Detection of antibodies to alphaviruses and discrimination between antibodies to eastern and western equine encephalitis viruses in rabbit sera using a recombinant antigen and virus-specific monoclonal antibodies.

EEE

Eastern Equine Encephalitis virus

EEE is a member of the Alphavirus genus, family Togaviridae. It is related to but antigenically distinct from a sympatric member of the western equine encephalomyelitis (WEE) virus complex, Highlands J (HJ) virus. Epidemiologically, EEE has many similarities to WEE in that both viruses cause encephalitis in horses and man, have wild avian hosts, and are transmitted from birds to mammals by mosquitoes. EEE and HJ virus are most closely related epidemiologically in that they share geographic distributions, are transmitted by the mosquito Cs. melanura, and infect a wide spectrum of wild avians, especially passerines.

Venezuelan equine encephalitis, eastern equine encephalitis, and western equine encephalitis are all members of the Alphavirus genus of the family Togaviridae. As with all the alphavirus group, VEE, EEE, and WEE are transmitted in nature by mosquitoes and are maintained in cycles with various vertebrate hosts. Thus, the natural epidemiology of these viruses is controlled by environmental factors that affect the relevant mosquito and reservoir host populations and their interactions. Of the 28 viruses currently classified within this group, VEE, EEE, and WEE are the only viruses regularly associated with encephalitis. Although these encephalitic strains are restricted to the Americas, as a group, alphaviruses have worldwide distribution and include other epidemic human pathogens such as chikungunya virus (Asia and Africa), Mayaro virus (South America), O'nyong-nyong virus (Africa), Ross River virus (Australia), and Sindbis virus (Africa, Europe, and Asia). These viruses cause an acute febrile syndrome often associated with debilitating polyarthritic syndromes.

Eastern equine encephalitis virus (EEEV), the sole species in the EEE antigenic complex, is divided into North and South American antigenic varieties based on hemagglutination inhibition tests. All North American isolates comprised a single, highly conserved lineage with strains grouped by the time of isolation and to some extent by location. An EEEV strain isolated during a 1996 equine outbreak in Tamaulipas State, Mexico was closely related to recent Texas isolates, suggesting southward EEEV transportation beyond the presumed enzootic range.

The North American subtype of this virus includes all isolates from all hosts from the area between Massachusetts and the Caribbean (Morris, 1988).

Nucleotide sequencing and phylogenetic analyses revealed additional genetic diversity within the South American variety; 3 major South/Central American lineages were identified including one represented by a single isolate from eastern Brazil, and 2 lineages with more widespread distributions in Central and South America (Brault et al., 1999).

The South American subtype of this virus includes all isolates from all hosts in the South American Continent.

The alphavirus virion is approximately 60 to 65 nm in diameter.

The alphavirus virion, a spherical particle approximately 60 to 65 nm in diameter is typically composed of three different structural proteins enclosing a single molecule of single-stranded RNA.

Eastern equine encephalitis (EEE) is a single-stranded RNA positive strand virus and a member of the Alphavirus genus and the family Togaviridae. It has no DNA stage.

11675 bp

7 genes

The viral genome is a positive-stranded RNA of approximately 11,700 nucleotides and has the structural features of messenger RNA (ie, mRNA, a 5 ' methylated cap [m7GpppA] and a poly-A tract at the 3 ' end). As a complete and functional mRNA, genomic RNA purified from virions is fully infectious when artificially introduced (ie, transfected) into susceptible cells. Similarly, RNA transcribed from a full-length complementary DNA (cDNA) clone of an alphavirus is also infectious, and it is this property that allows genetic manipulation of these viruses. Mutations introduced into a cDNA clone by site-directed mutagenesis will be reflected in the RNA transcribed from the altered clone and in the virus obtained from transfected cells. These procedures are being utilized to develop improved vaccines, but conceivably could be used also to enhance specific characteristics required for weaponization.

The 5' two-thirds of the genome encodes four nonstructural proteins (nsP1 to 4) that are involved in viral replication. After virus entry into the cytoplasm of cells, a nonstructural polyprotein is translated and utilized in the production of full-length negative-sense RNA. The negative-sense RNA is used for the generation of genomic RNA as well as a subgenomic mRNA (26S) that is homologous to the 3' one-third of the genome. The subgenomic RNA is translated directly into a structural polyprotein that is proteolytically cleaved into the capsid, E2, and E1 envelope glycoproteins.

Outbreaks of EEE virus have occurred in most eastern states and in southeastern Canada but have been concentrated along the eastern and Gulf coasts.

Birds

Mosquitoes

The ability of alphaviruses to infect mosquitoes efficiently with spread to and replication in the salivary glands is essential for maintaining the natural cycle of transmission. Not all mosquitoes taking a blood meal from a viremic host will become infected, and not all infected mosquitoes develop salivary gland infection and the ability to transmit the virus.

