Classical Swine Fever Virus (CSFV), Hog Cholera Virus (HCV), Pestivirus type 2 Classical Swine Fever Virus CSF is a serious, economically damaging disease of swine which can spread in an epizootic form as well as establish enzootic infections in domestic and wild pig populations. It is on the Office International des Epizooties (OIE) List A. Most countries with significant pig production have statutory control measures for the disease, although the efficacy of these measures varies in accordance with the national economy, and the state of development of veterinary and laboratory infrastructure. Although effective vaccines exist, they do not on their own bring about disease eradication. Any use of vaccine has to be done in the light of the consequences for the disease status of the country or region. At the end of the 20th century, CSF remains widespread in many parts of the globe. Successful eradication has been achieved in many countries, including North America, Australasia, and parts of Northern Europe, and many such countries have successfully maintained freedom in the absence of vaccination, i.e. with a totally susceptible swine population. Despite this, complete eradication has proved elusive in parts of Europe and new approaches to control may be needed in the remaining infected regions. The situation in most of Africa is uncertain, but the disease is not reported as a problem there except in Madagascar. The disease probably emerged in the 1830's in the Midwestern States of the USA and its viral aetiology was revealed early this century when body fluids of diseased pigs that had been passed through porcelain filters proved infectious. Natural hosts of CSFV are members of the Suidae, i.e. not only domestic pigs but wild boar are also fully susceptible to the virus. In the 1940's and the following years three disorders of ruminants were attributed to viruses that share a great number of virological properties with CSFV: Bovine viral diarrhoea, mucosal disease of cattle and border disease of sheep. Based on their common features, e.g. sequence homologies and genome organisation, these viruses make up the genus Pestivirus in the family Flaviviridae. CSFV's devastating economical impact on the pig industry has always been a stimulus for research. However, like the other pestiviruses, CSFV was a difficult virus to work with, and major progress only became possible with the development and the availability of sophisticated virological methods especially during the last 15 years. Classical swine fever virus (CSFV) is the etiological agent of a highly contagious disease of pigs. Together with bovine viral diarrhoea virus and border disease virus CSFV belongs to the genus Pestivirus within the family Flaviviridae. The other two genera of the family are Flavivirus and Hepacivirus Classical swine fever virus strain 39 (CSFV39) Classical swine fever virus 39 Classical swine fever virus 96TD Classical swine fever virus 96TD Classical swine fever virus isolate Schweinfurt Classical swine fever virus isolate Schweinfurt Classical swine fever virus isolate Schweinfurt was isolated in Germany in 1993 from a cell supernatant sample of a domestic pig. Classical Swine Fever virus strain 5440/99 Classical Swine Fever virus strain 5440/99 Classical swine fever virus strain Eystrup Classical swine fever virus strain Eystrup Classical swine fever virus strain Riems Classical swine fever virus strain Riems Hog cholera virus 'Switzerland 1/93' Hog cholera virus 'Switzerland 1/93' Hog cholera virus 'Switzerland 1/93' was isolated in Trubschachen, Switzerland in 1993 from an organ sample of a domestic pig. Hog cholera virus 'Switzerland 2/93' Hog cholera virus 'Switzerland 2/93' Hog cholera virus 'Switzerland 2/93' was isolated in Herrenschwanden, Switzerland in 1993 from an organ sample of a domestic pig. Hog cholera virus 'Switzerland 3/93/1' Hog cholera virus 'Switzerland 3/93/1' Hog cholera virus 'Switzerland 3/93/1' was isolated in Kerzers, Switzerland in 1993 from an organ sample of a domestic pig. Hog cholera virus 'Switzerland 3/93/2' Hog cholera virus 'Switzerland 3/93/2' Hog cholera virus 'Switzerland 3/93/2' was isolated in Kerzers, Switzerland in 1993 from an organ sample of a domestic pig. Hog cholera virus 'Switzerland 4/93' Hog cholera virus 'Switzerland 4/93' Hog cholera virus 'Switzerland 4/93' was isolated in Burgdorf, Switzerland in 1993 from an organ sample of a domestic pig. Hog cholera virus (strain Alfort) Hog cholera virus (strain Alfort) Hog cholera virus (strain Brescia) Hog cholera virus (strain Brescia) Hog cholera virus strain 'ATCC VR-531' Hog cholera virus strain 'ATCC VR-531' Hog cholera virus strain 'Chinese vaccine, Wuhan' Hog cholera virus strain 'Chinese vaccine, Wuhan' Hog cholera virus strain 'Jen Sal' Hog cholera virus strain 'Jen Sal' Hog cholera virus strain 'Russian LK vaccine' Hog cholera virus strain 'Russian LK vaccine' Hog cholera virus strain 'Switz. IV/93' Hog cholera virus strain 'Switz. IV/93' Hog cholera virus strain 'VRI 4425' Hog cholera virus strain 'VRI 4425' Hog cholera virus strain Alfort/M Hog cholera virus strain Alfort/M Hog cholera virus strain Cellpest Hog cholera virus strain Cellpest Hog cholera virus strain Duvaxin Hog cholera virus strain Duvaxin Hog cholera virus strain EVI100 Hog cholera virus strain EVI100 Hog cholera virus strain GPE- Hog cholera virus strain GPE- In Japan, the GPE- strain of HCV has been used to prevent pigs from the disease. The GPE- strain was obtained from the wild ALD strain after multiple passages in swine testicle, bovine testicle and guinea-pig kidney cells. Pigs inoculated with this strain did not develop such clinical symptoms as anorexia and pyrexia. Hog cholera virus strain Kanagawa Hog cholera virus strain Kanagawa Hog cholera virus strain Norden Hog cholera virus strain Norden Hog cholera virus strain Osaka Hog cholera virus strain Osaka A Japanese isolate from 1971 is almost certainly of European origin, since it was obtained from a pig held in quarantine, shortly after importation from the UK. Hog cholera virus strain Painswhin Hog cholera virus strain Painswhin Hog cholera virus strain Pestipan Hog cholera virus strain Pestipan Hog cholera virus strain PS Porco Hog cholera virus strain PS Porco Hog cholera virus strain Rovac Hog cholera virus strain Rovac Hog cholera virus strain Steiermark Hog cholera virus strain Steiermark Hog cholera virus strain Tipest Hog cholera virus strain Tipest Hog cholera virus strain TVM-1 Hog cholera virus strain TVM-1 Hog cholera virus strain VRI4061 Hog cholera virus strain VRI4061 Hog cholera virus strain Zoelen Hog cholera virus strain Zoelen Inner core structure of about 30 nm, surrounded by a spherical envelope with diameters ranging between 40 and 60 nm Particles with a hexagonally shaped, electron-dense inner core structure of about 30 nm, surrounded by a spherical envelope with diameters ranging between 40 and 60 nm. http://staff.vbi.vt.edu/pathport/pathinfo_images/Classical_Swine_Fever_Virus/CSFV_genome.jpg ssRNA positive stranded 12301 bp 1 The RNA genome is approximately 12.5 kb and