ebola Zaire or Sudan. Animal-to-animal transfer results in a progressive increase in virulence, resulting after a few passages in a viral stock that causes uniformly fatal disease. The major pathologic features of lethal infection in guinea pigs resemble those in mice and primates. Guinea pigs have been employed for vaccine testing, but because of their size are less useful for the initial evaluation of experimental drugs, which tend to be available in only very small quantities. </ref-info>
			</description>
		</model-system>
		<model-system name="Mus">
			<model-host>
				<ref-info refs="Bray"> Mus musculus </ref-info>
			</model-host>
			<model-pathogen taxon="Ebola_Zaire">
				<ref-info refs="Bray" />
			</model-pathogen>
			<description>
				<ref-info refs="Bray"> The Zaire subtype of Ebola virus (EBO-Z) is lethal for newborn mice, but adult mice are resistant to the virus, which prevents their use as an animal model of lethal Ebola infection. We serially passed EBO-Z virus in progressively older suckling mice, eventually obtaining a plaque-purified virus that was lethal for mature, immunocompetent BALB/c and C57BL/6 inbred and ICR (CD-1).</ref-info>
				<ref-info refs="Bray2">Marburg and Ebola viruses cause fatal disease in newborn mice, but do not cause visible illness in adult immunocompetent mice. However, sequential passage of Ebola Zaire &apos;76 virus in progressively older suckling mice resulted in the selection of a variant virus that causes rapidly lethal disease in normal adult mice when inoculated by the intraperitoneal route. The pathologic features of infection with this &apos;mouse-adapted virus&apos; resemble those in primates, except that coagulopathy is much less prominent. This mouse model is now in use for the preliminary testing of vaccines and antiviral drugs and for studies of filovirus pathogenesis. Immunodeficient mice, lacking either innate or antigen-specific immune responses, are susceptible to lethal infection by a variety of non-mouse-adapted Marburg and Ebola viruses. These murine models are proving to be a fruitful source of information on mechanisms of susceptibility and resistance to filovirus infection.</ref-info>
			</description>
		</model-system>
		<model-system name="Cercopithecus">
			<model-host>
				<ref-info refs="Ryabchikova Bray2"> Cercopithecus aethiops </ref-info>
			</model-host>
			<model-pathogen taxon="Ebola_Zaire">
				<ref-info refs="Ryabchikova Bray2" />
			</model-pathogen>
			<description>
				<ref-info refs="Bray2"> All filoviruses cause severe hemorrhagic fever in nonhuman primates. Ebola Zaire virus is the most virulent, producing uniformly lethal illness in African green monkeys, cynomolgus and rhesus macaques and baboons. In cynomolgus macaques, a commonly used model, this infection is characterized by the onset of fever and diminished activity on day 3 to 4 postchallenge; a reddish-purple macular rash on the trunk beginning on day 4 to 5; obtundation by day 6 and death on day 7 to 8. Virus is initially detectable in the serum on day 3 and titers may exceed 10(7) pfu/ml by day 5. High concentrations of virus are also measured in the liver, spleen and other tissues. Changes in blood cell counts and other clinical laboratory parameters resemble those in humans. Mild hemorrhagic phenomena are common, but profuse bleeding is rare. Ebola Sudan, Ebola Reston and Marburg viruses also cause severe hemorrhagic fever in nonhuman primates, but with a more prolonged clinical course and somewhat less than 100% mortality.</ref-info>
			</description>
		</model-system>
		<model-system name="Papio">
			<model-host>
				<ref-info refs="Ryabchikova Bray2">Papio hamadryas</ref-info>
			</model-host>
			<model-pathogen taxon="Ebola_Zaire">
				<ref-info refs="Ryabchikova Bray2" />
			</model-pathogen>
			<description>
				<ref-info refs="Bray2">  All filoviruses cause severe hemorrhagic fever in nonhuman primates. Ebola Zaire virus is the most virulent, producing uniformly lethal illness in African green monkeys, cynomolgus and rhesus macaques and baboons. In cynomolgus macaques, a commonly used model, this infection is characterized by the onset of fever and diminished activity on day 3 to 4 postchallenge; a reddish-purple macular rash on the trunk beginning on day 4 to 5; obtundation by day 6 and death on day 7 to 8. Virus is initially detectable in the serum on day 3 and titers may exceed 10(7) pfu/ml by day 5. High concentrations of virus are also measured in the liver, spleen and other tissues. Changes in blood cell counts and other clinical laboratory parameters resemble those in humans. Mild hemorrhagic phenomena are common, but profuse bleeding is rare. Ebola Sudan, Ebola Reston and Marburg viruses also cause severe hemorrhagic fever in nonhuman primates, but with a more prolonged clinical course and somewhat less than 100% mortality.</ref-info>
			</description>
		</model-system>
		<model-system name="Macaca">
			<model-host>
				<ref-info refs="Bray2">  Macaca fascicularis  </ref-info>
			</model-host>
			<model-pathogen taxon="Ebola_Zaire  Ebola_Sudan Ebola_Reston">
				<ref-info refs="Bray2" />
			</model-pathogen>
			<description>
				<ref-info refs="Bray2">  All filoviruses cause severe hemorrhagic fever in nonhuman primates. Ebola Zaire virus is the most virulent, producing uniformly lethal illness in African green monkeys, cynomolgus and rhesus macaques and baboons. In cynomolgus macaques, a commonly used model, this infection is characterized by the onset of fever and diminished activity on day 3 to 4 postchallenge; a reddish-purple macular rash on the trunk beginning on day 4 to 5; obtundation by day 6 and death on day 7 to 8. Virus is initially detectable in the serum on day 3 and titers may exceed 10(7) pfu/ml by day 5. High concentrations of virus are also measured in the liver, spleen and other tissues. Changes in blood cell counts and other clinical laboratory parameters resemble those in humans. Mild hemorrhagic phenomena are common, but profuse bleeding is rare. Ebola Sudan, Ebola Reston and Marburg viruses also cause severe hemorrhagic fever in nonhuman primates, but with a more prolonged clinical course and somewhat less than 100% mortality. </ref-info>
			</description>
		</model-system>
	</host>
	<host name="Primates" hostID="primate">
		<taxonomy>
			<species taxonID="Primates" genbank-taxon-id="9443" refs="Primate">
				<common-name>Monkeys and apes</common-name>
				<scientific-name>
					<ref-info refs="Primate"> Primates </ref-info>
				</scientific-name>
				<description>
					<ref-info refs="Formenty"> An outbreak due to a new subtype of the virus, Ebola virus (subtype Reston), occurred in a colony of cynomolgus monkey (Macca fascicularis) in a quarantine facility in Reston Virginia, in 1989.  The same virus was responsible for three further epizootics among monkeys in the United States in 1990, as well as one outbreak in Italy in 1992.  Investigations traced the source of all Ebola virus-Reston outbreaks to a primate export facility in the Philippines, but the mode of contamination of this facility was not determined.  Although African green monkeys (Cercopithecus aethiops) from Uganda were the first animals known to be infected with filovirus, the cycle of these viruses in nature remains a mystery. </ref-info>
				</description>
			</species>
		</taxonomy>
	</host>
	<host name="Bats" hostID="bat">
		<taxonomy>
			<species taxonID="Bats" genbank-taxon-id="9397" refs="Bat">
				<common-name>Bats</common-name>
				<scientific-name>Chiroptera</scientific-name>
				<description>
					<ref-info refs="Monath">  Evidence implicating bats is circumstantial and includes the transcontinental geographic distribution of EBO virus subtypes, the association between infection and potential roosting sites for bats in caves (Marburg virus; Kitum cave) or in man-made structures (EBO-S virus; cotton factory, Nzara, Sudan), and the association between bats a rhabdoviruses and paramyxoviruses. </ref-info>
				</description>
			</species>
		</taxonomy>
	</host>
	<labwork>
		<biosafety taxon="Ebola">
			<level>Virus isolation must only be attempted in Biosafety Level 4 facilities, such as are available at CDC.</level>
			<precautions>
				<ref-info refs="MMWR"> The patient should be isolated in a single room with an adjoining anteroom serving as its only entrance. The anteroom should contain supplies for routine patient care, as well as gloves, gowns, and masks for the staff. The Appendix lists suggested supplies for the anteroom. Hand-washing facilities should be available in the anteroom, as well as containers of decontaminating solutions. If possible, the patient&apos;s room should be at negative air pressure compared with the anteroom and the outside hall, and the air should not be recirculated. However, this is not absolutely required, and does not constitute a reason to transfer the patient. If a room such as described is not available, use adjacent rooms to provide safe and adequate space. </ref-info>
				<ref-info refs="MMWR">Strict barrier-nursing techniques should be enforced: all persons entering the patient&apos;s room should wear disposable gloves, gowns, masks, and shoe covers. Protective eye wear should be worn by persons dealing with disoriented or uncooperative patients or performing procedures that might involve the patient&apos;s vomiting or bleeding (for example, inserting a nasogastric tube or an intravenous or arterial line). Protective clothing should be donned and removed in the anteroom. Only essential medical and nursing personnel should enter the patient&apos;s room and anteroom. Isolation signs listing necessary precautions should be posted outside the anteroom. </ref-info>
				<ref-info refs="MMWR">Lipid-containing viruses, including the enveloped viruses, are among the most readily inactivated of all viral agents. Suitable disinfectant solutions include 0.5% sodium hypochlorite (10% aqueous solution of household bleach), as well as fresh, correctly prepared solutions of glutaraldehyde (2% or as recommended by the manufacturer) and phenolic disinfectants (0.5%-3%). Soaps and detergents can also inactivate these viruses and should be used liberally. </ref-info>
				<ref-info refs="MMWR">Laboratory personnel accidentally exposed to potentially-infected material (for example, through injections or cuts or abrasions on the hands) should immediately wash the infected part, apply a disinfectant solution such as hypochlorite solution, and notify the patient&apos;s physician. The person should then be considered as a high-risk contact and placed under surveillance.  Accidental spills of potentially contaminated material should be liberally covered with disinfectant solution, left to soak for 30 minutes, and wiped up with absorbent material soaked in disinfectant. </ref-info>
			</precautions>
			<disposal>
				<ref-info refs="MMWR"> The patient should use a chemical toilet. All secretions, excretions, and other body fluids (other than laboratory specimens) should be treated with disinfectant solution. All material used for patients, such as disposable linen and pajamas, should be double-bagged in airtight bags. The outside bags should be sponged with disinfectant solution and later incinerated or autoclaved. Disposable items worn by staff, such as gowns, gloves, etc., should be similarly treated. Disposable items used in patient care (suction catheters, dressings, etc.) should be placed in a rigid plastic container of disinfectant solution. The outside of the container should be sponged with disinfectant, and the container should be autoclaved, incinerated, or otherwise safely discarded. </ref-info>
				<ref-info refs="MMWR">All unnecessary handling of the body, including embalming, should be avoided. Persons who dispose of the corpse must take the same precautions outlined for medical and laboratory staff. The corpse should be placed in an airtight bag and cremated or buried immediately.</ref-info>