The initial isolation of EEE virus from a bird and from Culiseta melanura mosquitoes, the two major components of the EEE natural cycle, were both reported in 1951.

Mosquito

Birds

Bird

The primary mode of alphavirus transmission to vertebrates is through the bite of an infected mosquito. Mosquitoes salivate during feeding and deposit virus-infected saliva extravascularly. Saliva virus titers are highest early after the mosquito is infected, but decline, along with transmission rates, after 1 to 2 weeks, but mosquitoes remain infected for life.

The mosquito injects the agent of EEE into the subcutaneous and cutaneous tissues of the host.

Mosquitoes

Human

The mosquito injects the agent of EEE into the subcutaneous and cutaneous tissues of the host.

Human

Mosquitoes

The mosquito injects the agent of EEE into the subcutaneous and cutaneous tissues of the host.

Human

EEE is not transmitted by the aerosol route. It may cross the placenta and infect the fetus. Because of low viral titers in the donor's blood, EEE is unlikely to be transmitted by transfusion.

Mosquitoes

Horse

The mosquito injects the agent of EEE into the subcutaneous and cutaneous tissues of the host.

Horse

Mosquitoes

The mosquito injects the agent of EEE into the subcutaneous and cutaneous tissues of the host.

Birds are the primary reservoir hosts, and many species are susceptible to infection, but often remain asymptomatic despite prolong viremia. The amplifying species for EEEV in North America are wading birds, migratory passerine birds, and starlings. Young birds in general are probably important for virus amplification because they are more susceptible to infection, have a prolonged viremia, and are less defensive towards mosquitoes.

In Central and South America, forest-dwelling rodents, bats, and marsuipials are frequently infected and may provide an additional reservoir, but these transmission cycles are not well characterized.

Although other encephalitic viruses could be considered as potential weapons (eg, the tick-borne encephalitis viruses), few possess as many of the required characteristics for strategic or tactical weapons development as the alphaviruses: These viruses can be produced in large amounts in inexpensive and unsophisticated systems; They are relatively stable and highly infectious for humans as aerosols; Strains are available that produce either incapacitating or lethal infections; and the existence of multiple serotypes of VEE and EEE viruses, as well as the inherent difficulties of inducing efficient mucosal immunity, confound defensive vaccine development.

The equine encephalomyelitis viruses remain as highly credible threats today, and intentional release as a small-particle aerosol, from a single airplane, could be expected to infect a high percentage of individuals within an area of at least 10,000 km2. As a further complication, these viruses are readily amenable to genetic manipulation by modern recombinant deoxyribonucleic acid (DNA) technology. This capability is being used to develop safer and more effective vaccines, but in theory, could also be used to increase the weaponization potential of these viruses.

At the national level, the division of Vector-borne Infectious Diseases (DVBID), Centers for Disease Control and Prevention (CDC) collects information from the states on arboviral encephalitis. Although state and federal laws do not require physicians or hospitals to report human cases, there has been good cooperation between local, state, and federal agencies in reporting cases of arboviral encephalities. Standardized report forms and electronic reporting systems are used by state epidemiologists to report cases of arboviral encephalitis. Although routine reporting of human cases of encephalitis was discontinued in 1983, many states still report cases and other relevant data on an informal basis.

Vaccination of horses is not a useful public health tool for EEE, WEE, or enzootic VEE, however, since horses are not important as amplifying hosts for these diseases. Investigational formalin-inactivated vaccines for humans are available for WEE and EEE, but they require multiple injections and are poorly immunogenic. Insecticide measures of vector control may also have an impact on ameliorating epidemic transmission.

Human

Homo sapiens

People at greatest risk to EEE are children under 15 and adults over 55. Those age groups make up 70 to 90% of the cases in a given outbreak. Both sexes are equally affected, although typically there are more males than females. Unapparent infections are the same for all age groups and for both sexes. The disease is rural in distribution and most cases are associated with wooded areas adjacent to swamps and marshes.

During vector-borne EEE epidemics, the incidence of human infection is low with less than 3% of the population at risk and the neurological attack rate in one outbreak was estimated as 1 in every 23 cases of human infection.

Unknown

Bite of infected mosquito

Vaccine (Inactivated PE-6). The PE-6 strain of EEE virus was passed in primary chick-embryo cell cultures, and then was formalin-treated and lyophilized to produce an inactivated vaccine for EEE.174 This vaccine is administered as a 0.5-mL dose subcutaneously on days 0 and 28, with 0.1-mL intradermal booster doses given as needed to maintain neutralizing antibody titers.

58%. A long-term follow-up study of 573 recipients indicated a 58% response rate after the primary series, and a 25% chance of failing to maintain adequate titers for 1 year. Response rates and persistence of titers increased with the administration of additional booster doses.