contains a single large open reading frame (ORF), which is flanked by 5prime and 3prime nontranslated regions (NTRs). This ORF is translated into a polyprotein, which is further processed into mature proteins by viral and host cell proteases. The surface structure of pestivirus virions is composed of three glycoproteins, Erns, E1, and E2. E2 is present as a homodimer and as an E2-E1 heterodimer. The C terminus of E2 (and probably of E1 as well) functions as a membrane-spanning domain and anchors the E2-E1 and E2-E2 dimers in the viral lipid membrane. The association of Erns homodimers with the virion is not accomplished by a membrane-spanning domain and is tenuous. The mechanism of Erns association with virions is currently unknown. All three envelope proteins contain N-linked glycosyl groups. Erns is glycosylated to a higher extent than E1 and E2 are. N-linked glycosyl residues account for about half of the mass of an Erns homodimer. A considerable portion of the Erns protein produced in infected cells is secreted into the extracellular environment and circulates in the body fluids of infected animals. The unexpected finding that Erns possesses RNase activity led to several interesting studies regarding the function of Erns in the life cycle of pestiviruses. The results of in vitro and in vivo studies indicated that Erns (and its enzyme activity) plays a role in the regulation of RNA synthesis in infected cells and in weakening the immune defense of the host early in infection. CSF is a serious, economically damaging disease of swine which can spread in an epizootic form as well as establish enzootic infections in domestic and wild pig populations. It is on the Office International des Epizooties (OIE) List A. Most countries with significant pig production have statutory control measures for the disease, although the efficacy of these measures varies in accordance with the national economy, and the state of development of veterinary and laboratory infrastructure. Although effective vaccines exist, they do not on their own bring about disease eradication. Any use of vaccine has to be done in the light of the consequences for the disease status of the country or region. The OIE defines the requirements for CSF-free status as follows: 1. Absence of CSF for at least two years 2. One year after slaughter of the last affected animal following a stamping out campaign with vaccination. 3. Six months after slaughter of the last affected animal following a stamping out campaign without vaccination. At the end of the 20th century, CSF remains widespread in many parts of the globe. Successful eradication has been achieved in many countries, including North America, Australasia, and parts of Northern Europe, and many such countries have successfully maintained freedom in the absence of vaccination, i.e. with a totally susceptible swine population. Despite this, complete eradication has proved elusive in parts of Europe and new approaches to control may be needed in the remaining infected regions. The situation in most of Africa is uncertain, but the disease is not reported as a problem there except in Madagascar. NETHERLANDS 1997: In 1997, the pig husbandry in the Netherlands was struck by a severe epidemic of classical swine fever (CSF). During this epidemic 429 CSF-infected herds were depopulated and approximately 1300 herds were slaughtered pre-emptively. In addition millions of pigs of herds not CSF-infected were killed for welfare reasons (over crowding or overweight). In this paper, we describe the course of the epidemic and the measures that were taken to control it.The first outbreak was detected on 4 February 1997 in the pig dense south-eastern part of the Netherlands. We estimate that CSF virus (CSFV) had already been present in the country by that time for 5-7 weeks and that the virus had been introduced into approximately 39 herds before the eradication campaign started. This campaign consisted of stamping-out infected herds, movement restrictions and efforts to diagnose infected herds as soon as possible. However, despite these measures the rate at which new outbreaks were detected continued to rise. The epidemic faded out only upon the implementation of additional measures such as rapid pre-emptive slaughter of herds in contact with or located near infected herds, increased hygienic measures, biweekly screening of all herds by veterinary practitioners, and reduction of the transportation movements for welfare reasons. The last infected herd was depopulated on 6 March 1998. GERMANY 1990's: In Germany, 424 outbreaks of CSF in domestic pigs and a great number of cases in wild boar were recorded between 1990 and 1998. Most of the federal states (Bundeslaender) were affected. Epidemiological data from field investigations combined with genetic typing allowed to distinguish seven unrelated epidemics and a number of sporadic outbreaks in domestic pigs. Detailed epidemiological data was available for 327 outbreaks. It was found that 28% of these were primary outbreaks. Most of them were due to indirect or direct contact to wild boar infected with CSF virus or swill feeding. Infected wild boar remain the main risk for domestic pigs. The most frequent sources of infection in secondary or follow up outbreaks were the trade with infected pigs, neighborhood contacts to infected farms and other contacts via contaminated persons and vehicles, respectively. An increased risk of virus transmission from infected herds to neighborhood farms was observed up to a radius of nearly 500 m. More than two thirds of the infected herds were discovered due to clinical signs. About 20% were identified by epidemiological tracing on and back. These were scrutinized because contacts to infected herds were evident. In conclusion, tracing of contact herds and clinical examination combined with carefully targeted virological testing of suspicious animals is likely to be the most important measure to immediately uncover secondary outbreaks. Obligatory serological screening in the surveillance and the restriction zones do not seem to be efficient measures to detect follow-up outbreaks. SWITZERLAND 1998: An outbreak of classical swine fever in wild boar in the southern part of Switzerland (Canton of Ticino) was investigated after the implementation of control measures in a defined infected area (the risk zone), and in a surrounding surveillance zone (the non-risk zone). After the disease had been detected, hunting was not allowed in the risk zone for over six months, during which the disease was left to run its course, but hunting was continued in the non-risk zone for one month. After seven months, a hunting strategy targeted at young animals was implemented in both zones. Between May 1998 and January 2000,1294 wild boar were shot or found dead, and diagnostic and biological data were collected and analysed. Only one animal from the non-risk zone was found to be seropositive for antibodies to the virus, whereas 179 of 528 wild boar from the risk zone were virus positive and 162 were seropositive. The proportion of virus-positive animals