				<ref-info refs="MMWR">Disposable items, such as pipette tips, specimen containers, swabs, etc., should be placed in a container filled with disinfectant solution and incinerated. Clothes and blankets that were used by the patient should be washed in a disinfectant, such as hypochlorite solution.  Nondisposable items such as endoscopes used in patient care must be cleaned with decontaminating fluids (for example, gluteraldehyde or hypochlorite). Laboratory equipment must be treated similarly. All non- disposable materials that withstand autoclaving should be autoclaved, after they have been soaked in disinfectant solution. The patient&apos;s bed and other exposed surfaces in the hospital room, or in vehicles used to transport the patient, should be decontaminated with disinfectant solution. </ref-info>
			</disposal>
		</biosafety>
		<culturing name="General Cell Culture Information for Ebola Virus">
			<description>
				<ref-info refs="Peters"> Virus isolation in cell culture.  Acute sera or postmortem tissues are usually positive.  Virus growth is detected by cytophatic effect or more usually by fluorescent antibody detection of antigen in cells.  It is usually efficient.  May require several days, multiple cell systems, and blind passage.  BSL-4 laboratory is required.  Isolation in cell culture or animals is needed to study the virus, regardless of how it was detected intially. </ref-info>
			</description>
		</culturing>
		<culturing name="In Vitro Culture System">
			<description>
				<ref-info refs="Gibb"> To study the host response to and identify potential diagnostic markers for Ebola virus infections, an in vitro culture system involving nonhuman primate alveolar macrophages was developed and characterized.</ref-info>
				<ref-info refs="Gibb">Data from this study indicate clearly that nonhuman primate alveolar macrophages are susceptible to Ebola virus infection in vitro and are capable of replicating the virus to a high titer within 24 h. These data are particularly significant, as alveolar macrophages are the first line of phagocytic defense against inhaled pathogens and are known to be important in orchestrating the host immune response (i.e., cytokine production and regulation of MHC molecule expression) to infectious agents that reach the alveoli . In this system, Ebola virus replication appeared to proceed efficiently. Within 24 h of initial infection, viral replication led to irreversible cell injury and severe cytolysis. </ref-info>
			</description>
			<medium>
				<ref-info refs="Gibb"> Viral stock was diluted serially in minimal essential medium with Earle salts and nonessential amino acids, adsorbed to confluent Vero E6 cells in 12-well dishes, incubated for 1 h at 37 degrees celcius, and covered with an agarose overlay. </ref-info>
			</medium>
			<optimal-temperature>
				<ref-info refs="Gibb"> 37 C </ref-info>
			</optimal-temperature>
			<note>
				<ref-info refs="Jahrling"> Diagnosis by viral cultivation and identification for the VHF-causing agents requires 3 to 10 days for most (longer for the hantaviruses); and, with the exception of dengue, specialized microbiologic containment is required for safe handling of these viruses. </ref-info>
			</note>
		</culturing>
		<culturing name="Vero E6 Cell Culture">
			<description>
				<ref-info refs="Stroher"> In this study they used the Musoke strain of Marbug virus (MBGV), the Mayinga strain of the Zaire species of EBOV (EBOV-Zaire), and the Reston strain of the Reston species of EBOV (EBOV-Reston).  Virus stocks were freshly prepared in Vero E6 cells (ATCC 1568). Harvesting was performed when no obvious cytopathic effect was seen. Mock-infected Vero E6 cells were treated the same way in order to prepare a control (mock stock). Vero E6 cells were cultured in Dulbecco&apos;s modified Eagle&apos;s medium (DMEM) supplemented with 10% fetal calf serum), penicillin (100 U/ml), streptomycin (100 ug/ml), and L-glutamine (2 mM). For virus propagation, DMEM with 2% fetal calf serum was used. </ref-info>
			</description>
			<medium>
				<ref-info refs="Stroher">  Dulbecco&apos;s modified Eagle&apos;s medium (DMEM) supplemented with 10% fetal calf serum), penicillin (100 U/ml), streptomycin (100 ug/ml), and L-glutamine (2 mM).</ref-info>
			</medium>
			<optimal-temperature>
				<ref-info refs="Stroher"> 37 C </ref-info>
			</optimal-temperature>
			<optimal-humidity>
				<ref-info refs="Stroher">95% </ref-info>
			</optimal-humidity>
			<note>
				<ref-info refs="Jahrling"> Diagnosis by viral cultivation and identification for the VHF-causing agents requires 3 to 10 days for most (longer for the hantaviruses); and, with the exception of dengue, specialized microbiologic containment is required for safe handling of these viruses. </ref-info>
			</note>
		</culturing>
		<diagnostic-tests>
			<organism-detection name="Electron microscopy" type="electron-microscopy" time-to-perform="2-to-7-days">
				<description>
					<ref-info refs="Jahrling">  When the identity of a VHF agent is totally unknown, isolation in cell culture and direct visualization by electron microscopy, followed by immunological identification by immunohistochemical techniques is often successful.</ref-info>
					<ref-info refs="Mekki">Ebola, Marburg and Lassa viruses produced cytopathic effect in Vero cells, commencing at the 7th day post inoculation.  In CV-1 cells, cytopathic effect was observed on the 5th day post inoculation for Ebola and on the 6th day post inoculation for Marburg and Lassa viruses.  In both Vero and CV-1 cells, Ebola and Marburg virus particles were detected by electron microscopy three days post inoculation.  Lassa particles were detected on the 4th and 6th days post inoculaton in CV-1 and Vero cells, respectively.  In both cell lines, the three viruses were detected by EM before the appearance of cytopathic effect.  Viral antigens of Ebola, Marburg and Lassa were detected by indirect immunofluorescence on the 3rd day post inoculation in Vero cells.  In CV-1 cells, Marburg and Lassa antigens were detected on the 2nd day post inoculation, a day earlier than in Vero cells.  While Ebola antigens were detected on the 3rd day post inoculation in both systems, fluorescent foci were much more pronounced in CV-1 than in Vero cells.</ref-info>
				</description>
			</organism-detection>
			<organism-detection name="Indirect Immunofluorescence" type="immunofluorescence-microscopy" time-to-perform="2-to-7-days">
				<description>
					<ref-info refs="Mekki"> Ebola, Marburg and Lassa viruses produced cytopathic effect in Vero cells, commencing at the 7th day post inoculation.  In CV-1 cells, cytopathic effect was observed on the 5th day post inoculation for Ebola and on the 6th day post inoculation for Marburg and Lassa viruses.  In both Vero and CV-1 cells, Ebola and Marburg virus particles were detected by electron microscopy three days post inoculation.  Lassa particles were detected on the 4th and 6th days post inoculaton in CV-1 and Vero cells, respectively.  In both cell lines, the three viruses were detected by EM before the appearance of cytopathic effect.  Viral antigens of Ebola, Marburg and Lassa were detected by indirect immunofluorescence on the 3rd day post inoculation in Vero cells.  In CV-1 cells, Marburg and Lassa antigens were detected on the 2nd day post inoculation, a day earlier than in Vero cells.  While Ebola antigens were detected on the 3rd day post inoculation in both systems, fluorescent foci were much more pronounced in CV-1 than in Vero cells. </ref-info>
				</description>
			</organism-detection>
			<organism-detection name="Immunofluorescence Microscopy" type="immunofluorescence-microscopy">
				<description>
					<ref-info refs="Saijo"> A novel recombinant baculovirus which expresses Ebola virus (EBO) nucleoprotein (NP) under the control of the cytomegalovirus immediate-early promoter was constructed. HeLa cells abortively infected with the baculovirus expressed EBO NP, and this was used as an immunofluorescent (IF) antigen to detect EBO immunoglobulin G (IgG) antibody. This IF method has high efficacy in detecting EBO IgG antibody in clinical specimens, indicating its usefulness in the diagnosis of EBO infections and seroepidemiological studies. </ref-info>
					<ref-info refs="Saijo">In previous reports on the seroepidemiology of EBO, inactivated EBO-infected cells were used as antigens for indirect IF methods. Our IF method may offer an attractive alternative to the use of live EBO-infected cells, which should be handled in a biosafety level 4 laboratory. </ref-info>
				</description>
				<false-positive>
					<ref-info refs="Saijo">  Among the 48 sera from subjects without a history of EBO infections, one showed positive staining at a dilution of 1:100. We could not rule out the possibility that this serum had IgG antibodies specific to EBO. Even if the positive reaction by 1 of the 48 control sera was nonspecific, the IF system using rEBO NP-expressing HeLa cells has high efficacy in detecting EBO-specific IgG, with 100% sensitivity and 98% specificity. The number of serum samples used for the evaluation of this IF system was small; these results indicate the usefulness of this IF method for detection of EBO-specific IgG antibody. </ref-info>
				</false-positive>
			</organism-detection>
			<organism-detection name="Virus isolation in animals" type="other" refs="Peters">
				<description>
					<ref-info refs="Peters"> Innoculation of guinea pigs or monkeys, or sometimes mice or hamsters.  Animals may become ill or require blind passage.  This procedure is time consuming, expensive, and dangerous, but probably the most sensitive.  BSL-4 laboratory required. </ref-info>
				</description>
			</organism-detection>
			<organism-detection name="Indirect immunoelectron microscopy" type="other" time-to-perform="1-hour-to-1-day">
				<description>
					<ref-info refs="Geisbert2"> An indirect immunoelectron microscopy method, which uses homologous guinea pig polyclonal antiserum, successfully identified Ebola-related (Reston) virus particles in serum and tissue culture fluid specimens with infectivity titres of 300 plaque forming units (pfu) per ml or more. The sensitivity of this procedure is sufficient to show virus in most acute phase sera, and is equal to that of the antigen capture enzyme linked immunosorbent assay (ELISA). The immunoelectron microscopy fluid technique can differentiate among antigenically distinct filoviruses in less than three hours. It should be valuable in the rapid diagnosis of potential filoviral infections. </ref-info>
				</description>
			</organism-detection>
			<immunoassay name="Haemagglutination" type="haemagglutination">
				<description>
					<ref-info refs="Rodhain"> Sera collected in May 1984 from 132 adult residents of Karamoja district, Uganda, were examined by haemagglutination inhibition tests for antibodies against selected arboviruses.  A few individuals had antibodies against Crimean-Congo haemorrhagic fever, Lassa, Ebola and Marburg viruses, suggesting that these viruses all circulate in the area. </ref-info>
				</description>
			</immunoassay>
			<immunoassay name="ELISA using Antibody against Nucleoprotein" type="ELISA">
				<description>
					<ref-info refs="Niikura"> We developed an Ebola virus antigen-detection enzyme-linked immunosorbent assay (ELISA) system using a novel monoclonal antibody (MAb) to the nucleoprotein (NP). This antibody recognized an epitope defined by a 26-amino-acid stretch near the C terminus of NP. In a sandwich ELISA system with the MAb, as little as 30 ng of purified recombinant NP (rNP) was detected. Although this MAb was prepared by immunization with rNP of subtype Zaire, it also reacted to the corresponding region of NP derived from the Reston and Sudan subtypes. These results suggest that our ELISA system should work with three of four Ebola subtypes. Furthermore, our ELISA system detected the NP in subtype Reston-infected monkey specimens, while the background level in noninfected specimens was very low, suggesting the usefulness of the ELISA for laboratory diagnosis with clinical specimens.</ref-info>