75% of those inoculated maintained adequate titers for one year.

Mild reactions to the vaccine were observed, and immunogenicity was demonstrated in initial clinical trials.

Limit exposure to mosquitoes. Warn individuals who live in high-risk areas to take the necessary precautions. This includes wearing appropriate clothing (eg, long pants, long-sleeved shirts), wearing mosquito repellant, avoiding areas with high mosquito activity, and avoiding outside activity during times of day when mosquitoes are active. Mosquito netting at nighttime also can be used if appropriate.

Environmental animal control. The potential exists for monitoring the sources of infection by assessing serology of antibodies to EEE in certain wild birds or caged flocks of sentinel birds (eg, chickens). The virus also may be recovered from adult mosquitoes and may provide an opportunity for screening in possible vector habitats. Officials should control the vector mosquito population in areas where the virus has been isolated or where a high risk of infection exists.

Ground and aerial applications of insecticides are used to control populations of adult mosquitoes, which spread such diseases as West Nile virus and related illness, eastern equine encephalitis, and dengue fever.

When insecticides are used, public health agencies should inform the public when and where spraying will occur and communicate how to reduce the likelihood of exposure. To avoid direct exposure from passing spray trucks, public health agencies should ensure that visible and audible warnings are made before spraying. Persons with exposure-related health concerns should consult their health-care providers. To prevent exposures from improper application methods, insecticide handlers and applicators should be trained in proper insecticide handling and application methods and in the use of appropriate personal protective equipment.

Of the 133 reported cases of pesticide-related illness, 95 (71.4%) cases were associated with organophosphates, primarily malathion. Malathion alone was associated with 64 (67.4%) of the 95 cases; 37 (27.8%) cases were associated with pyrethoids, primarily sumithrin (24 cases) and resmethrin (10 cases). Illness severity was categorized for all cases. One exposure was associated with illness of high severity. When her neighborhood was sprayed, a woman aged 54 years was exposed to sumithrin, which passed through operating window fans and a window air conditioner. She had exacerbation of her asthma and chronic obstructive pulmonary disease. The majority of the remaining cases were of low (65.4%) or moderate (33.8%) severity. The majority of cases were associated either with respiratory (66.2%) or neurologic (60.9%) dysfunction. Other systems affected were gastrointestinal (45.1%), ocular (36.1%), dermal (27.1%), cardiovascular (12.0%), renal-genitourinary (3.0%), and miscellaneous (28.6%).

In humans viremia occurs soon after infection and may be accompanied by a febrile prodrome. In a relatively high proportion (estimated in one study as one in 23), virus gains access to the nervous system and results in severe encephalitis. Viremia is usually undetectable and HI or neutralizing antibody is present in samples taken during the first 3 to 5 days of encephalitis. Despite this evidence of an effective humoral immune response, virus is not eradicated from the brain and neuronal destruction continues through direct CPE, inflammatory damage, and vasculitis.

The primary pathological features of EEE are confined to the CNS. Lesions are scattered throughout the cortex, hippocampus, and pons and are particularly severe in basal ganglia and thalamus; cerebellum and spinal cord are minimally involved. There is extensive neuronal necrosis as well as thrombosis of arterioles and venules. Inflammatory cells are widespread in lesions, perivascular areas, and meninges. The cells are predominantly polymorphonuclear in the first week, but later mononuclear cells may predominate.

The incubation period in humans varies from 5 to 15 days.

The prognosis for the infected patient is extremely poor; 50-70% of patients die. The morbidity rate is approximately 90%, representing a wide range of mild to severe impairment. Only 10% of patients fully recover. The average duration of hospitalization is 16-20 days. Most patients die within a few days.

Children younger than 10 years of age are most susceptible, with one of eight infections in children resulting in encephalitis compared to one encephalitis case in 23 infections in adults. The case fatality rate was 60% to 70% in earlier studies and 30% to 40% in more recent studies, with the highest rates in children and the elderly.

Neurologic symptoms/CNS Impairment

During vector-borne EEE epidemics, the incidence of human infection is low (less than 3% of the population at risk), and the neurological attack rate in one outbreak was estimated as 1 in every 23 cases of human infection.

Headache. Headaches are the most prevalent symptom.

Headaches of 75% prevalence have been reported.

Nausea or vomiting. The illness is characterized by rapid onset of high fever, vomiting, stiff neck, and drowsiness.

Present in both prodromal and active stages of the infection.

61% prevalence of vomiting and nausea in EEE cases has been reported.

Confusion

40% prevalence of confusion has been reported.

Seizures

Approximately 50%.

Up to 30% of survivors are left with neurological sequelae such as seizures, spastic paralysis, and cranial neuropathies.

Somnolence

Neck stiffness. The illness is characterized by rapid onset of high fever, vomiting, stiff neck, and drowsiness.