decreased from 62.7 per cent to zero over one year. During the first hunting season, seropositive animals were found in all age groups, but 12 months later only animals more than one year old had antibodies against the virus. BELGIUM 1997: Between 30 June and 17 July 1997, eight herds, located in three different areas, were confirmed to be CSF-positive. CSF virus was transmitted from the primary infected herd of one area to another five herds in the same area and to one herd in a different area. The mode of virus introduction for this primary infected herd and for the one herd that was not infected by this primary herd could not be determined. Clinical, serological, and virological findings indicate that the CSF-infected herds were detected in an early stage of the infection. The early detection of the infection together with a preventive stamping out 1 procedure resulted in a rapid elimination of the CSF virus. A total of 46 561 pigs were slaughtered to control the spread of the infection. Another 27 579 pigs were slaughtered in the framework of the market support. The total direct costs of the episode were estimated at 10 893 337 euros. USA AND CANADA: Canada has been free of CSF since 1963. The official eradication scheme in the USA started in 1961, the last case being recorded in 1976. No further outbreaks have occurred in Canada or the USA which must be attributable, at least in part, to a highly rigorous control policy for import of pigs and pig products to this region. BARBADOS 1973: Barbados, the most easterly of all the Caribbean islands has a total area of 166 square miles. The pig population previous to the 1973 outbreak of swine fever was 28,000 animals which were widely distributed over the eleven parishes or districts of the island. The pig industry, valued at $5M (B'dos) has always been of major importance to the livestock economy of the island. Through the years, the general health of the pig population has been good, with freedom from most of the major porcine diseases which take such heavy tool in other countries. Swine fever was last recorded in 1938, an absences of 35 years, a truly significant fact considering that there have been sporadic outbreaks of this disease during these years in several of the neighboring Caribbean territories. On February 26, 1973, the owner of a larger piggery in the parish of St. Lucy informed the senior veterinary officer of an outbreak of disease which was causing heavy losses in pigs of all ages. This was followed shortly after by a second outbreak at a large piggery in the parish of St. James. Investigation of these two outbreaks disclosed very similar findings and a common feature, namely the feeding of uncooked garbage from the same source. These initial outbreaks were rapidly followed by a series of others, mostly among smallholders' pigs in nine of the 11 parishes, the last case occurring on May 28. The introduction of the virus found a highly susceptible pig population and, as a result, the disease ran an acute course. In view of the widely distributed number of animals and their very close proximity, it was feared that the outbreak would have assumed greater proportions than actually occurred. The number of infected premises represented 0.07 per cent of the total number, while the number of pigs slaughtered represented 3.4 per cent of the total population. ORONASAL: The natural infection route for CSF is oronasal. SEXUAL: Three boars were inoculated with a CSF virus field isolate and from Day 5 till Day 18 thereafter, ejaculates were collected and prepared for insemination. Ruttish sows were inseminated with the extended semen from Day 5 till Day 18 after inoculation of the boars. All the inoculated boars remained healthy throughout the experiment and developed CSF neutralizing antibodies between 14 and 21 days after inoculation. Virus was isolated from several semen samples collected from 5 till 11 days after inoculation. Two out of six sows inseminated with CSF contaminated semen seroconverted after insemination. All the other sows remained seronegative. In the foetuses of both the seropositive sows, CSF virus was detected at 35 days post insemination. These results demonstrate that adult boars infected with CSF virus can excrete virus with semen and can, subsequently, transmit the virus to sows and their foetuses via artificial insemination. VERTICAL: The CSFV may also be transmitted from sows to their offspring by intrauterine infection. The outcome of such as transplacental passage depends on the stage of gestation. Infections during the first trimester of gestation mostly lead to repeat breeding and abortion, whereas, infection during the last trimester mostly result in abortion, malformation or birth of weak or dead piglets. Only when a sow becomes infected during the second trimester, persistently infected piglets may be born. These piglets are immunotolerant and may survive for a long time, persistently shedding the virus in the environment until a late onset of disease occurs and the animals die. This phenomenon is called the carrier-sow syndrome, and is of great importance in the epidemiology of CSF since it may lead to the persistence of an outbreak as apparently healthy pigs may shed the virus without being detected in the serological screening following an outbreak. WILD BOAR RESERVOIR: Since 1993, 327 CSF outbreaks in domestic pig herds were notified in Germany.Twenty-eight per cent of these were primary outbreaks. Most of them occurred in geographic regions where the wild boar population was affected by CSF. Epidemiological field investigations confirmed by genetic typing have shown that 59% of the primary outbreaks in domestic pig herds were due to direct or indirect contact to infected wild boar and wild boar meat SWILL FEEDING: Swill containing products originating from CSF infected pigs and fed to susceptible pigs may cause new infections. The outbreaks of 1986 and 2000 in the United Kingdom and of 1996 in Germany are believed to be caused by sill feeding. In 1993-1994 during a screening in Germany, the virus has been isolated from imported meat of wild boar of China and Romania. Although swill feeding has been forbidden in the EU, experts estimate that (illegal) swill remains an important threat. INDIRECT CONTACT: Livestock trucks contaminated with excretions and secretion of infected pigs that are insufficiently cleaned and disinfected may be an important route of virus transmission. Transmission of SCFV by persons is also frequently mentioned as a possible route of virus spreading. With persons all kind of visitors on pig premises can be understood [sic]: veterinarians, inseminators, pig dealers, screening teams, etc. These persons may carry the virus passively by contaminated clothing and material. In the past, also iatrogenic transmission after vaccination or treatment has been described and was important. Use of the same needles, syringes, contaminated medicine bottles and other material are risk factors. Under current management systems and hygienic precautions, the probability of between-herd spread through iatrogenic