					<ref-info refs="Niikura"> One of the advantages of our new ELISA system is that the highest level of security containment is not required, since no live virus except that in the clinical specimens is involved. This means that an ordinarily equipped laboratory can reproduce the system as long as the secondary polyclonal antibody, which can also be prepared by use of noninfectious recombinant protein, is available. The disadvantage is that it uses only one MAb that recognizes at least three of four subtypes of Ebola virus. Although Ebola virus is genetically stable  and so far only four subtypes have been reported, there is no guarantee that this MAb cross-reacts with all the minor variants that might appear in the future.</ref-info>
					<ref-info refs="Sanchez2"> Detection of either Ebola or Marburg virus antigen by antigen-capture enzyme-linked immunosorbent assay (ELISA) has often been the most rapid means of diagnosing infections.  The assay time is approximately 3 to 4 hours, and detection of antigen in the blood or serum of either nonhuman primates or patients in the acute course of the disease was very successful when compared to virus isolation or to RT-PCR for Ebola viruses.  This assay was also useful in detection of virus antigen in frozen tissues.</ref-info>
				</description>
			</immunoassay>
			<immunoassay name="EIA" type="ELISA">
				<description>
					<ref-info refs="Ksiazek"> EIAs for IgG and IgM antibodies directed against Ebola (EBO) viral antigens have been developed and evaluated using sera of animals and humans surviving infection with EBO viruses. The IgM capture assay detected anti-EBO (subtype Reston) antibodies in the sera of 5 of 5 experimentally infected animals at the time they succumbed to lethal infections. IgM antibodies were also detected in the serum of a human who was infected with EBO (subtype Reston) during a postmortem examination of an infected monkey. The antibody was detectable as early as day 6 after infection in experimentally infected animals and persisted for less than 90 days. The IgG response was less rapid; however, it persisted for more than 400 days in 3 animals who survived infection, and it persisted for approximately 10 years after infection in the sera of 2 humans. Although these data are limited by the number of sera available for verification, the IgM assay seems to have great promise as a diagnostic tool. Furthermore the long-term persistence of the IgG antibodies measured by this test strongly suggests that the ELISA will be useful in field investigations of EBO virus.</ref-info>
					<ref-info refs="Sanchez2">IgM-capture antibody ELISA proved useful in the diagnosis of recent infections in surviving patients.  The IgG response of the patients was somewhat delayed and realistically could be expected only in the early convalescent sera of those patients who were destined to recover from their infections.  The IgM antibodies detected by this test have been found to persist for only 2 to 3 months in macaques that were experimentally infected and a similar relatively short period in surviving humans. </ref-info>
				</description>
			</immunoassay>
			<immunoassay name="ELISA using Antibody against Glycoprotein" type="ELISA">
				<description>
					<ref-info refs="Lucht">Monoclonal antibodies to EBOV were produced from mice immunized with inactivated EBOV species Zaire. Antibodies directed against the viral glycoprotein GP were characterized by ELISA, Western blot and immunofluorescence analyses. An antigen capture ELISA was established, which is specific for EBOV-Zaire and shows a sensitivity of approximately 10(3) plaque-forming units/ml. Since the ELISA is able to detect even SDS-inactivated EBOV in spiked human sera, it could complement the existing diagnostic tools in the field and in routine laboratories where high containment facilities are not available.  The sensitivity of the assay corresponded to approximately 10(3) pfu/ml serum.</ref-info>
				</description>
			</immunoassay>
			<immunoassay name="ELISA using Antibody against Reston Nucleoprotein" type="ELISA">
				<description>
					<ref-info refs="Ikegami">Antigen capture ELISAs was developed using two novel MAbs, Res2-6C8 and Res2-1D8, specific to the NP of EBO-R. Res2-6C8 and Res2-1D8 recognized epitopes consisting of 4 and 8 amino acid residues, respectively, near the C-terminal region of the EBO-R NP. The antigen capture ELISAs using these two MAbs detected the EBO-R NP in the tissues from EBO-R-infected cynomolgus macaques. The antigen capture ELISAs using Res2-6C8 and Res2-1D8 are useful for the rapid detection of the NP in EBO-R-infected cynomolgus macaques (Ikegami et al., 2003).  The ELISA prepared with 3-3D detected His-EBO-R-NP upto the dilution of 1:32,000.</ref-info>
				</description>
			</immunoassay>
			<immunoassay name="ELISA using Antibody against VP40" type="ELISA">
				<description>
					<ref-info refs="LuchtB">An antigen capture enzyme-linked immunosorbent assay was established, which detects VP40 of all known species of EBOV. This assay could detect viral material in spiked human serum that has been sodium dodecylsulfate-inactivated. The established enzyme-linked immunosorbent assay therefore has the ability to become a very useful tool for obtaining an accurate diagnosis in the field, limiting the risk of laboratory infections.  The sensitivity of the assay corresponded to 10(3) to 10(4) pfu/ml serum.</ref-info>
				</description>
			</immunoassay>
			<immunoassay name="Western Blotting using ABs against Nucleoprotein and VP40" type="western-blotting">
				<description>
					<ref-info refs="Leroy2"> Purified Ebola virus from tissue culture medium was loaded on 10% sodium dodecyl sulfate-polyacrylamide gel and transferred onto a polyvinylidene fluoride membrane at 55 V for 3 h at 4 degrees celcius. Protein immunoblotting analysis was done with serum samples diluted in a ratio of 1:500, and a secondary antibody (goat antibody to human IgG peroxidase conjugate) in a dilution of 1:30000. All incubations were done for 1 h at room temperature (Leroy et al., 2000).  Western-blot analysis showed that IgG responses were directed to nucleoprotein and viral protein of 40 kDa. </ref-info>
				</description>
			</immunoassay>
			<immunoassay name="Enzyme immunoassay" type="other">
				<description>
					<ref-info refs="Merzlikin"> Enzyme immunoassay (EIA) test systems for the detection of antigens and antibodies to Ebola virus were developed and tried. The test system for the detection of Ebola virus antigens based on direct solid-phase EIA detects viral antigens in culture fluid of infected Vero cells, in the blood sera, and in homogenates of infected tissues. Use of this test system allows detection of at least 10 ng of viral proteins or 5.0 x 10(3) to 1.0 x 10(4) PFU/ml in infectious material. The test system is prepared on the basis of protein A - horseradish peroxidase conjugate. It is universal for the testing of animal and human sera and is characterized by high resolution and reproducibility of results. It allows detection of antibodies to Ebola virus starting from days 8-9 of infection. A higher sensitivity of direct solid-phase EIA in comparison with complement fixation or indirect immunofluorescence tests is demonstrated. </ref-info>
				</description>
			</immunoassay>
			<immunoassay name="Indirect Fluorescent Antibody (IFA)" type="other">
				<description>
					<ref-info refs="Peters"> IFA is widely used.  It is adaptable to field situations, if fluorescnt microscope is available.  Until recently, it was the most reliable test available.</ref-info>
				</description>
			</immunoassay>
			<immunoassay name="Immunofluorescence focus assay" type="other" time-to-perform="1-to-2-days">
				<description>
					<ref-info refs="Truant"> A 48-h indirect immunofluorescence focus assay for the quantitation of Ebola virus was developed, utilizing HeLa-229 cell monolayers. The dose dependency and the sensitivity of this assay as compared with conventional assays are reported. This indirect immunofluorescence focus assay can be used as a rapid, quantitative test for the detection of Ebola virus. </ref-info>
				</description>
			</immunoassay>
			<nucleic-acid-detection>
				<PCR name="PCR Identifies Polymerase Gene">
					<description>
						<ref-info refs="Drosten2">Ebola and Marburg viruses can be detected by Filoviridae specific primers binding to the polymerase gene.  These primers target sites that are highly conserved among the virus family and were applied in PCRs of conventional and real-time format (Drosten et al. 2003).  Clinical sensitivity is 100%.</ref-info>
					</description>
					<primers name="Filo-B and Filo-A" refs="Sanchez3">
						<forward>
							<ref-info refs="Sanchez3">atgtggtgggttataataatcactgacatg(g)</ref-info>
						</forward>
						<reverse>
							<ref-info refs="Sanchez3">atcggaatttttctttctcatt(ag)</ref-info>
						</reverse>
						<product size="419 bp" />
					</primers>
				</PCR>
				<PCR name="PCR Identifies Glycoprotein Gene">
					<description>
						<ref-info refs="Drosten2">The glycoprotein gene of Ebola virus is used as a target to detect all four subtypes of Ebola virus (Zaire, Sudan, Ivory Coast, Reston), but not Marburg virus (Drosten et al., 2003).  Clinical sensitivity is 100%.</ref-info>
					</description>
					<primers name="EBO-GP2 and EBO-GP1" refs="Sanchez3">
						<forward>
							<ref-info refs="Sanchez3">ttttttagtttcccagaaggcccact(g)</ref-info>
						</forward>
						<reverse>
							<ref-info refs="Sanchez3">aatgggctgaaaattgctacaatc(ag)</ref-info>
						</reverse>
						<product size="580 bp" />
					</primers>
				</PCR>
				<PCR name="PCR Identifies Nucleoprotein gene">
					<description>
						<ref-info refs="Sanchez3">A similar rTth-based single tube RT-PCR assay was developed to target EBO-R NP gene sequences.  This assay was extremely rapid and sensitive in detecting viral RNA for all known strains of EBO-R.  Results of assays done in parallel with antigen-capture assays on animals from the 1996 outbreak in Alice, Texas, and in samples obtained during a subsequent investigation of a Phillipine primate export facility (the source of the infected monkeys shipped to Alice) showed 100% correlation with results of antigen-capture assays. </ref-info>
					</description>
					<primers name="RES-NP2 and RES-NP1" refs="Sanchez3">
						<forward>
							<ref-info refs="Sanchez3">caagaaattagtcctcatcaatc(g)</ref-info>
						</forward>
						<reverse>
							<ref-info refs="Sanchez3">gtatttggaaggtcatggattc(ag)</ref-info>
						</reverse>
						<product size="337 bp" />
					</primers>
				</PCR>
				<PCR name="PCR for NP gene Sequence">
					<description>
						<ref-info refs="Sanchez3">A RT-PCR assay, using the polymerase rTth and targeting NP gene sequences, was subsequently developed and found to be more sensitive in detecting EBO-Z RNA from whole blood than were assays directed at L gene sequences.</ref-info>
					</description>
					<primers name="ZAI-NP2 and ZAI-NP1" refs="Sanchez3">
						<forward>
							<ref-info refs="Sanchez3">gcatattgttggagttgcttctcagc(g)</ref-info>
						</forward>
						<reverse>
							<ref-info refs="Sanchez3">ggaccgccaaggtaaaaaatga(ag)</ref-info>
						</reverse>
						<product size="268 bp" />
					</primers>
				</PCR>
				<PCR name="RT-PCR">
					<description>
						<ref-info refs="Morvan"> We tested for EBO virus in the organs of 242 small mammals captured during ecological studies in the Central African Republic. EBO virus glycoprotein or polymerase gene sequences were detected by reverse transcription PCR in RNA extracts of the organs of seven animals and by PCR in DNA extract of one animal. </ref-info>