36% of patients report neck stiffness.

Malaise and weakness

58% malaise and weakness have been reported.

Cranial nerve palsies, with cranial nerves VI, VII, and occasionally XII being the most commonly affected.

Up to 30% of survivors are left with neurological sequelae such as seizures, spastic paralysis, and cranial neuropathies.

Photophobia

Autonomic disturbances

Fever

The illness is characterized by rapid onset of high fever, vomiting, stiff neck, and drowsiness.

Adults typically exhibit a febrile prodrome for up to 11 days before the onset of neurological disease; however, illness in children exhibits a more sudden onset. Viremia occurs during the febrile prodrome, but is usually undetectable by the time clinical encephalitis develops, when HI and neutralizing antibodies become evident.

83% prevalence of fever has been reported.

Chills

25% of patients report chills.

Abdominal pain

Sore throat

Arthralgia or myalgia

38% of patients report myalgia or arthralgia.

Respiratory difficulty

Mental retardation

Paralysis

Up to 30% of survivors are left with neurological sequelae such as seizures, spastic paralysis, and cranial neuropathies.

Behavioral changes

Permanent focal neurologic deficits

Up to 30% of survivors are left with neurological sequelae such as seizures, spastic paralysis, and cranial neuropathies.

Seizure disorders

Up to 30% of survivors are left with neurological sequelae such as seizures, spastic paralysis, and cranial neuropathies.

Seizures have been in 25% of patients.

Anticonvulsants like dilantin/phenytoin.

May act in motor cortex where may inhibit spread of seizure activity. Activity of brain stem centers responsible for tonic phase of grand mal seizures also may be inhibited.

Persons with the following conditions should not use this drug. These include delayed hypersensitivity, sinoatrial block, second- and third-degree AV block, sinus bradycardia, Adams-Stokes syndrome, and pregnancy.

Complications may include: blood dyscrasia; exfoliative, bulbous, or purpuric skin rash; death from cardiac arrest marked by QRS widening following a rapid IV infusion; elevation of blood sugar in diabetics or in acute intermittent porphyria; hepatic dysfunction; sedation; and hypotension.

Corticosteroids like dexamethasone (Decadron, AK-Dex, Alba-Dex) can be used by both adults and children.

Dexamethasone (Decadron, AK-Dex, Alba-Dex) decreases inflammation by suppressing migration of polymorphonuclear leukocytes and reducing capillary permeability. Usually administered by IV for various allergic and inflammatory diseases.

Safety in pregnancy has not been established. Do not use this drug if you have any of the following conditions: documented hypersensitivity; an active bacterial infection; an active fungal infection; or an active tubercular skin infection.

Use of this drug may result in the following complications: an increased risk of severe infections; adrenal crisis following an abrupt discontinuation of glucocorticoids; hyperglycemia; edema; osteonecrosis; myopathy; peptic ulcer disease; hypokalemia; osteoporosis; euphoria; psychosis; myasthemia gravis; growth suppression; and infections.

Mus musculus

Newborn mice show extensive neuronal damage and rapid death. At age 3 to 4 weeks, mice become relatively reisistant to peripherla, but not intracerebral inoculation of the virus.

Rhesus monkey

Laboratory studies of monkeys, mice, guinea pigs, and hamsters confirm the neurovirulence of EEEV for mammals.

Guinea pig

Laboratory studies of monkeys, mice, guinea pigs, and hamsters confirm the neurovirulence of EEEV for mammals.

Hamster

Laboratory studies of monkeys, mice, guinea pigs, and hamsters confirm the neurovirulence of EEEV for mammals. Hamsters develop encephalitis, hepatitis, and lymphatic organ infection.

Mosquito

Culiseta

Enzootic transmission of EEE virus occurs almost exclusively between passerine birds (ie, the perching songbirds) and the mosquito Culiseta melanura.

EEEV isolations have been reported in the literature from 23 species in six genera, and more than 80% of these have been from Culiseta melanura.

Culiseta melanura is the primary enzootic vector for EEEV in North America.

Mosquitoes

Culicidae

Enzootic transmission of EEE virus occurs almost exclusively between passerine birds (ie, the perching songbirds) and the mosquito Culiseta melanura. Because of the strict ornithophilic feeding behavior of this mosquito, human and equine disease requires the involvement of more general feeders, known as bridging vectors, such as members of the genera Aedes and Coquillettidia. Mosquito vectors belonging to Culex species are thought to play a role in maintaining and transmitting South American EEE strains.

EEEV isolations have been reported in the literature from 23 species of mosquitoes in six genera.

Birds

Aves

Birds are the primary reservoir host, and many species are susceptible to infection, but often remain asymptomatic despite prolonged viremia. The amplifying species for EEEV in North America are wading birds, migratory passerine songbirds, and starlings. Young birds in general are probably important for virus amplification because they are more susceptible to infection, have a prolonged viremia, and are less defensive towards mosquitoes.