transmission is believed to be limited. AIRBORNE: It can be concluded that airborne transmission of CSFV is possible within as well as between herds. However, in some studies airborne transmission is found only in a radius of 250 m, whereas in others it is found in the 1 km zone. Consequently, the maximum distance that the virus may spread airborne remains unclear. Moreover, it is to be expected that airborne transmission is largely influenced by climatological and geographical parameters, but factors such as virus strain may also influence the transmission. The role of wild boar as a virus reservoir and possible source of infection for domestic pigs is still unclear although epidemiological links between CSF virus infections in wild board and domestic pigs have been reported repeatedly. The findings were indicative for the decisive role which young wild boar play in the epidemiology of CSF. Following intrauterine transfer some of the wild-boar piglets were probably persistently infected with CSF virus as experienced experimentally. Such piglets can be held responsible for CSF virus perpetuation within the wild-boar population. No CSF virus was isolated from adult wild boar weighing more than 75 kg. During 3 years of monitoring a sufficient number of susceptible wild boar, in particular young animals, was available to maintain the infection chain in that area. It was concluded that persistently infected piglets and the high population density of wild boar in the Brandenburg region offered optimal conditions for the establishment of an CSF epidemic. During these 3 years the chain of infection was not interrupted in spite of simultaneous bait vaccination against CSF. The most likely explanation for this observation is the existence of persistently infected animals which harbour CSF virus for a prolonged period. Persistently infected domestic piglets can survive and shed CSF virus for several weeks, or even for months without showing clinical symptoms following transplacental or early postnatal infection. For Brandenburg it can be concluded that during the reported 3 years of monitoring sufficient susceptible wild boar, in particular young animals, were available to maintain the chain of infection. Persistently infected piglets and the high density of wild boar in that region are the most plausible explanation for the establishment of CSF. Swill containing products originating from CSF infected pigs and fed to susceptible pigs may cause new infections. The outbreaks of 1986 and 2000 in the United Kingdom and of 1996 in Germany are believed to be caused by swill feeding. In 1993-1994 during a screening in Germany, the virus has been isolated from imported meat of wild boar of China and Romania. It is well established that virus can readily be recovered from pigs which die or are killed during acute swine fever infection, including during the prodromal period. The latter is particularly important as pigs could pass through abattoir and meat inspection procedures without being detected as abnormal. The importance of this results from the widespread practice of feeding waste food (swill) from the human food chain back to pigs. If swill contains uncooked infected pig meat or meat products, then it can initiate a new focus of infection, which may be remote from the original source. This is a frequent source of infection for new outbreaks in swine fever-free areas. The viability of virus in pork and pig meat products is very variable depending on the treatments to which they are subjected. The most stable system is frozen pork, where virus survival times of more than 4 years have been recorded. Virus was still viable in chilled fresh pork for periods up to 85 days. Less information is available on room temperature storage, but it has been reported that artificially contaminated factory-processed abattoir waste held at 20 C for 3 weeks was already non-infectious by four days. A wide variety of processes are used in curing of pig meat, including salt-cures and smoking methods. The treatments themselves do not appear to inactivate swine fever virus in the proteinaceous environment of meat tissue. Virus survival times of between 17 and 188 days have been reported for different forms of curing or smoking The critical factor is probably the length of time and the temperature at which the product is stored before being released to the marketplace. Thus, traditional hams with prolonged curing times should be safe as virus could not be recovered from Parma ham from Day 313 onwards and from Serrano and Iberian hams by 140 - 252 days. Swine fever virus is readily killed by pasteurization processes or cooking. Treatment of virus-contaminated meat for 30 min at 65 C or 1 min at 71 C rendered it non-infective. However, 30 min at 62.5 C failed to inactivate the virus, indicating the importance of temperature control during industrial processes. In a series of carefully controlled experiments, Torrey and Prather (1963) showed that virus survival in defibrinated pig blood changed markedly over a narrow temperature range. Blood contaminated at 10(5) TCID50/ml was inactivated by temperatures of 66 C for 60 min, 68 C for 45 min, or 69 C for 30 min. Virus contamination of meat is mainly of concern where such products come in contact with live pigs, usually through feeding of swill. Thus, a major impact on disease prevention can be achieved by banning swill feeding, or by strict control of swill feeding plants to ensure that the swill is adequately heated. In practice, such enforcement can be difficult, and complementary controls on importation of pork and pork products from infected areas should be implemented. In establishing the scope of such control, a risk assessment/risk management approach should be adopted. Other, often overlooked, reservoirs of local importance are contaminated syringes, needles and partly used medicine bottles, especially when kept cool. Inadequately cleaned and disinfected stables or vehicles are sources of minor importance, as putrefaction and other environmental influences rapidly inactivate the virus. Survival Times: It is impossible to give definitive guidelines for the survival time of swine fever virus in the environment. The durability of the virus is affected by many physical and chemical variables, including temperature, humidity, pH, presence of organic matter, and exposure to various chemicals. Artificially contaminated bricks or chopped hay, exposed to air but protected from direct sunlight and rain, retained infective virus at 7 days but were no longer infective at 14 days. Ultra-violet light will rapidly inactivate the virus. Infected pigs excrete virus from the respiratory, urinary and alimentary tracts, so it must be assumed that the immediate surroundings of such animals are contaminated and will remain so for a period after removal of the pigs. Airborne spread from farm to farm may occur, especially in areas with high pig population density, but this is not a major feature of the epidemiology, and is usually limited to neighboring herds within 6 km radius, suggesting that the virus is rapidly