					</description>
					<primers refs="Morvan">
						<forward> EBO1: TGG GTA ATY ATC CTY TTC CA </forward>
						<reverse> EBO2: ACG ACA CCT TCA GCR AAA GT </reverse>
					</primers>
					<primers refs="Morvan">
						<forward> EBO3: GTT TGT CGK GAC AAA CTG TC</forward>
						<reverse> EBO4: TGG AAR GCW AAG TCW CCG G </reverse>
					</primers>
				</PCR>
				<PCR name="PCR-ABI PRISM 7700 sequence detection system">
					<description>
						<ref-info refs="Gibb2"> A one-tube reverse transcription-PCR assay for the identification of Ebola virus subtype Zaire (Ebola Zaire) and Ebola virus subtype Sudan (Ebola Sudan) was developed and evaluated by using the ABI PRISM 7700 sequence detection system. This assay uses one common primer set and two differentially labeled fluorescent probes to simultaneously detect and differentiate these two subtypes of Ebola virus. The sensitivity of the primer set was comparable to that of previously designed primer sets, as determined by limit-of-detection experiments. This assay is unique in its ability to simultaneously detect and differentiate Ebola Zaire and Ebola Sudan. In addition, this assay is compatible with emerging rapid nucleic acid analysis platforms and therefore may prove to be a very useful diagnostic tool for the control and management of future outbreaks. </ref-info>
					</description>
					<primers refs="Gibb2">
						<forward> 5&apos;-TGGGCTGAAAAYTGCTACAATC-3&apos; for the EBOGP-1D forward primer </forward>
						<reverse>5&apos;-CTTTGTGMACATASCGGCAC-3&apos; for the EBOGP-1D reverse primer </reverse>
					</primers>
					<false-negative>
						<ref-info refs="Gibb2"> All control samples lacking template were negative.</ref-info>
					</false-negative>
				</PCR>
				<other-test name="RT-PCR" refs="Leroy3">
					<description>
						<ref-info refs="Leroy3"> A reverse transcriptase-polymerase chain reaction (RT-PCR) assay was developed, implemented and evaluated at Centre International de Recherches Medicales de Franceville (CIRMF) in Gabon, to detect Ebola viral RNA in peripheral blood mononuclear cells (PBMC). Twenty-six laboratory-confirmed patients during and 5 after the acute phase of Ebola haemorrhagic fever, 15 healthy controls and 20 febrile patients not infected with Ebola virus were studied. RT-PCR results were compared with ELISA antigen capture, and Ebola specific IgM and IgG antibody detection. Ebola virus RNA was amplified from 26/26 specimens from the acute phase, 3/5 during recovery, 0/20 febrile patients and 1/15 negative controls. Sensitivity of RT-PCR in identifying acute infection and early convalescence compared with antigen or IgM detection was 100% and 91% respectively, and specificity compared with antigen detection and IgM assay combined was 97%. Antigen capture detected only 83% of those identified by PCR, and IgM only 67%. Ebola virus RNA was detected in all 13 fatalities, only 5 of whom had IgM and none IgG. RT-PCR detected Ebola RNA in PBMC one to three weeks after disappearance of symptoms when antigen was undetectable. RT-PCR was the most sensitive method and able to detect virus from early acute disease throughout early recovery. </ref-info>
					</description>
					<false-negative>
						<ref-info refs="Leroy3"> Ebola virus RNA was amplified from 26/26 specimens from the acute phase, 3/5 during recovery, 0/20 febrile patients and 1/15 negative controls.</ref-info>
					</false-negative>
				</other-test>
				<other-test name="Real-time reverse transcription-PCR" refs="Drosten">
					<description>
						<ref-info refs="Drosten"> Viral hemorrhagic fevers (VHFs) are acute infections with high case fatality rates. Important VHF agents are Ebola and Marburg viruses (MBGV/EBOV), Lassa virus (LASV), Crimean-Congo hemorrhagic fever virus (CCHFV), Rift Valley fever virus (RVFV), dengue virus (DENV), and yellow fever virus (YFV). VHFs are clinically difficult to diagnose and to distinguish; a rapid and reliable laboratory diagnosis is required in suspected cases. We have established six one-step, real-time reverse transcription-PCR assays for these pathogens based on the Superscript reverse transcriptase-Platinum Taq polymerase enzyme mixture. Novel primers and/or 5&apos;-nuclease detection probes were designed for RVFV, DENV, YFV, and CCHFV by using the latest DNA database entries. PCR products were detected in real time on a LightCycler instrument by using 5&apos;-nuclease technology (RVFV, DENV, and YFV) or SybrGreen dye intercalation (MBGV/EBOV, LASV, and CCHFV). The inhibitory effect of SybrGreen on reverse transcription was overcome by initial immobilization of the dye in the reaction capillaries. Universal cycling conditions for SybrGreen and 5&apos;-nuclease probe detection were established. Thus, up to three assays could be performed in parallel, facilitating rapid testing for several pathogens. All assays were thoroughly optimized and validated in terms of analytical sensitivity by using in vitro-transcribed RNA. The 95% detection limits as determined by probit regression analysis ranged from 1,545 to 2,835 viral genome equivalents/ml of serum (8.6 to 16 RNA copies per assay). The suitability of the assays was exemplified by detection and quantification of viral RNA in serum samples of VHF patients.</ref-info>
						<ref-info refs="Drosten">For statistically precise determination of the detection limit, four different concentrations of RNA transcript were spiked into human plasma prior to RNA preparation and tested in six replicates (24 test reactions per PCR assay). The numbers of positive and negative reactions obtained with each of the four RNA concentrations were subjected to probit regression analysis  to calculate the probability of achieving a positive result at any RNA concentration within the range of 0 to 10,000 copies per ml of plasma. Virus genome equivalents (geq) per milliliter of plasma which could be detected with 95% probability were as follows: LASV, 2,445 geq/ml (95% confidence interval, 1,848 to 3,903); MBGV/EBOV, 2,647 geq/ml (1,887 to 4,964); CCHFV, 2,779 geq/ml (2,021 to 6,017); YFV, 1,545 geq/ml (1,003 to 2,207); RVFV, 2,835 geq/ml (2,143 to 4,525); and DENV, 2,550 geq/ml (1,871 to 4,212). These detection limits corresponded to 8.6 to 16 geq per reaction, taking into account that RNA was prepared from 140 l of plasma and 1/25 of the RNA preparation was used as the template and assuming 100% efficiency in RNA preparation. </ref-info>
					</description>
					<false-positive>
						<ref-info refs="Drosten">The PCR set was used for about 30 suspected cases of VHF. As an inhibition control, in vitro-transcribed EBOV RNA was spiked into an aliquot of each RNA preparation and amplified in parallel with the test samples. Purification of RNA and performance of all six assays in two LightCycler runs was usually accomplished in less than 6 h. We have not encountered any false-positive RT-PCR results due to contamination.  To exemplify the suitability of the assays and to obtain first data on virus RNA levels in VHF patients, viral RNA concentrations in serum samples from patients with Ebola hemorrhagic fever, Lassa fever, Crimean-Congo hemorrhagic fever, yellow fever, and dengue fever were measured. The samples were amplified in parallel with in vitro-transcribed RNA of the corresponding virus as a quantification standard. All assays showed an excellent correlation (r 0.9) between cycle number and RNA concentration over a broad dynamic range. The patients were found to have high virus RNA concentrations in serum: one patient with Lassa fever had 7 x10(6) and 4 x10(9) geq/ml at days 4 and 13 of illness, respectively, and the other had 9 x 10(6) geq/ml on day 13 of illness; the patient with acute Ebola fever had 6.9 x 10(8) geq/ml, and the convalescent Ebola fever patient had 7 x 10(6) geq/ml; the patient with Crimean-Congo fever had 7.7 x 10(5) geq/ml; the patient with yellow fever had 4 x 10(5) geq/ml; and the patient with dengue fever had 8 x 10(5) geq/ml. Thus, virus concentrations in patients in the acute phase of VHF were orders of magnitudes above the 95% detection limits of the assays. </ref-info>
					</false-positive>
				</other-test>
			</nucleic-acid-detection>
		</diagnostic-tests>
	</labwork>
	<references>
		<journal refID="Drosten2" refName="Drosten et al., 2003" PMID="12615304">
			<author>
				<last-name>Drosten</last-name>
				<first-names>C</first-names>
			</author>
			<author>
				<last-name>Kummerer</last-name>
				<first-names>BM</first-names>
			</author>
			<author>
				<last-name>Schmitz</last-name>
				<first-names>H</first-names>
			</author>
			<other-authors> Gunther S.</other-authors>
			<title>Molecular diagnostics of viral hemorrhagic fevers</title>
			<journal-name>Antiviral Res</journal-name>
			<year>2003</year>
			<volume>57</volume>
			<issue>1-2</issue>
			<pages>
				<first>61</first>
				<last>87</last>
			</pages>
		</journal>
		<journal refID="Sanchez3" refName="Sanchez et al., 1999" PMID="9988180">
			<author>
				<last-name>Sanchez</last-name>
				<first-names>A</first-names>
			</author>
			<author>
				<last-name>Ksiazek</last-name>
				<first-names>TG</first-names>
			</author>
			<author>
				<last-name> Rollin</last-name>
				<first-names>PE</first-names>
			</author>
			<other-authors>Miranda ME, Trappier SG, Khan AS, Peters CJ, Nichol ST.</other-authors>
			<title>Detection and molecular characterization of Ebola viruses causing disease in human and nonhuman primates.</title>
			<journal-name>J Infect Dis</journal-name>
			<year>1999</year>
			<volume>179</volume>
			<issue>Suppl 1</issue>
			<pages>
				<first>S164</first>
				<last>S169</last>
			</pages>
		</journal>
		<journal refID="LuchtB" refName="Lucht et al., 2003B" PMID="12821193">
			<author>
				<last-name>Lucht</last-name>
				<first-names>A</first-names>
			</author>
			<author>
				<last-name>Grunow</last-name>
				<first-names>R</first-names>
			</author>
			<author>
				<last-name>Moller</last-name>
				<first-names>P</first-names>
			</author>
			<other-authors>Feldmann H, Becker S.</other-authors>
			<title>Development, characterization and use of monoclonal VP40-antibodies for the detection of Ebola virus.</title>
			<journal-name>J Virol Methods.</journal-name>
			<year>2003</year>
			<volume>111</volume>
			<issue>1</issue>
			<pages>
				<first>21</first>
				<last>28</last>
			</pages>
		</journal>
		<journal refID="Ikegami" refName="Ikegami et al., 2003" PMID="12853385">
			<author>
				<last-name>Ikegami</last-name>
				<first-names>T</first-names>
			</author>
			<author>
				<last-name>Niikura</last-name>
				<first-names>N</first-names>
			</author>
			<author>
				<last-name>Saijo</last-name>
				<first-names>M</first-names>
			</author>
			<other-authors>Miranda ME, Calaor AB, Hernandez M, Acosta LP, Manalo DL, Kurane I, Yoshikawa Y, Morikawa S.</other-authors>
			<title>Antigen capture enzyme-linked immunosorbent assay for specific detection of Reston Ebola virus nucleoprotein.</title>
			<journal-name>Clin Diagn Lab Immunol.</journal-name>
			<year>2003</year>
			<volume>6</volume>
			<issue>4</issue>
			<pages>
				<first>552</first>
				<last>557</last>
			</pages>
		</journal>
		<journal refID="Lucht" refName="Lucht et al., 2003" PMID="14593476">
			<author>
				<last-name>Lucht</last-name>
				<first-names>A</first-names>
			</author>
			<author>
				<last-name>Grunow</last-name>
				<first-names>R</first-names>
			</author>
			<author>
				<last-name>Otterbein</last-name>
				<first-names>C</first-names>
			</author>
			<other-authors>Moller P, Feldmann H, Becker S.</other-authors>
			<title>Production of monoclonal antibodies and development of an antigen capture ELISA directed against the envelope glycoprotein GP of Ebola virus.