Clinical signs of EEEV infection in domestic fowl (pheasants, chickens, chukars, ducks, turkeys) and wild birds have been described in detail (Morris, 1988). EEEV infection in wild birds may result in disease in introduced species such as the English sparrow, ring-necked pheasant, and domestic pigeons. Die-offs of native birds, especially small species, have been noted during EEV epizootics, but the causes of death was not conclusively identified as EEEV.

Domestic horse

Equus caballus

The pattern of EEE infection of horses is similar to that of humans. There is viremia for 1 to 3 days, asymptomatic or associated with fever. Viremia ceases, and serum-neutralizing antibody appears. In some horses there then ensues a severe and usually fatal febrile encephalitis. The necrotizing pathological pattern seen in humans also occurs in equines, but the prominent polymorphonuclear response is only observed in animals dying in the first 2 days of illness.

Bats

Chiroptera

In Central and South America, forest-dwelling rodents, bats, and marsupials are frequently infected and may provide an additional reservoir, but these transmission cycles are not well characterized.

Rodents

Rodentia

In Central and South America, forest-dwelling rodents, bats, and marsupials are frequently infected and may provide an additional reservoir, but these transmission cycles are not well characterized.

Marsupials

Metatheria

In Central and South America, forest-dwelling rodents, bats, and marsupials are frequently infected and may provide an additional reservoir, but these transmission cycles are not well characterized.

Level 2 for diagnostic, level 3 for propagation and animal work.

Biosafety Level 2 is similar to Biosafety Level 1 and is suitable for work involving agents of moderate potential hazard to personnel and the environment. It differs from BSL-1 in that (1) laboratory personnel have specific training in handling pathogenic agents and are directed by competent scientists; (2) access to the laboratory is limited when work is being conducted; (3) extreme precautions are taken with contaminated sharp items; and (4) certain procedures in which infectious aerosols or splashes may be created are conducted in biological safety cabinets or other physical containment equipment.

Biosafety Level 3 is applicable to clinical, diagnostic, teaching, research, or production facilities in which work is done with indigenous or exotic agents which may cause serious or potentially lethal disease as a result of exposure by the inhalation route. Laboratory personnel have specific training in handling pathogenic and potentially lethal agents, and are supervised by competent scientists who are experienced in working with these agents. All procedures involving the manipulation of infectious materials are conducted within biological safety cabinets or other physical containment devices, or by personnel wearing appropriate personal protective clothing and equipment. The laboratory has special engineering and design features. It is recognized, however, that some existing facilities may not have all the facility features recommended for Biosafety Level 3 (i.e., double-door access zone and sealed penetrations). In this circumstance, an acceptable level of safety for the conduct of routine procedures, (e.g., diagnostic procedures involving the propagation of an agent for identification, typing, susceptibility testing, etc.), may be achieved in a Biosafety Level 2 facility, providing 1) the exhaust air from the laboratory room is discharged to the outdoors, 2) the ventilation to the laboratory is balanced to provide directional airflow into the room, 3) access to the laboratory is restricted when work is in progress, and 4) the recommended Standard Microbiological Practices, Special Practices, and Safety Equipment for Biosafety Level 3 are rigorously followed. The decision to implement this modification of Biosafety Level 3 recommendations should be made only by the laboratory director.

Previously, the recovery of EEE was limited because only a few facilities had the resources to amplify the virus. Recent studies indicate excellent growth of the virus recovered from patient CSF in A549 and MRC-5 cell cultures, which are mediums that virology labs routinely use to recover adenovirus, herpes simplex virus (HSV), and enterovirus.

Virus can be isolated from CSF, blood, or CNS tissue by inoculation into newborn mice or onto a variety of tissue-culture cells, most commonly CSF or Vero cells.

Enveloped Toga virus particles were demonstrated by means of an electron microscopy in the brain tissues of a 3-year-old girl with acute encephalitis. Areas of demyelinization and necrosis throughout the white matter and brainstem were revealed by light microscopy. These viral particles were identified as eastern equine encephalomyelitis virus in postmortem isolation of the virus utilizing young mice and complement-fixation studies. To the authors' knowledge, this is the first demonstration of eastern equine encephalomyelitis virus particles in human tissues by electron microscopy.

Tissues were tested for virus by intracerebral inoculation of suckling mice and by examination of frozen sections and impression smears by the indirect fluorescent antibody (FA) technique. The FA technique appears useful for the rapid diagnosis of fatal eastern equine encephalomyelitis and may be applicable in laboratories not equipped for isolation of viruses.