inactivated in aerosols. The virus may survive for longer periods in manure, and experimental studies suggested that inactivation occurred more rapidly in the liquid phase of slurry than in the solid phase, infectivity being lost in about 15 days. Using BVD virus as a model, it was shown that survival times in various types of water varied from 6 - 24 days at 20 C. Compared to bio-terror, agro-terror is appallingly easy. Animal diseases of greatest concern are those that , by nature, are very infectious and spread rapidly through herds and flocks. Foot-and-mouth disease, for instance, is the most contagious disease known to exist, spreading from animal to animal with incredible rapidity and in a more efficient manner than even the most contagious of human diseases. Bringing foot-and-mouth disease virus into a naive area is surprisingly simple, and once introduced, it will spread quite readily, without any requirement for weaponization to facilitate spread. Many of the other animal disease that are of greatest concern in terms of their ability to enter a new area and destroy trade - classical swine fever, rinderpest, highly pathogenic avian influenza, and exotic Newcastle disease - are also extremely contagious. These agents could be acquired in many less-developed countries where they are endemic. Stated simply, agro-terror is appallingly low-tech. Veterinarians and livestock owners who suspect an animal may have CSF or any other foreign animal disease should immediately contact State or Federal animal authorities. For more information, contact: USDA, APHIS, Veterinary Services Emergency Programs 4700 River Road, Unit 41 Riverdale, MD 20737-1231 Telephone (301) 734-8073 Fax (301) 734-7817 Once introduced, it will spread quite readily, without any requirement for weaponization to facilitate spread. Many of the other animal disease that are of greatest concern in terms of their ability to enter a new area and destroy trade - classical swine fever, rinderpest, highly pathogenic avian influenza, and exotic Newcastle disease - are also extremely contagious. In response to the potentially devastating consequences that could arise, there is an acute need for rapid detection of a variety of the lethal foreign animal diseases, such as foot-and-mouth disease virus (FMDV), highly pathogenic strains of avian influenza, classical swine fever, rinderpest, exotic Newcastle disease virus (END), and domestic, vesicular look-alike diseases that include bluetongue, epizootic hemorrhagic disease, vesicular stomatitis, bovine herpes IBR, contagious ecthyma, bovine herpes mammilitis virus, vesicular exanthema, malignant catarrhal fever, and papular stomatitis. Some striking advances are occurring in the creation of rapid technology, including microfluidics, robotics, miniaturization, and biostabilization that are quickly being applied to the development of rapid microbial detection assays. These are now providing important weapons to combat this agricultural vulnerability. The current advances in technology make rapid detection and real-time diagnostics not only possible, as the standard of high quality diagnostics, but also probably for the future. In the current environment of homeland security and global awareness, the ability to transition developing technologies into practical applications rapidly has never been more relevant fore the public and animal health professions. Molecular weapons for defense of animal and public health should now be within the realm of possibility, because of the remarkable progress in the sciences and technology that have occurred in the US over the last several decades. Pig, swine, wild boar Sus scrofa Classical swine fever (CSF) is one of the most important viral pig diseases. 398 TCID50 intranasally -- The CSFV strain used for challenge inoculation of the pigs was the virulent strain Brescia 456610. The actual virus content was approximately 10(2.6) TCID50 per ml [398 TCID50]. After challenge inoculation, all pigs in the unvaccinated control groups in all experiments developed signs of CSF like fever, anorexia and paresis. All control pigs died of CSF or were killed when moribund 10 - 14 dpc. Formerly inactivated vaccines were used a great deal. Usually pigs were infected with a virulent virus and the spleen, lymph nodes and blood from these animals were then used as a virus source for the vaccine, either directly or after one passage on pig kidney cells. The HCV was inactivated with one of the following agents: toluidine blue, hydroxylamine, ethylene oxide, beta-propriolactone or formalin. Some of these vaccines are no longer used because: the large volume of vaccine to be injected (sometimes up to 20 ml), the necessity of injecting twice at a 2 to 4 weeks interval for the first vaccination, the slow development (2-3 weeks) and the short duration of the immunity, the cost of the vaccines due to the virus origin and the necessity of having high virus titers, the difficulties to obtain uniform inactivation. The last (experimental) inactivated vaccines dated from the 1970's. Vaccination against CSF has a long history, leading to the development in the 1960's of a number of highly effective live attenuated vaccines. Prophylactic vaccination is still carried out in many parts of the world. If used systematically and on a national or regional basis, conventional live vaccines will lead to a marked reduction in clinical cases and in the levels of circulating virus. This can be used as a transitional phase towards non-vaccination and stamping out as was done in Europe and elsewhere. In order to avoid the disadvantages of inactivated vaccines and thanks to the development of new virological techniques, production of live attenuated vaccines has begun. The development of an attenuated vaccine strain has sometimes occurred via many roundabout ways. The virus strains obtained at almost every step were tested fro use as a vaccine and, to a greater or lesser extent, put to practical use. A distinction is made between a lapinized strain and a lapinized C strain. Both strains are the final product of several passages in rabbits. However, some lapinized strains lost all virulence for pigs of any age (including pregnant sows). The development of attenuated HCV vaccine often occurred as follows: An initial modification of the virus strain was obtained by alternating rabbit-pig passage until the virus was altered in such a way that further passages could only be carried out in rabbits e.g. lapinized strains. Usually, the rabbits were slaughtered 3 days and the pigs 5 days after inoculation. Some strains have been attenuated using the continuous cell virus propagation technique: after incubation with the virus, the culture medium was renewed every 3 to 7 days. In this manner, the virus culture was maintained until cells declined in activity. A further cloning then followed using the limiting dilution method, and/or by passages on cell cultures carried out at low temperatures. CEDIPEST - The Chinese strain of hog cholera virus (HCV) was adapted to suspension cultures of the established swine kidney cell line SK6. the