</title>
			<journal-name>Med Microbiol Immunol (Berl).</journal-name>
			<year>2003</year>
			<volume>EPub-ahead of print</volume>
			<issue />
			<pages>
				<first />
				<last />
			</pages>
		</journal>
		<journal refID="Franz" refName="Franz et al., 1997" PMID="9244332">
			<author>
				<last-name> Franz </last-name>
				<first-names> David R. </first-names>
			</author>
			<author>
				<last-name> Jahrling </last-name>
				<first-names> Peter B. </first-names>
			</author>
			<author>
				<last-name> Friedlander </last-name>
				<first-names> Arthur M. </first-names>
			</author>
			<other-authors> McClain DJ, Hoover DL, Bryne WR, Pavlin JA, Christopher GW, Eitzen EM Jr. </other-authors>
			<title> Clinical recognition and management of patients exposed to biological warfare agents </title>
			<journal-name> JAMA </journal-name>
			<year> 1997 </year>
			<volume> 278 </volume>
			<issue> 5 </issue>
			<pages>
				<first> 399 </first>
				<last> 411 </last>
			</pages>
		</journal>
		<journal refID="Mekki" refName="Mekki and Van Der Groen, 1981" PMID="7024293">
			<author>
				<last-name> Mekki </last-name>
				<first-names> A.A. </first-names>
			</author>
			<author>
				<last-name> Van Der Groen </last-name>
				<first-names> G. </first-names>
			</author>
			<title> A comparison of indirect immunofluorescence and electron microscopy for the diagnosis of some haemorrhagic viruses in cell cultures </title>
			<journal-name> Journal of Virological Methods </journal-name>
			<year> 1981 </year>
			<volume> 3 </volume>
			<issue> 2 </issue>
			<pages>
				<first> 61 </first>
				<last> 69 </last>
			</pages>
		</journal>
		<journal refID="Gibb2" refName="Gibb et al., 2001" PMID="11682540">
			<author>
				<last-name> Gibb </last-name>
				<first-names> T.R. </first-names>
			</author>
			<author>
				<last-name> Norwood Jr </last-name>
				<first-names> D.A. </first-names>
			</author>
			<author>
				<last-name>Woollen  </last-name>
				<first-names> N. </first-names>
			</author>
			<other-authors> Henchal </other-authors>
			<title> Development and evaluation of a fluorogenic 5&apos; nuclease assay to detect and differentiate between Ebola virus subtypes Zaire and Sudan </title>
			<journal-name> J Clin Microbiol  </journal-name>
			<year> 2001 </year>
			<volume> 39 </volume>
			<issue> 11 </issue>
			<pages>
				<first> 4125 </first>
				<last> 4130 </last>
			</pages>
		</journal>
		<journal refID="Drosten" refName="Drosten et al., 2002" PMID=" 12089242">
			<author>
				<last-name> Drosten </last-name>
				<first-names> C. </first-names>
			</author>
			<author>
				<last-name> Gottig </last-name>
				<first-names> S. </first-names>
			</author>
			<author>
				<last-name> Schilling </last-name>
				<first-names> S. </first-names>
			</author>
			<other-authors> Asper M, Panning M, Schmitz H, Gunther S. </other-authors>
			<title> Rapid detection and quantification of RNA of Ebola and Marburg viruses, Lassa virus, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, dengue virus, and yellow fever virus by real-time reverse transcription-PCR </title>
			<journal-name>  J Clin Microbiol </journal-name>
			<year> 2002 </year>
			<volume> 40 </volume>
			<issue> 7 </issue>
			<pages>
				<first> 2323 </first>
				<last> 2330 </last>
			</pages>
		</journal>
		<journal refID="Bray2" refName="Bray and Paragas, 2002" PMID="11888653">
			<author>
				<last-name> Bray </last-name>
				<first-names> Mike </first-names>
			</author>
			<author>
				<last-name> Paragas </last-name>
				<first-names> Jason </first-names>
			</author>
			<title> Experimental therapy of filovirus infections </title>
			<journal-name> Antiviral Research </journal-name>
			<year> 2002 </year>
			<volume> 54 </volume>
			<issue> 1 </issue>
			<pages>
				<first> 1 </first>
				<last> 17 </last>
			</pages>
		</journal>
		<journal refID="Beer" refName="Beer et al., 1999" PMID="10024977">
			<author>
				<last-name> Beer  </last-name>
				<first-names> Brigitte </first-names>
			</author>
			<author>
				<last-name> Kurth </last-name>
				<first-names> Reinhard </first-names>
			</author>
			<author>
				<last-name> Bukreyev </last-name>
				<first-names> Alexander </first-names>
			</author>
			<title> Characteristics of Filoviridae: Marburg and Ebola viruses </title>
			<journal-name> Naturwissenschaften </journal-name>
			<year> 1999 </year>
			<volume> 86 </volume>
			<issue> 1 </issue>
			<pages>
				<first> 8 </first>
				<last> 17 </last>
			</pages>
		</journal>
		<journal refID="Truant" refName="Truant et al., 1983" PMID="6352735">
			<author>
				<last-name> Truant </last-name>
				<first-names> A.L. </first-names>
			</author>
			<author>
				<last-name> Regnery </last-name>
				<first-names> R.L. </first-names>
			</author>
			<author>
				<last-name> Kiley </last-name>
				<first-names> M.P. </first-names>
			</author>
			<title> Development of an immunofluorescence focus assay for Ebola virus </title>
			<journal-name> J Clin Microbiol </journal-name>
			<year> 1983 </year>
			<volume> 18 </volume>
			<issue> 2 </issue>
			<pages>
				<first> 416 </first>
				<last> 419 </last>
			</pages>
		</journal>
		<journal refID="Morvan" refName="Morvan et al., 1999" PMID="10580275">
			<author>
				<last-name> Morvan </last-name>
				<first-names> J.M. </first-names>
			</author>
			<author>
				<last-name> Deubel </last-name>
				<first-names> V. </first-names>
			</author>
			<author>
				<last-name> Gounon </last-name>
				<first-names> P. </first-names>
			</author>
			<other-authors> Nakoune E, Barriere P, Murri S, Perpete O, Selekon B, Coudrier D, Gautier-Hion A, Colyn M, Volehkov V. </other-authors>
			<title> Identification of Ebola virus sequences present as RNA or DNA in organs of terrestrial small mammals of the Central African Republic </title>
			<journal-name> Microbes Infect  </journal-name>
			<year> 1999 </year>
			<volume> 1 </volume>
			<issue> 14 </issue>
			<pages>
				<first> 1193 </first>
				<last> 1201 </last>
			</pages>
		</journal>
		<journal refID="Leroy3" refName="Leroy et al., 2000" PMID="10686031">
			<author>
				<last-name> Leroy </last-name>
				<first-names> E.M. </first-names>
			</author>
			<author>
				<last-name> Baize </last-name>
				<first-names> S. </first-names>
			</author>
			<author>
				<last-name> Lu </last-name>
				<first-names> C.Y. </first-names>
			</author>
			<other-authors> McCormick JB, Georges AJ, Georges-Courbot MC, Lansoud-Soukate J, Fisher-Hoch SP.
 </other-authors>
			<title> Diagnosis of Ebola haemorrhagic fever by RT-PCR in an epidemic setting </title>
			<journal-name> J Med Virol </journal-name>
			<year> 2000 </year>
			<volume> 60 </volume>
			<issue> 4 </issue>
			<pages>
				<first> 463 </first>
				<last> 467 </last>
			</pages>
		</journal>
		<journal refID="Leroy2" refName="Leroy et al, 2000B" PMID="10881895">
			<author>
				<last-name> Leroy </last-name>
				<first-names> E.M. </first-names>
			</author>
			<author>
				<last-name> Baize </last-name>
				<first-names> S. </first-names>
			</author>
			<author>
				<last-name> Volchkov </last-name>
				<first-names> V.E. </first-names>
			</author>
			<other-authors> Fisher-Hoch SP, Georges-Courbot MC, Lansoud-Soukate J, Capron M, Debre P, McCormick JB, Georges AJ. </other-authors>
			<title> Human asymptomatic Ebola infection and strong inflammatory response </title>
			<journal-name> Lancet </journal-name>
			<year> 2000 </year>
			<volume> 355 </volume>
			<issue> 9222 </issue>
			<pages>
				<first> 2210 </first>
				<last> 2215 </last>
			</pages>
		</journal>
		<journal refID="Niikura" refName="Niikura et al., 2001" PMID="11526161">
			<author>
				<last-name> Niikura </last-name>
				<first-names> M. </first-names>
			</author>
			<author>
				<last-name> Ikegami </last-name>
				<first-names> T. </first-names>
			</author>
			<author>
				<last-name> Saijo </last-name>
				<first-names> M.  </first-names>
			</author>
			<other-authors> Kurane I, Miranda ME, Morikawa S. </other-authors>
			<title> Detection of Ebola viral antigen by enzyme-linked immunosorbent assay using a novel monoclonal antibody to nucleoprotein </title>
			<journal-name> J Clin Microbiol </journal-name>
			<year> 2001 </year>
			<volume> 39 </volume>
			<issue> 9 </issue>
			<pages>
				<first> 3267 </first>
				<last> 3271 </last>
			</pages>
		</journal>
		<journal refID="Merzlikin" refName="Merzlikin et al., 1995" PMID="7740786">
			<author>
				<last-name> Merzlikin </last-name>
				<first-names> N.V. </first-names>
			</author>
			<author>
				<last-name> Chepurnov </last-name>
				<first-names> A.A. </first-names>
			</author>
			<author>
				<last-name> Istomina </last-name>
				<first-names> N.N. </first-names>
			</author>
			<other-authors> Ofitserov VI, Vorob&apos;eva MS. </other-authors>
			<title> Development and application of an immunoenzyme test system for diagnosing Ebola fever </title>
			<journal-name> Vopr Virusol  </journal-name>
			<year> 1995 </year>
			<volume> 40 </volume>
			<issue> 1 </issue>
			<pages>
				<first> 31 </first>
				<last> 35 </last>
			</pages>
		</journal>
		<journal refID="Rodhain" refName="Rodhain et al., 1989" PMID="2559514">
			<author>
				<last-name> Rodhain </last-name>
				<first-names> F. </first-names>
			</author>
			<author>
				<last-name> Gonzales </last-name>
				<first-names> J. P. </first-names>
			</author>
			<author>
				<last-name> Mercier </last-name>
				<first-names> E. </first-names>
			</author>
			<other-authors> Helynck B, Larouze B, Hannoun C. </other-authors>
			<title> Arbovirus infections and viral haemorrhagic fevers in Uganda: a serological survey in Karamoja district, 1984 </title>
			<journal-name> Trans R Soc Trop Med Hyg  </journal-name>
			<year> 1989 </year>
			<volume> 83 </volume>
			<issue> 6 </issue>
			<pages>
				<first> 851 </first>
				<last> 854 </last>
			</pages>
		</journal>
		<journal refID="Geisbert2" refName="Geisbert et al., 1991" PMID="2066435">
			<author>
				<last-name> Geisbert </last-name>
				<first-names> T. W. </first-names>
			</author>
			<author>
				<last-name> Rhoderick </last-name>
				<first-names> J.B. </first-names>