Isolation of alphaviruses from vertebrate sera during acute disease or from postmortem brain samples, as well as isolation from invertebrate hosts, has been accomplished most often by intracerebral inoculation of neonatal mice, an animal model that is extremely susceptible to most, if not all, alphaviruses. Because alphaviruses produce an extensive cytopathic effect in almost all common vertebrate cell cultures examined, this also is an effective means of isolation.

Biochemical assays are valuable for EEE diagnosis. With early suspicion, obtain sera at 2- to 3-day intervals. A potential drawback is the inability to rapidly receive these test results.

Hemagglutination inhibition, although cross-reactive throughout the alphavirus genus, nonetheless retains sufficient specificity to define six antigen complexes or serotypes, which include the antigenic complexes of Western equine encephalitis, Venezuelan equine enchephalitis, Eastern equine encephalitis, Semilik forest, Middleburg, Nduma, and Barmah Forest.

Identification of a specific virus or subtype usually requires neutralization tests or modified hemagglutination tests. The kinetic hemagglutination inhibition test, for example, is extremely useful in differentiating subtypes of Venezuelan equine encephalitis virus as well as geographic varieties of eastern equine encephalitis and Ross river virus.

IgM capture ELISA is usually sufficiently specific and gives a rapid inexpensive assessment of recent infection using a single early convalescent serum sample.

Surveillance of mosquito populations for virus activity is not often performed by small, vector-control districts because they do not have the financial resources to use virus isolation, or newer methods such as the polymerase chain reaction. Consequently, development and refinements of rapid, sensitive, and simple enzyme-linked immunosorbent assays (ELISAs) applicable to a wide variety of public health settings are justified. We have developed an antigen-capture ELISA for the detection of eastern equine encephalitis (EEE) virus in mosquitoes that uses both monoclonal capture and detector antibodies. The sensitivity of this assay is 4.0-5.0 log10 plaque-forming units/ml, which is comparable to previously published EEE antigen-capture assays developed with polyclonal antibody reagents. This test identifies only North American strains of EEE virus and does not react with either western equine encephalitis or Highlands J viruses. Test sensitivity was enhanced by sonicating mosquito pools, treating them with Triton X-100, and increasing the time and temperature of antigen incubation. The conversion of this ELISA to a monoclonal antibody-based format should result in a readily standardizable and transferable assay that will permit laboratories lacking virus isolation facilities to conduct EEE virus surveillance.

Biochemical assays are valuable for EEE diagnosis. With early suspicion, obtain sera at 2- to 3-day intervals. A potential drawback is the inability to rapidly receive these test results (Website 16). Enzyme-linked immunosorbent assay (ELISA) detects IgM, primarily during convalescent stages or prolonged courses. ELISA may detect antiarboviral immunoglobulin G (IgG), which has similar results to the neutralization assay, used primarily as an adjunct to the IgM ELISA. IgM antibodies can be detected 0-3 days after onset of clinical symptoms and usually decline to undetectable levels within four months of onset. Measurement of IgM in CSF is test of choice when CNS disease is suspected. It has very good sensitivity.

Identification of a specific virus or subtype usually requires neutralization tests or modified hemagglutination tests. The neutralization test has continued to provide the highest specificity for the infecting virus species.

Antibody to EEE is usually measured by enzyme immunoassay (EIA) with detection of IgM in serum and CSF particularly useful.

An epitope blocking assay using an EEEV glycoprotein E1-expressing recombinant Sindbis virus and virus-specific monoclonal antibodies (mAbs) binding to the E1 of EEEV (strain NJ/60) and the E1 of Sindbis virus was established using automated flow cytometry. The test was evaluated using sera of infected and vaccinated rabbits. A cut-off value of 30% inhibition for antigenic complex-specific seroconversion was found to be sufficient for the detection of the respective infection. By using three different mAbs in parallel, we were able to detect alphavirus genus-, EEEV- and WEEV-complex-specific serum antibodies. As this test is based on the inhibition of binding of virus-specific mAbs, sera of every origin other than mouse can be tested. Thus, this assay may prove useful in the serological screening of a variety of animal species during an outbreak investigation.

Using homogenized bird brains as template, the EEE primers were able to detect EEE in RNA dilutions as high as 10(-8).

Homogenates of 100 mosquitoes were used, and EEE could be detected by RT-PCR at 100-fold dilution in tissue culture. Viral EEE could be detected at 1000-fold dilution using this method.

The EEE-specific assay described here was able to amplify the RNA of two EEE isolates from Brazil. This is in contrast to the EEE-specific assay described by Armstrong and coworkers, which failed to detect the RNA of EEE strains from Panama and Brazil. Optimal results were obtained with 0.1 uM concentrations each of primers EEE-4 (CTAGTTGAGCACAAACACCGCA) and cEEE-7 (CACTTGCAAGGTGTCGTCTGCCCTC), which were derived from the E2 gene.