strain designated "Cedipest," is produced on the basis of the seedlot system. The masterseed virus was identified in vitro and in vivo, and was found free from extraneous pig pathogenic viruses by repeated animal inoculation followed by appropriate serological tests. A distinct and reproducible relationship was ascertained between infectivity in vitro and protection. Pigs inoculated with 400-600 TCID50 of the Cedipest strain proved fully protected against challenge with greater than 100 pig LD50 of a virulent strain of HCV at 7 days and at 6 month post vaccination. Cedipest - 100% Cedipest - 6 months at least. C-strain:The vaccinal protection lasted at least 6-18 months but it may even be lifelong: Terpstra (unpublished results) observed that sows vaccinated during a field campaign and challenged in the laboratory 6-7 years later, still remained healthy, whereas two unvaccinated control sows died from the CSFV challenge. Another disadvantage of the C-strain is that it sometimes can be transmitted from sow to foetus, but it does not appear to lead to immunotolerance The C-strain is generally considered to be very safe. It induces no disease in young piglets or pregnant sows, even when pigs have been immunosuppressed with corticosteroids. The vaccine virus replicates in the tonsils and sometimes may be encountered in other organs, up to 2-3 weeks after vaccination. Persistence for more than 3 weeks has not been reported. The vaccine virus has been shown to be transmitted occasionally to in-contact pigs, but it has not been reported that it can persist in a population. Serial pig-to-pig transmission experiments have been performed to examine whether the C-strain could revert to virulence: all experiments showed absence of such a reversion. No adverse effects have been described due to transmission of the vaccine virus to foetuses or newborn animals. Local reactions at the site of injection have never been reported. Chromosomal aberrations have been reported to be associated with C-strain vaccination. A general drawback of live vaccines is the risk of contamination with extraneous agents, and a batch of C-strain vaccine has been found contaminated with another pestivirus The major advantage of an efficacious marker vaccine is that it allows the detection of infected pigs in a vaccinated pig population, and thus offers the possibility to monitor the spread or re-introduction of CSFV in a pig population. Thus, it makes it possible to declare, with a certain level of confidence, that a vaccinated pig population is free of CSF on the basis of laboratory test results. The latter could result in a shortening of the restriction period for the export of live pigs or pig products. The economic advantage of a rapid resumption of trade is obvious and therefore closely related to the use of any marker vaccine. SUBUNIT: Recently, a subunit vaccine against CSFV has been developed based on the envelope glycoprotein E2. This subunit vaccine is thus a potential marker vaccine, as discrimination between vaccinated and infected pigs can be based on the detection of antibodies against Erns and/or NS3. A single vaccination with a vaccine dose of 32 mg E2 in a water-oil-water adjuvant was able to prevent most clinical signs (except a mild fever) and mortality due to a CSFV challenge-inoculation three weeks after vaccination. Moreover, virus transmission to susceptible sentinel pigs was prevented in nearly all groups of pigs vaccinated with this dose. The vaccine was stable until at least 18 months after being produced, and retained its full potency. These findings indicate that the E2 marker vaccine merits further evaluation to determine whether it is suitable for implementation in a control program during an outbreak of CSF. LIVE RECOMBINANT: The Chinese vaccine strain (C-strain) of CSFV is used world-wide for the eradication of CSF. Recent developments in molecular technology have enabled researchers to construct DNA copies of the complete RNA genome of CSFV. Two recombinant CSFVs (Flc2, Flc3) transcribed from a DNA copy of the genome of the C-strain have been characterized in vivo in rabbits and pigs. The results demonstrated that the two recombinant viruses had retained the advantageous biological and immunogenic properties of the parent C-strain in rabbis and pigs. We concluded that the full-length cDNA of the C-strain could serve as a matrix for further development of a live recombinant CSFV marker vaccine. Two live candidate recombinant marker vaccines (Flc9 and Flc11) against CSF have been evaluated for their capacity to reduce transmission of virulent CSFV among vaccinated pigs. In Flc9 virus the 5prime terminal half of the E2 gene of the C-strain was exchanged with the homologous gene of the bovine viral diarrhea virus (BVDV) strain 5250; in the chimeric Flc11 virus the Erns gene was exchanged likewise with the homologous gene of the strain 5250. Thus pigs infected with Flc9 or Flc11 virus will not induce CSFV-specific antibody against E2 or Erns protein, respectively. Clinical protection and reduction of transmission of virulent CSFV were studied in pigs vaccinated with Flc9 or Flc11 at a vaccination challenge interval of 1, 2, or 4 weeks. Both chimeric viruses provided good clinical protection against a challenge with virulent CSFV at 1 or 2 weeks after vaccination. VIRUS REPLICON PARTICLES: The most recent CSF vaccines described are the so-called virus replicon particles (VRP). These particles contain a mutant genomic RNA which is able to replicate and to express the encoded viral proteins but which does not contain the complete information required for particle formation due to deletions in at least one of the genes encoding the viral structural proteins. These virus particles are non-transmissible and, therefore, fulfill one of the requirements for a safe vaccine. All animals vaccinated with VRP A187-E2del68 (groups A and B) showed clinical signs of CSF but survived the challenge. The clinical picture showed that oral immunization was not as efficacious as vaccination by the intradermal route. This is also supported by the fact that two of the latter animals were positive for either anti-E2 or neutralizing antibodies one day before challenge whereas the oronasally immunized animals were seronegative at this time. Also, the booster effect of the challenge virus on the antibody response was more pronounced in the intradermally immunized animals. Oronasal immunization with VRP A187-E2del373 had a comparable protective effect in two of three animals (group C) as observed for VRP A187-E2del68. However, the third animal (no. 745) showed prolonged viremia and leukopenia and had to be sacrificed due to severe anaemia. Nevertheless, this finding suggests that protection against lethal challenge after immunization with CSF-VRP might not depend primarily on E2 protein. Serologically, after immunization with VRP A187-E2del373 the booster effect of the challenge virus was observed only for anti-Erns antibodies but, as expected, not for anti-E2 antibodies. Thus, we confirm the finding of van Gennip et al. who found that intradermal vaccination with CSF-VRP encoding either complete E2 or the antigenic domain A of E2 is efficient in protecting pigs against a lethal CSFV challenge. Furthermore, we show that a comparable partial protection is obtained by oronasal application of 107 TCID50 CSF-VRP lacking the E2 gene either partially or completely. The two experimental vaccines CSF-VRP A187-E2del68 and CSF-VRP A187-E2del373 used here represent live-attenuated non-transmissible vaccines. Such "suicide" vaccines are of interest because they are not spread, neither horizontally nor vertically. 