			</author>
			<author>
				<last-name> Jahrling </last-name>
				<first-names> P.B. </first-names>
			</author>
			<title> Rapid identification of Ebola virus and related filoviruses in fluid specimens using indirect immunoelectron microscopy </title>
			<journal-name>  J Clin Pathol  </journal-name>
			<year> 1991 </year>
			<volume> 44 </volume>
			<issue> 6 </issue>
			<pages>
				<first> 521 </first>
				<last> 522 </last>
			</pages>
		</journal>
		<journal refID="Saijo" refName="Saijo et al., 2001" PMID="11158150">
			<author>
				<last-name> Saijo </last-name>
				<first-names> Masayuki  </first-names>
			</author>
			<author>
				<last-name> Niikura </last-name>
				<first-names> Masahiro  </first-names>
			</author>
			<author>
				<last-name>  Morikawa </last-name>
				<first-names> Shigeru </first-names>
			</author>
			<other-authors> Kurane </other-authors>
			<title> Immunofluorescence Method for Detection of Ebola Virus Immunoglobulin G, Using HeLa Cells Which Express Recombinant Nucleoprotein </title>
			<journal-name> Journal of Clinical Microbiology </journal-name>
			<year> 2001 </year>
			<volume> 39 </volume>
			<issue> 2 </issue>
			<pages>
				<first> 776 </first>
				<last> 778 </last>
			</pages>
		</journal>
		<journal refID="Stroher" refName="Stroher et al., 2001" PMID="11602743">
			<author>
				<last-name> Stroher </last-name>
				<first-names> Ute </first-names>
			</author>
			<author>
				<last-name> West </last-name>
				<first-names> Elmar </first-names>
			</author>
			<author>
				<last-name> Bugany </last-name>
				<first-names> Harald </first-names>
			</author>
			<other-authors> Klenk HD, Schnittler HJ, Feldmann H. </other-authors>
			<title> Infection and Activation of Monocytes by Marburg and Ebola Viruses </title>
			<journal-name> Journal of Virology </journal-name>
			<year> 2001 </year>
			<volume> 75 </volume>
			<issue> 22 </issue>
			<pages>
				<first> 11025 </first>
				<last> 11033 </last>
			</pages>
		</journal>
		<journal refID="Gibb" refName="Gibb et al., 2002" PMID="11777824">
			<author>
				<last-name> Gibb </last-name>
				<first-names> Tammy R. </first-names>
			</author>
			<author>
				<last-name> Norwood </last-name>
				<first-names> David A. </first-names>
			</author>
			<author>
				<last-name> Woollen </last-name>
				<first-names> Neal </first-names>
			</author>
			<other-authors> Henchal </other-authors>
			<title> Viral Replication and Host Gene Expression in Alveolar Macrophages Infected with Ebola Virus (Zaire Strain) </title>
			<journal-name> Clinical and Diagnostic Laboratory Immunology </journal-name>
			<year> 2002 </year>
			<volume> 9 </volume>
			<issue> 1 </issue>
			<pages>
				<first> 19 </first>
				<last> 27 </last>
			</pages>
		</journal>
		<journal refID="Feldmann" refName="Feldmann et al., 2001" PMID="11714958">
			<author>
				<last-name> Feldmann </last-name>
				<first-names> Heinz </first-names>
			</author>
			<author>
				<last-name> Volchkov </last-name>
				<first-names> Viktor E. </first-names>
			</author>
			<author>
				<last-name> Volchkov </last-name>
				<first-names> Valentina A. </first-names>
			</author>
			<other-authors> Stroher U, Klenk HD.</other-authors>
			<title> Biosynthesis and role of filoviral glycoproteins </title>
			<journal-name> Journal of General Virology </journal-name>
			<year> 2001 </year>
			<volume> 82 </volume>
			<issue> Pt 12 </issue>
			<pages>
				<first> 2839 </first>
				<last> 2848 </last>
			</pages>
		</journal>
		<journal refID="Ryabchikova" refName="Ryabchikova et al., 1999" PMID="9988185">
			<author>
				<last-name> Ryabchikova </last-name>
				<first-names> Elena I. </first-names>
			</author>
			<author>
				<last-name> Kolesnikova </last-name>
				<first-names>Larisa V.  </first-names>
			</author>
			<author>
				<last-name> Luchko </last-name>
				<first-names> Sergei V.  </first-names>
			</author>
			<title> An analysis of features of pathogenesis in two animal models of Ebola virus infection </title>
			<journal-name> J infect Dis </journal-name>
			<year> 1999 </year>
			<volume> 179 </volume>
			<issue> Suppl 1 </issue>
			<pages>
				<first> S199 </first>
				<last> S202 </last>
			</pages>
		</journal>
		<journal refID="Bray" refName="Bray et al., 1999" PMID="9988191">
			<author>
				<last-name> Bray </last-name>
				<first-names> M. </first-names>
			</author>
			<author>
				<last-name> Davis </last-name>
				<first-names> K. </first-names>
			</author>
			<author>
				<last-name> Geisbert </last-name>
				<first-names> T. </first-names>
			</author>
			<other-authors> Schmaljohn C, Huggins J. </other-authors>
			<title> A mouse model for evaluation of prophylaxis and therapy of Ebola hemorrhagic fever </title>
			<journal-name> J. Infect. Dis </journal-name>
			<year> 1999 </year>
			<volume> 179 </volume>
			<issue> Suppl 1 </issue>
			<pages>
				<first> S248 </first>
				<last> S258 </last>
			</pages>
		</journal>
		<journal refID="Parren" refName="Parren et al., 2002" PMID="12021376">
			<author>
				<last-name> Parren </last-name>
				<first-names> Paul W. H. I. </first-names>
			</author>
			<author>
				<last-name> Geisbert </last-name>
				<first-names> Tom W. </first-names>
			</author>
			<author>
				<last-name> Maruyama </last-name>
				<first-names> Toshiaki </first-names>
			</author>
			<other-authors> Jahrling PB, Burton DR. </other-authors>
			<title> Pre- and Postexposure Prophylaxis of Ebola Virus Infection in an Animal Model by Passive Transfer of a Neutralizing Human Antibody </title>
			<journal-name> Journal of Virology </journal-name>
			<year> 2002 </year>
			<volume> 76 </volume>
			<issue> 12 </issue>
			<pages>
				<first> 6408 </first>
				<last> 6412 </last>
			</pages>
		</journal>
		<journal refID="MMWR" refName="MMWR, 1988" PMID="3126390">
			<author>
				<last-name />
				<first-names />
			</author>
			<title> Management of Patients With Suspected Viral Hemorrhagic Fever </title>
			<journal-name> MMWR </journal-name>
			<year> 1988 </year>
			<volume> 37 </volume>
			<issue> S3 </issue>
			<pages>
				<first> 1 </first>
				<last> 16 </last>
			</pages>
		</journal>
		<journal refID="Kerstiens" refName="Kerstiens and Matthy, 1999" PMID="9988193">
			<author>
				<last-name> Kerstiens </last-name>
				<first-names> Barbara </first-names>
			</author>
			<author>
				<last-name> Matthy </last-name>
				<first-names> Francine </first-names>
			</author>
			<title> Interventions to Control Virus Transmission during an Outbreak of Ebola Hemorrhagic Fever: Experience from Kikwit, Democratic Republic of the Congo, 1995 </title>
			<journal-name> J Infect Dis </journal-name>
			<year> 1999 </year>
			<volume> 179 </volume>
			<issue> Suppl 1 </issue>
			<pages>
				<first> S263 </first>
				<last> S267 </last>
			</pages>
		</journal>
		<journal refID="Khan" refName="Khan et al., 1999" PMID="9988168">
			<author>
				<last-name> Khan </last-name>
				<first-names> Ali S </first-names>
			</author>
			<author>
				<last-name> Tshioko </last-name>
				<first-names> F. Kweteminga </first-names>
			</author>
			<author>
				<last-name> Heymann </last-name>
				<first-names> David L. </first-names>
			</author>
			<other-authors> Le Guenno B, Nabeth P, Kerstiens B, Fleerackers Y, Kilmarx PH, Rodier GR, Nkuku O, Rollin PE, Sanchez A, Zaki SR, Swanepoel R, Tomori O, Nichol ST, Peters CJ, Muyembe-Tamfum JJ, Ksiazek TG. </other-authors>
			<title> The Reemergence of Ebola Hemorrhagic Fever, Democratic Republic of the Congo, 1995 </title>
			<journal-name> J Infect Dis </journal-name>
			<year> 1999</year>
			<volume> 179 </volume>
			<issue> Suppl 1 </issue>
			<pages>
				<first> S76 </first>
				<last> S86 </last>
			</pages>
		</journal>
		<journal refID="Jaax" refName="Jaax et al., 1996" PMID="8712894">
			<author>
				<last-name> Jaax </last-name>
				<first-names> N.K. </first-names>
			</author>
			<author>
				<last-name> Davis </last-name>
				<first-names> K.J. </first-names>
			</author>
			<author>
				<last-name> Geisbert  </last-name>
				<first-names> T.P. </first-names>
			</author>
			<title> Lethal experimental infection of rhesus monkeys with Ebola-Zaire (Mayinga) virus by the oral and conjunctival route of exposure </title>
			<journal-name> Arch Pathol Lab Med </journal-name>
			<year> 1996 </year>
			<volume> 120 </volume>
			<issue> 2 </issue>
			<pages>
				<first> 140 </first>
				<last> 155 </last>
			</pages>
		</journal>
		<journal refID="Monath" refName="Monath, 1999" PMID="9988176">
			<author>
				<last-name> Monath </last-name>
				<first-names> Thomas P. </first-names>
			</author>
			<title> Ecology of Marburg and Ebola viruses: speculations and directions for future research </title>
			<journal-name> J Infect Dis </journal-name>
			<year> 1999 </year>
			<volume> 179 </volume>
			<issue> Suppl 1 </issue>
			<pages>
				<first> S127 </first>
				<last> S138 </last>
			</pages>
		</journal>
		<journal refID="Formenty2" refName="Formenty et al., 1999" PMID="9988164">
			<author>
				<last-name> Formenty  </last-name>
				<first-names> Pierre </first-names>
			</author>
			<author>
				<last-name> Hatz </last-name>
				<first-names> Christophe </first-names>
			</author>
			<author>
				<last-name> Le Guenno </last-name>
				<first-names> Bernard </first-names>
			</author>
			<other-authors> Stoll A, Rogenmoser P, Widmer A. </other-authors>
			<title> Human infection due to Ebola virus, subtype Cote d&apos;Ivoire: clinical and biologic presentation </title>
			<journal-name> J Infect Dis </journal-name>
			<year> 1999 </year>
			<volume> 179 </volume>
			<issue> Suppl 1 </issue>
			<pages>
				<first> S48 </first>
				<last> S53 </last>
			</pages>
		</journal>
		<journal refID="Geisbert" refName="Geisbert and Jahrling, 1995" PMID="8837880">
			<author>
				<last-name> Geisbert </last-name>
				<first-names> T.W. </first-names>
			</author>
			<author>
				<last-name> Jahrling </last-name>
				<first-names> P.B. </first-names>
			</author>
			<title> Differentiation of filoviruses by electron microscopy </title>
			<journal-name> Virus Research </journal-name>
			<year> 1995 </year>
			<volume> 39 </volume>