CTAGTTGAGCACAAACACCGCA CACTTGCAAGGTGTCGTCTGCCCTC

Nucleic acid sequence-based amplification (NASBA), standard reverse transcription PCR (RT-PCR), and TaqMan nucleic acid amplification assays for the rapid detection of North American eastern equine encephalitis (EEE) and western equine encephalitis (WEE) viral RNAs from samples collected in the field and clinical samples was developed. The sensitivities of these assays have been compared to that of virus isolation. While all three types of nucleic acid amplification assays provide rapid detection of viral RNAs comparable to the isolation of viruses in Vero cells, the TaqMan assays for North American EEE and WEE viral RNAs are the most sensitive. We have shown these assays to be specific for North American EEE and WEE viral RNAs by testing geographically and temporally distinct strains of EEE and WEE viruses along with a battery of related and unrelated arthropodborne viruses. In addition, all three types of nucleic acid amplification assays have been used to detect North American EEE and WEE viral RNAs from mosquito and vertebrate tissue samples. The sensitivity, specificity, and rapidity of nucleic acid amplification demonstrate the usefulness of NASBA, standard RT-PCR, and TaqMan assays, in both research and diagnostic settings, to detect North American EEE and WEE viral RNAs.

EEE 9597 gatgcaaggtcgcatatgagCACATGGATGGCCGCACGAA EEE 9804 aattctaatacgactcactatagggagaaggCAGCAAAGTAACGCCAGGAGTA EEE 5640 CGGCAGCGGAATTTGACGAG EEE 6072 ACTTTGACGGCCACTTCTGCTGATGA EEE 9391 ACACCGCACCCTGATTTTACA EEE 9459 CTTCCAAGTGACCTGGTCGTC

To evaluate the specificities of the North American EEE virus NASBA, standard RT-PCR, and TaqMan assays, 14 isolates of EEE virus including representatives of both North American and South American antigenic groups were tested. We also tested related alphaviruses (Highlands J, Venezuelan equine encephalitis [VEE], and WEE viruses) and unrelated arboviruses that circulate throughout the Americas (La Crosse, dengue 2, Powassan, and yellow fever viruses). The NASBA, standard RT-PCR, and TaqMan assays detected all of the North American EEE virus isolates tested. These assays were specific for North American EEE virus and did not detect South American EEE virus, related alphaviral, or unrelated arboviral RNAs (with the exception of the NASBA assay detection of one South American EEE virus strain, Ecuador 1974).

Passler

Pfeffer

Detection of antibodies to alphaviruses and discrimination between antibodies to eastern and western equine encephalitis viruses in rabbit sera using a recombinant antigen and virus-specific monoclonal antibodies.

J Vet Med B Infect Dis Vet Public Health.

2003 50 6 265 269

Brown

Mitchell

Nasci

Smith GC, Roehrig JT.

Detection of eastern equine encephalitis virus in infected mosquitoes using a monoclonal antibody-based antigen-capture enzyme-linked immunosorbent assay.

Am J Trop Med Hyg.

2001 65 3 208 213

Lambert

Martin

Lanciotti

Detection of North American eastern and western equine encephalitis viruses by nucleic acid amplification assays

J Clin Microbiol.

2003 41 1 379 385

Surveillance for acute insecticide-related illness associated with mosquito-control efforts--nine states, 1999-2002.

MMWR Morb Mortal Wkly Rep

2003 52 27 629 634

Monath

T.P.

McLean

R.G.

Cropp

C.P.

Parham GL, Lazuick JS, Calisher CH.

Diagnosis of eastern equine encephalomyelitis by immunofluorescent staining of brain tissue

Am J Vet Res

1981 42 8 1418 1421

Bastian

F.O.

Wende

R.D.

Singer

D.B.

Zeller RS.

Eastern equine encephalomyelitis. Histopathologic and ultrastructural changes with isolation of the virus in a human case

Am J Clin Pathol

1975 64 1 10 13

Brault

A.C.

Powers

A.M.

Chavez

C.L.

Lopez RN, Cachon MF, Gutierrez LF, Kang W, Tesh RB, Shope RE, Weaver SC.

Genetic and antigenic diversity among eastern equine encephalitis viruses from North, Central, and South America

American Journal of Tropical Medicine and Hygiene

1999 61 4 579 586

Sorrentino

J.V.

Berman

Lowenthal

J.P.

Cutchins E.

The immunologic response of the guinea pig to Eastern equine encephalomyelitis vaccines.

Am J Trop Med Hyg

1968 17 4 619 624

Brault

Aaron C.

Powers

Ann M.

Holmes

Edward C.

Woelk CH, Weaver SC.

Positively charged amino acid substitutions in the E2 envelope glycoprotein are associated with the emergence of venezuelan equine encephalitis virus

Journal of Virology

2002 76 4 1718 1730

Deresiewicz

R.L.

Thaler

S.J.