95% - The PD95 is here defined as the vaccine dose that can protect 95% of the pigs against mortality due to a challenge infection with CSFV strain Brescia. Using the Reed - Muench estimate (1938), the PD95 was determined to be approximately 28 mg E2. A safe and effective dose in following experiments was assumed to be 32 mg E2. Swill feeding remains of paramount importance in the introduction of classical swine fever into previously disease-free areas as the virus survives surprisingly well in a variety of meat products. Swill feeding should therefore be banned or be strictly controlled to ensure that only properly heat-treated materials are fed. The public and industry also need to be informed of the risks from imported pig meat products. In the event of such an outbreak on an intensive pig farm, there may be the additional problem of large quantities of pig slurry that may be contaminated with the virus. This cannot be disposed of in the usual manner by spreading onto agricultural land, as some virus may remain infective for long periods of time in the slurry and disposal on field risks spreading the virus to adjacent farms. The virus must therefore be rendered non-infective before disposal of the slurry. From the results and considering virus in slurry and water, it is recommended that a full-scale mobile treatment plant, when used to treat farm-scale quantities of contaminated slurry, should operate at a minimum of 65 C for CSFV. This is more than enough to cause inactivation of the virus in question to below detectable levels in slurry of any concentration, or water, and allows a reasonable margin of error during operation to provide confidence in the treatment process. 100% Like other pestiviruses, CSFV grows readily in vitro and is able to cause a persistent, non-cytopathic infection of cell cultures. This indicates that the virus can avoid the antiviral effects of type I interferon and prevent programmed cell death (apoptosis). Indeed, porcine cells infected with CSFV are strongly protected against stimuli that normally trigger apoptosis, such as treatment with double-stranded RNA, and resist the antiviral effects of type I interferon. The first protein encoded by the genome, Npro, is an autoprotease that cleaves itself from the nascent viral polyprotein and whose function has been enigmatic. Recently, it has been shown that CSFV, lacking Npro induces rather than inhibits an interferon response in infected monocytes. CSFV is also immunosuppressive and neutralising antibodies may not appear until three weeks after infection. Since the virus is so innocuous in vitro, it has long been suspected that the serious lesions found in vivo must have an immunopathological origin. During infection, there are profound changes in the bone marrow and in the circulating white cell population and these may precede widespread infection of these cell types. This suggests an indirect cytopathic effect induced in mainly uninfected cells, damaged by a soluble viral factor or by some other disturbance of cellular homeostasis. There is evidence for both of these mechanisms. Firstly, there is a soluble viral protein Erns that at high concentrations is able to induce apoptosis in lymphocytes in vitro. However, supernatant fluids collected from cell cultures infected with CSFV do not induce apoptosis. Secondly, virus replication in monocytes and macrophages induces the release of cytokines including prostaglandin-E2 and interleukin-1, which have a probable role in fever and haemorrhages. Although the majority of pestiviruses are noncytopathic in vitro, BVD viruses from cases of mucosal disease and a small minority of CSF viruses can be cytopathic in vitro, expression of NS3 being the hallmark of such cytopathic viruses. The incubation period in individual animals is about one week to 10 days. Under field conditions, symptoms may only become evident in a holding 24 weeks after virus introduction, or even later. The severity of clinical signs largely depends on the age of the animal and viral virulence. Usually young animals are affected more severely than older animals. In older breeding pigs the course of the infection is often mild or even subclinical. Mortality rates may reach 90% in young pigs. Acute and chronic courses of CSF are known. All courses of the infection have in common that the animals are viraemic at least as long as they show clinical signs. Death occurs 2 - 3 weeks after infection (acute course) or after up to three months (chronic course). The outcome of transplacental infection of foetuses depends largely on the time of gestation and may result in abortions, stillbirths, mummifications, malformations or the birth of weak or persistently viraemic piglets. Although persistently infected offspring may be clinically normal at birth, they invariably die from CSF. Survival periods of 11 months after birth have been observed. Piglets up to 12 weeks of age most often display the acute form. A constant finding is pyrexia, usually higher than 40 C, but in adults the temperature may not exceed 39.5 C. Initial signs are anorexia, lethargy, conjunctivitis, enlarged and discolored lymph nodes, respiratory signs and constipation followed by diarrhoea. Neurological signs are frequently seen, such as a staggering gait with weakness of hind legs, uncoordination of movement, and convulsions. The typical haemorrhages of the skin are usually observed on the ear, tail, abdomen and the inner side of the limbs during the second and third week after infection until death. The virus is shed from the infected animal by saliva, urine and feces. Pathological changes visible on post mortem examination are observed most often in lymph nodes, spleen and kidneys. The lymph nodes become swollen, oedematous and haemorrhagic. Haemorrhages of the kidney may vary in size from petechiae to ecchymotic haemorrhages. Petechiae can also be observed in the urinary bladder, larynx, epiglottis and heart, and may be widespread over the serosae of the abdomen and chest. A nonpurulent encephalitis is often present. CSF virus causes severe leukopenia and immunosuppression, which often leads to secondary enteric or respiratory infections. The signs of these secondary infections can mask or overlap the most typical signs of CSF and may mislead the veterinarian. CSF must also be considered in the differential diagnosis of erysipelas, porcine reproductive and respiratory syndrome (PRRS), cumarin poisoning, purpura haemorragica, post-weaning multisystemic wasting syndrome (PWMS), porcine dermatitis