			<issue> 2, 3  </issue>
			<pages>
				<first> 129 </first>
				<last> 150 </last>
			</pages>
		</journal>
		<journal refID="Sanchez" refName="Sanchez et al., 1996" PMID="8622982">
			<author>
				<last-name> Sanchez </last-name>
				<first-names> A. </first-names>
			</author>
			<author>
				<last-name> Trappier </last-name>
				<first-names> S.G. </first-names>
			</author>
			<author>
				<last-name> Mahy </last-name>
				<first-names> B.W. </first-names>
			</author>
			<other-authors> Peters CJ, Nichol ST. </other-authors>
			<title> The virion glycoproteins of Ebola viruses are encoded in two reading frames and are expressed through transcriptional editing </title>
			<journal-name> Proc Natl Acad Sci U S A </journal-name>
			<year> 1996 </year>
			<volume> 93 </volume>
			<issue> 8 </issue>
			<pages>
				<first> 3602 </first>
				<last> 3607 </last>
			</pages>
		</journal>
		<journal refID="Knobloch" refName="Knobloch et al., 1977" PMID="21783">
			<author>
				<last-name> Knobloch </last-name>
				<first-names> J. </first-names>
			</author>
			<author>
				<last-name> Dietrich </last-name>
				<first-names> M. </first-names>
			</author>
			<author>
				<last-name> Peters  </last-name>
				<first-names> D. </first-names>
			</author>
			<other-authors> Nielsen G, Schumacher HH. </other-authors>
			<title> Maridi haemorrhgic fever: a new viral disease </title>
			<journal-name> Dtsch Med Wochenschr  </journal-name>
			<year> 1977 </year>
			<volume> 102 </volume>
			<issue> 44 </issue>
			<pages>
				<first> 1575 </first>
				<last> 1581 </last>
			</pages>
		</journal>
		<journal refID="Groseth" refName="Groseth et al., 2002" PMID="12191779">
			<author>
				<last-name> Groseth </last-name>
				<first-names> Allison </first-names>
			</author>
			<author>
				<last-name> Stroher </last-name>
				<first-names> Ute </first-names>
			</author>
			<author>
				<last-name> Theriault </last-name>
				<first-names> Steven </first-names>
			</author>
			<other-authors> Feldmann </other-authors>
			<title> Molecular characterization of an isolate from the 1989/90 epizootic of Ebola virus Reston among macaques imported into the United States </title>
			<journal-name> Virus Res </journal-name>
			<year> 2002 </year>
			<volume> 87 </volume>
			<issue> 2 </issue>
			<pages>
				<first> 155 </first>
				<last> 163 </last>
			</pages>
		</journal>
		<journal refID="Volchkov3" refName="Volchkov et al., 1998" PMID="9576958">
			<author>
				<last-name> Volchkov </last-name>
				<first-names> Viktor E. </first-names>
			</author>
			<author>
				<last-name> Feldmann </last-name>
				<first-names> Heinz </first-names>
			</author>
			<author>
				<last-name> Volchkove </last-name>
				<first-names> Valentina A. </first-names>
			</author>
			<other-authors> Klenk </other-authors>
			<title> Processing of the Ebola virus glycoprotein by the proprotein convertase furin </title>
			<journal-name> PNAS </journal-name>
			<year> 1998 </year>
			<volume> 95 </volume>
			<issue> 10 </issue>
			<pages>
				<first> 5762 </first>
				<last> 5767 </last>
			</pages>
		</journal>
		<journal refID="Formenty" refName="Formenty et al., 1999" PMID="9988175">
			<author>
				<last-name> Formenty </last-name>
				<first-names> Pierre </first-names>
			</author>
			<author>
				<last-name> Boesch </last-name>
				<first-names> Christophe </first-names>
			</author>
			<author>
				<last-name> Wyers </last-name>
				<first-names> Monique </first-names>
			</author>
			<other-authors> Steiner C, Donati F, Dind F, Walker F, Le Guenno B. </other-authors>
			<title> Ebola virus outbreak among wild chimpanzees living in a rain forest of Cote-d&apos;Ivoire </title>
			<journal-name> Journal of Infectious Diseases </journal-name>
			<year> 1999 </year>
			<volume> 179 </volume>
			<issue> Suppl 1 </issue>
			<pages>
				<first> S120 </first>
				<last> S126 </last>
			</pages>
		</journal>
		<journal refID="Georges" refName="Georges et al., 1999" PMID="9988167">
			<author>
				<last-name> Georges </last-name>
				<first-names> A.J. </first-names>
			</author>
			<author>
				<last-name> Leroy </last-name>
				<first-names> E.M. </first-names>
			</author>
			<author>
				<last-name> Renaut </last-name>
				<first-names> A.A. </first-names>
			</author>
			<other-authors> Benissan CT, Nabias RJ, Ngoc MT, Obiang PI, Lepage JP, Bertherat EJ, Benoni DD, Wickings EJ, Amblard JP, Lansoud-Soukate JM, Milleliri JM, Baize S, Georges-Courbot MC. </other-authors>
			<title> Ebola hemorrhagic fever outbreaks in Gabon, 1994-1997: epidemiologic and health control issues </title>
			<journal-name> J Infect Dis </journal-name>
			<year> 1999 </year>
			<volume> 179 </volume>
			<issue> Suppl 1 </issue>
			<pages>
				<first> S65 </first>
				<last> S75 </last>
			</pages>
		</journal>
		<journal refID="Leroy" refName="Leroy et al., 2002" PMID="11752702">
			<author>
				<last-name> Leroy </last-name>
				<first-names> Eric M. </first-names>
			</author>
			<author>
				<last-name> Baize </last-name>
				<first-names> Sylvain </first-names>
			</author>
			<author>
				<last-name> Mavoungou </last-name>
				<first-names> Elie </first-names>
			</author>
			<other-authors> Apetrei </other-authors>
			<title> Sequence analysis of the GP, NP, VP40 and VP24 genes of Ebola virus isolated from deceased, surviving and asymptomatically infected individuals during the 1996 outbreak in Gabon: comparative studies and phylogenetic characterization </title>
			<journal-name> Journal of General Virology </journal-name>
			<year> 2002 </year>
			<volume> 83 </volume>
			<issue> Pt 1 </issue>
			<pages>
				<first> 67 </first>
				<last> 73 </last>
			</pages>
		</journal>
		<journal refID="Ellis" refName="Ellis et al., 1979" PMID="94087">
			<author>
				<last-name> Ellis </last-name>
				<first-names> D.S. </first-names>
			</author>
			<author>
				<last-name> Stamford </last-name>
				<first-names> S. </first-names>
			</author>
			<author>
				<last-name> Lloyd </last-name>
				<first-names> G. </first-names>
			</author>
			<other-authors> Bowen ET, Platt GS, Way H, Simpson DI. </other-authors>
			<title> Ebola and Marburg viruses: I. Some ultrastructural differences between strains when grown in Vero cells </title>
			<journal-name> J Med Virol </journal-name>
			<year> 1979 </year>
			<volume> 4 </volume>
			<issue> 3 </issue>
			<pages>
				<first> 201 </first>
				<last> 211 </last>
			</pages>
		</journal>
		<journal refID="Ksiazek" refName="Ksiazek et al., 1999" PMID="9988182">
			<author>
				<last-name> Ksiazek </last-name>
				<first-names> T.G. </first-names>
			</author>
			<author>
				<last-name> Rollin </last-name>
				<first-names> P.E. </first-names>
			</author>
			<author>
				<last-name> Williams </last-name>
				<first-names> A.J. </first-names>
			</author>
			<other-authors> Bressler DS, Martin ML, Swanepoel R, Burt FJ, Leman PA, Khan AS, Rowe AK, Mukunu R, Sanchez A, Peters CJ. </other-authors>
			<title> Clinical virology of Ebola hemorrhagic fever (EHF): virus, virus antigen, and IgG and IgM antibody findings among EHF patients in Kikwit, Democratic Republic of the Congo, 1995 </title>
			<journal-name>  J Infect Dis </journal-name>
			<year> 1999 </year>
			<volume> 179 </volume>
			<issue> Suppl 1 </issue>
			<pages>
				<first> S177 </first>
				<last> S187 </last>
			</pages>
		</journal>
		<journal refID="Volchkov2" refName="Volchkov et al., 1998" PMID="9614872">
			<author>
				<last-name> Volchkov </last-name>
				<first-names> Viktor E. </first-names>
			</author>
			<author>
				<last-name> Volchkov </last-name>
				<first-names> Valentina A. </first-names>
			</author>
			<author>
				<last-name> Slenczka </last-name>
				<first-names> Werner </first-names>
			</author>
			<other-authors> Klenk HD, Feldmann H. </other-authors>
			<title> Release of viral glycoproteins during Ebola virus infection </title>
			<journal-name> Virology </journal-name>
			<year> 1998 </year>
			<volume> 245 </volume>
			<issue> 1 </issue>
			<pages>
				<first> 110 </first>
				<last> 119 </last>
			</pages>
		</journal>
		<journal refID="Volchkov" refName="Volchkov et al., 1997" PMID="9185597">
			<author>
				<last-name> Volchkov </last-name>
				<first-names> V. </first-names>
			</author>
			<author>
				<last-name> Volchkov </last-name>
				<first-names> V. </first-names>
			</author>
			<author>
				<last-name> Eckel </last-name>
				<first-names> C. </first-names>
			</author>
			<other-authors> Klenk HD, Bouloy M, LeGuenno B, Feldmann H. </other-authors>
			<title> Emergence of subtype Zaire Ebola virus in Gabon </title>
			<journal-name> Virology </journal-name>
			<year> 1997 </year>
			<volume> 232 </volume>
			<issue> 1 </issue>
			<pages>
				<first> 139 </first>
				<last> 144 </last>
			</pages>
		</journal>
		<journal refID="Le_Guenno" refName="Le Guenno et al., 1995" PMID="7746057">
			<author>
				<last-name> Le Guenno </last-name>
				<first-names> B. </first-names>
			</author>
			<author>
				<last-name> Formentry </last-name>
				<first-names> P. </first-names>
			</author>
			<author>
				<last-name> Wyers </last-name>
				<first-names> M. </first-names>
			</author>
			<other-authors> Gounon P, Walker F, Boesch C. </other-authors>
			<title> Isolation and partial characterisation of a new strain of Ebola virus </title>
			<journal-name> Lancet </journal-name>
			<year> 1995 </year>
			<volume> 345 </volume>
			<issue> 8960 </issue>
			<pages>
				<first> 1271 </first>
				<last> 1274 </last>
			</pages>
		</journal>
		<journal refID="Nichol" refName="Nichol et al., 2000" PMID="11035785">
			<author>
				<last-name> Nichol </last-name>
				<first-names> Stuart T. </first-names>
			</author>
			<author>
				<last-name> Arikawa </last-name>
				<first-names> Jiro </first-names>
			</author>
			<author>
				<last-name> Kawaoka </last-name>
				<first-names> Yoshihiro </first-names>
			</author>
			<title> Emerging viral diseases </title>
			<journal-name> Proc Natl Acad Sci U S A </journal-name>
			<year> 2000 </year>
			<volume> 97 </volume>
			<issue> 23 </issue>
			<pages>
				<first> 12411 </first>
				<last> 12412 </last>