Hsu

Zamanii

Clinical and neuroradiographic manifestations of eastern equine encephalitis

N Engl J Med

1997 336 26 1867 1874

Linssen

Bettina

Kinney

Richard M.

Aguilar

Patricia

Russell KL, Watts DM, Kaaden OR, Pfeffer M.

Development of Reverse Transcription-PCR Assays Specific for Detection of Equine Encephalitis Viruses

Journal of Clinical Microbiology

2000 38 4 1527 1535

Nathanson

Stolley

P.D.

Boolukos

P.J.

Eastern equine encephalitis. Distribution of central nervous system lesions in man and Rhesus monkey

J Comp Pathol

1969 79 1 109 115

Stotomayor

Edgar A.

Josephson

Stephen L.

Isolation of Eastern Equine Encephalitis virus in A549 and MRC-5 cell cultures

Clinical Infectious Diseases

1999 29 1 193 196

Huang

Cinnia

Slater

Brett

Campbell

Wayne

Howard J, White D.

Detection of arboviral RNA directly from mosquito homogenates by reverse-transcription polymerase chain reaction

Journal of Virological Methods

2001 94 1-2 121 128

Johnston

Robert E.

Peters

C.J.

Alphaviruses

Fields

Bernard N.

Knipe

David M.

Howley

Peter M.

Field's Virology Third Edition Volume 1

1996 843 898 Lippincott-Raven Publishers

Philadelphia PA

Morris

Charles D.

Eastern Equine Encephalitis

Monath

Thomas P.

The Arboviruses: Epidemiology and Ecology Volume III

1988 2 120 CRC Press

Boca Raton, Florida

Griffin

Diane E.

Alphaviruses

Knipe

David M.

Howley

Peter M.

Field's Virology Fourth Edition Volume 1

2001 917 962 Lippincott Williams and Wilkins

Philadelphia Pa

http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=10090&lvl=3&lin=f&keep=1&srchmode=1&unlock Mus musculus http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=10026&lvl=3&lin=f&keep=1&srchmode=1&unlock Cricetinae http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9544&lvl=3&lin=f&keep=1&srchmode=1&unlock Macaca mulatta http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=10141&lvl=3&lin=f&keep=1&srchmode=1&unlock Cavia porcellus http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Tree&id=9606&lvl=3&keep=1&srchmode=1&unlock Homo sapiens http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9796&lvl=3&lin=f&keep=1&srchmode=1&unlock Equus caballus http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=7157&lvl=3&lin=f&keep=1&srchmode=1&unlock Culicidae http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=8782&lvl=3&lin=f&keep=1&srchmode=1&unlock Aves http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=174825&lvl=3&lin=f&keep=1&srchmode=1&unlock Culiseta http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9989&lvl=3&lin=f&keep=1&srchmode=1&unlock Rodentia http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9397&lvl=3&lin=f&keep=1&srchmode=1&unlock Chiroptera http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9263&lvl=3&lin=f&keep=1&srchmode=1&unlock Metatheria http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=11021&lvl=3&lin=f&keep=1&srchmode=1&unlock Eastern equine encephalitis virus http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_uids=21218484&dopt;=GenBank Eastern equine encephalitis virus, complete genome http://www.vnh.org/MedAspChemBioWar/chapters/chapter_28.htm

Smith

Jonathan F.

Davis

Kelly

Hart

Mary Kate

Ludwig GV, McClain DJ, Parker MD, Pratt WD.

Viral Encephalitides http://www.emedicine.com/med/topic3155.htm

Mohan

Nandalur

Urban

Andrew W.

Eastern Equine Encephalitis http://www.cdc.gov/od/ohs/pdffiles/attachment5.pdf Guidelines for Arbovirus Surveillance Programs in the United States http://www.cdc.gov/od/ohs/biosfty/bmbl4/bmbl4s3.htm BMBL Section III. Laboratory Biosafety Level Criteria http://www.smartcycler.com/pdfs/west_nile_virus2.pdf

Skallah

Sameer

Bolton

Denise

Development of a Duplex Real Time RT-PCR test for surveillance of west nile and eastern equine encephalitis viruses using the smart cycler http://www.cdc.gov/ncidod/dvbid/arbor/arboguid.pdf

Moore

C.G.

McLean

R.G.

Mitchell

R.J.

Nasci RS, Tsai TF, Calisher CH, Marfin AA, Moore PS, Gubler DJ.

Guidelines for Arboviral Surveillance Programs in the United States. http://www.cdc.gov/ncidod/dvbid/arbor/alphavir.htm Division of Vector-Borne Infectious Diseases, CDC http://www.vetmed.ucdavis.edu/viruses/download.html UCDavis School Of Veterinary Medicine Virus Images

Wattam

Rebecca

wattam@vbi.vt.edu

05/11/2004 1.0

pathinfo@vbi.vt.edu