			</pages>
		</journal>
		<book refID="Sanchez2" refName="Sanchez et al., 2001" ISBN="0-7817-1832-5">
			<author>
				<last-name> Sanchez </last-name>
				<first-names> Anthony </first-names>
			</author>
			<author>
				<last-name> Khan </last-name>
				<first-names> Ali S. </first-names>
			</author>
			<author>
				<last-name> Zaki </last-name>
				<first-names> Sherif R. </first-names>
			</author>
			<author>
				<last-name> Nabel </last-name>
				<first-names> Gary J. </first-names>
			</author>
			<author>
				<last-name> Ksiazek </last-name>
				<first-names> Thomas G. </first-names>
			</author>
			<author>
				<last-name> Peters </last-name>
				<first-names> Clarence J. </first-names>
			</author>
			<article-title> Filorviridae&quot;  Marburg and Ebola Viruses </article-title>
			<book-editor>
				<last-name> Knipe </last-name>
				<first-names> David M. </first-names>
			</book-editor>
			<book-editor>
				<last-name> Howley </last-name>
				<first-names> Peter M. </first-names>
			</book-editor>
			<book-name> Field&apos;s Virology Fourth Edition Volume 1 </book-name>
			<year> 2001 </year>
			<pages>
				<first> 1279 </first>
				<last> 1304 </last>
			</pages>
			<publisher> Lippincott Williams and Wilkins </publisher>
			<publisher-location> Philadelphia Pa </publisher-location>
		</book>
		<book refID="Peters" refName="Peters et al., 1996" ISBN="0-7817-0253-4">
			<author>
				<last-name> Peters </last-name>
				<first-names> C.J. </first-names>
			</author>
			<author>
				<last-name> Sanchez </last-name>
				<first-names> Anthony </first-names>
			</author>
			<author>
				<last-name> Rollin </last-name>
				<first-names> Pierre E. </first-names>
			</author>
			<article-title> Filoviridae:  Marburg and Ebola Viruses </article-title>
			<book-editor>
				<last-name> Fields </last-name>
				<first-names> Bernard N. </first-names>
			</book-editor>
			<book-editor>
				<last-name> Knipe </last-name>
				<first-names> David M. </first-names>
			</book-editor>
			<book-editor>
				<last-name> Howley </last-name>
				<first-names> Peter M. </first-names>
			</book-editor>
			<book-name> Field&apos;s Virology Third Edition Volume 1 </book-name>
			<year> 1996 </year>
			<pages>
				<first> 1161 </first>
				<last> 1176 </last>
			</pages>
			<publisher> Lippincott-Raven Publishers </publisher>
			<publisher-location> Philadelphia PA </publisher-location>
		</book>
		<website refID="Bat" refName="Website 1">
			<URL> http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=9397&amp;lvl=3&amp;keep=1&amp;srchmode=1&amp;unlock  </URL>
			<title> Chiroptera </title>
		</website>
		<website refID="Hsapiens" refName="Website 2">
			<URL> http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Tree&amp;id=9606&amp;lvl=3&amp;keep=1&amp;srchmode=1&amp;unlock</URL>
			<title> Homo sapiens </title>
		</website>
		<website refID="NCBI" refName="Website 3">
			<URL> http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=11268&amp;lvl=3&amp;p=17&amp;p=20&amp;p=37&amp;p=38&amp;lin=f&amp;keep=1&amp;srchmode=1&amp;unlock</URL>
			<title> Ebola virus </title>
		</website>
		<website refID="Zaire" refName="Website 4">
			<URL> http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&amp;db=nucleotide&amp;list_uids=10313991&amp;dopt=GenBank  </URL>
			<title> Zaire Ebola virus, complete genome </title>
		</website>
		<website refID="ZaireA" refName="Website 5">
			<URL> http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=186538&amp;lvl=3&amp;keep=1&amp;srchmode=1&amp;unlock  </URL>
			<title> Zaire Ebola virus </title>
		</website>
		<website refID="ZaireB" refName="Website 6">
			<URL> http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=129000&amp;lvl=3&amp;keep=1&amp;srchmode=1&amp;unlock </URL>
			<title>Ebola virus strain Eckron-76  </title>
		</website>
		<website refID="ZaireC" refName="Website 7">
			<URL> http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=128947&amp;lvl=3&amp;keep=1&amp;srchmode=1&amp;unlock </URL>
			<title> Ebola virus strain Gabon-94 </title>
		</website>
		<website refID="ZaireD" refName="Website 8">
			<URL>http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=128952&amp;lvl=3&amp;keep=1&amp;srchmode=1&amp;unlock  </URL>
			<title> Ebola virus strain Zaire Mayinga </title>
		</website>
		<website refID="ZaireE" refName="Website 9">
			<URL>http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=128951&amp;lvl=3&amp;keep=1&amp;srchmode=1&amp;unlock  </URL>
			<title> Ebola virus strain Zaire-95 </title>
		</website>
		<website refID="SudanA" refName="Website 10">
			<URL> http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=186540&amp;lvl=3&amp;keep=1&amp;srchmode=1&amp;unlock </URL>
			<title> Sudan Ebola virus </title>
		</website>
		<website refID="SudanB" refName="Website 11">
			<URL> http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=128948&amp;lvl=3&amp;keep=1&amp;srchmode=1&amp;unlock </URL>
			<title>Ebola virus strain Sudan Boniface </title>
		</website>
		<website refID="SudanC" refName="Website 12">
			<URL> http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=128949&amp;lvl=3&amp;keep=1&amp;srchmode=1&amp;unlock</URL>
			<title> Ebola virus strain Sudan Maleo-79 </title>
		</website>
		<website refID="RestonA" refName="Website 13">
			<URL> http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=186539&amp;lvl=3&amp;keep=1&amp;srchmode=1&amp;unlock  </URL>
			<title> Reston Ebola virus </title>
		</website>
		<website refID="RestonB" refName="Website 14">
			<URL> http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=129004&amp;lvl=3&amp;keep=1&amp;srchmode=1&amp;unlock  </URL>
			<title> Ebola virus strain Reston Siena/Philippine-92 </title>
		</website>
		<website refID="IvoryCoastA" refName="Website 15">
			<URL> http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=186541&amp;lvl=3&amp;keep=1&amp;srchmode=1&amp;unlock  </URL>
			<title> Cote d&apos;Ivoire Ebola virus </title>
		</website>
		<website refID="IvoryCoastB" refName="Website 16">
			<URL> http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=128999&amp;lvl=3&amp;keep=1&amp;srchmode=1&amp;unlock  </URL>
			<title> Ebola virus strain Ivory coast-94 </title>
		</website>
		<website refID="Taxonomy" refName="Website 17">
			<URL> http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&amp;id=186536&amp;lvl=3&amp;keep=1&amp;srchmode=1&amp;unlock  </URL>
			<title> Ebola-like viruses </title>
		</website>
		<website refID="ZGenomeA" refName="Website 18">
			<URL> http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&amp;db=nucleotide&amp;list_uids=23630482&amp;dopt=GenBank  </URL>
			<title> Zaire Ebola virus strain Mayinga subtype Zaire, complete genome </title>
		</website>
		<website refID="ZGenomeB" refName="Website 19">
			<URL> http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&amp;db=nucleotide&amp;list_uids=21702647&amp;dopt=GenBank  </URL>
			<title> Zaire Ebola virus strain Mayinga, complete genome </title>
		</website>
		<website refID="ZGenomeC" refName="Website 20">
			<URL> http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&amp;db=nucleotide&amp;list_uids=10313991&amp;dopt=GenBank  </URL>
			<title> Zaire Ebola virus, complete genome </title>
		</website>
		<website refID="ZGenomeD" refName="Website 21">
			<URL> http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&amp;db=nucleotide&amp;list_uids=10141003&amp;dopt=GenBank  </URL>
			<title> Zaire Ebola virus strain Mayinga, complete genome </title>
		</website>
		<website refID="RGenomeA" refName="Website 22">
			<URL> http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&amp;db=nucleotide&amp;list_uids=15823608&amp;dopt=GenBank  </URL>
			<title> Reston Ebola virus genomic RNA, complete genome </title>
		</website>
		<website refID="RGenomeB" refName="Website 23">
			<URL> http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&amp;db=nucleotide&amp;list_uids=22671623&amp;dopt=GenBank  </URL>
			<title> Reston Ebola virus strain Pennsylvania, complete genome </title>
		</website>
		<website refID="RGenomeC" refName="Website 24">
			<URL> http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&amp;db=nucleotide&amp;list_uids=22789222&amp;dopt=GenBank  </URL>
			<title> Reston Ebola virus, complete genome </title>
		</website>
		<website refID="CDC" refName="Website 25">
			<URL> http://www.cdc.gov/ncidod/dvrd/spb/mnpages/dispages/ebotabl.htm  </URL>
			<title> Ebola Hemorrhagic Fever.  Table Showing Known Cases and Outbreaks, in Chronological Order
 </title>
		</website>
		<website refID="Primate" refName="Website 26">
			<URL> http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=9443&amp;lvl=3&amp;keep=1&amp;srchmode=1&amp;unlock  </URL>
			<title> Primates </title>
		</website>
		<website refID="CDC-Ebola" refName="Website 27">
			<URL> http://www.cdc.gov/ncidod/dvrd/spb/mnpages/dispages/ebola.htm  </URL>
			<title> Ebola Hemorrhagic Fever </title>
		</website>
		<website refID="Jahrling" refName="Website 28">
			<URL> http://www.vnh.org/MedAspChemBioWar/chapters/chapter_29.htm  </URL>
			<author>
				<last-name> Jahrling </last-name>
				<first-names> Peter B. </first-names>
			</author>
			<title> Viral Hemorrhagic Fevers </title>
		</website>
		<website refID="King" refName="Website 29">
			<URL> http://www.emedicine.com/MED/topic626.htm  </URL>
			<author>
				<last-name> King </last-name>
				<first-names> John W. </first-names>
			</author>
			<author>
				<last-name> Markanday </last-name>
				<first-names> Anurag </first-names>
			</author>
			<title> Ebola virus </title>
		</website>
		<website refID="website30" refName="Website 30">
			<URL>http://www.vetmed.ucdavis.edu/viruses/download.html</URL>
			<title>UCDavis School Of Veterinary Medicine Virus Images</title>
		</website>
	</references>
	<curation-info>
		<curator curatorID="Wattam">
			<last-name>Wattam</last-name>
			<first-names>Rebecca</first-names>
			<contact-info>
				<email>wattam@vbi.vt.edu</email>
			</contact-info>
		</curator>
		<date>05/11/2004</date>
		<version>1.0</version>
		<contact-info>
			<email>pathinfo@vbi.vt.edu</email>
		</contact-info>
	</curation-info>
</pathinfo>