and nephropathy syndrome (PDNS), Salmonella or Pasteurella infections or any enteric or respiratory syndrome with fever not responding to antibiotic treatment. With increasing age of the infected pigs (fattening and breeding animals) the clinical signs are less specific and recovery with production of antibodies can occur. Antibodies against CSF virus become detectable 23 weeks postexposure to CSF virus A constant finding is pyrexia, usually higher than 40 C, but in adults the temperature may not exceed 39.5 C Initial signs are anorexia, lethargy, conjunctivitis, enlarged and discoloured lymph nodes, respiratory signs and constipation followed by diarrhoea. Initial signs are anorexia, lethargy, conjunctivitis, enlarged and discoloured lymph nodes, respiratory signs and constipation followed by diarrhoea. Initial signs are anorexia, lethargy, conjunctivitis, enlarged and discoloured lymph nodes, respiratory signs and constipation followed by diarrhoea. Initial signs are anorexia, lethargy, conjunctivitis, enlarged and discoloured lymph nodes, respiratory signs and constipation followed by diarrhoea. Initial signs are anorexia, lethargy, conjunctivitis, enlarged and discoloured lymph nodes, respiratory signs and constipation followed by diarrhoea. Initial signs are anorexia, lethargy, conjunctivitis, enlarged and discoloured lymph nodes, respiratory signs and constipation followed by diarrhoea. Neurological signs are frequently seen, such as a staggering gait with weakness of hind legs, uncoordination of movement, and convulsions. The typical haemorrhages of the skin are usually observed on the ear, tail, abdomen and the inner side of the limbs during the second and third week after infection until death. Kidney and lymph node haemorrhages are widely reported in the acute and subacute forms of CSF; indeed, a pale kidney with petechiae ("turkey-egg kidney") is a characteristic finding of great diagnostic value. Classical Swine Fever is a viral disease characterized by haemorrhages associated with early intense thrombocytopenia. The onset of thrombocytopenia coincides with the appearance of fever and the start of viremia. The chronic form of CSF is always fatal. It develops when pigs are not able to mount an effective immune response against the infection. Initial signs are similar to die acute infection. Later, predominantly non-specific signs are observed, e.g. intermittent fever, chronic enteritis and wasting. Animals may survive for 2-3 months before they die. CSF virus is shed from the onset of clinical signs constantly until death. Antibodies may be temporarily detected in serum samples, as the immune system starts to produce antibodies although they are not able to eliminate the virus from the host. Consequently the antibodies are neutralised by the virus and cease to be detectable. Pathological changes are less typical, especially the lack of haemorrhages on organs and serosae. In animals displaying chronic diarrhoea, necrotic and ulcerative lesions on the ileum, the ileocaecal valve and the rectum are common. Since clinical signs of chronic CSF are rather non-specific, a broad range of other diseases must be considered as part of any differential diagnosis. Although the course of infection in the sow is often subclinical, CSF virus is able to cross the placenta of pregnant animals, thereby infecting fetuses during all stages of pregnancy. The outcome of transplacental infection of fetuses mainly depends on the time of gestation and viral virulence, respectively. Infection during early pregnancy may result in abortions and stillbirths, mummification and malformations. All of this will lead to a reduction in the fertility index in the holding. Infection of sows from about 50-70 days of pregnancy can lead to the birth of persistently viraemic piglets, which may be clinically normal at birth and survive for several months. After birth, they may show poor growth, wasting or occasionally congenital tremor. This course of infection is referred to as late onset CSF. These piglets constantly shed large amounts of virus and are a dangerous virus reservoir, spreading the disease and maintaining the infection within the pig population. This situation is comparable to cattle persistently infected with BVD virus. CSF must be considered in the differential diagnosis of reduced fertility due to parvovirus infection, PRRS, leptospirosis and Aujeszkys disease. Prevailing strains of CSF virus are of only moderate virulence, making clinical diagnosis difficult especially in older animals. This increases the danger of delayed detection of primary cases as occurred in England in 2000. The recent emergence of porcine dermatitis and nephropathy syndrome also complicates the diagnosis, since it can have a similar clinical appearance to CSF. Because the clinical signs of CSF are not pathognomonic, laboratory confirmation of disease is normally required, even for secondary cases during large outbreaks. CSF often has an incubation period of some weeks, on a herd basis, requiring several cycles of amplification before it becomes clinically apparent. "Pre-clinical" detection would therefore be of enormous benefit to disease control. Fever is a very prominent sign in CSF and it would be extremely useful if pigs could be microchipped or screened en masse (for example using infra red devices) to select those with the highest temperatures for closer examination and sampling. There are no descriptions of pen-side tests for CSF virus in the literature and tests are currently laboratory based, although portable RT-PCR methods are under investigation. The traditional laboratory diagnostic methods are virus isolation and the demonstration of viral antigens in sections of frozen organs. These have been augmented by the use of antigen detection ELISA and RT-PCR. The ELISA is a simple and rapid method for screening sick or pyrexic pigs and has the advantage that it can be used on large numbers of blood samples. RT-PCR is more complicated and expensive but is also rapid and due to its greater sensitivity can be used on pooled samples and for preclinical diagnosis. If sufficiently automated to enable large numbers of blood samples to be examined, it might be usable as a means of certifying that pigs at an abattoir were non-viraemic at slaughter. An RT-PCR on meat-juices has also been investigated as an alternative to testing blood. There is currently no practical means of wholesale screening of pig-meat imports, as the level of virus in meat is likely to be very low and the scale of required testing would be very large. Tests for CSF antibodies in meat juices would be a possible alternative approach as has been done for other diseases. Infection with CSF virus is immunosuppressive and virus-specific antibodies are very slow to appear. A Dutch study confirmed that routine serosurveillance is not an effective method for early detection of newly introduced CSF. Large-scale serology is possible using commercially available ELISA kits. In 1997/1998 the Dutch tested 2.1 million blood samples for antibody. Unfortunately, the tests are not absolutely CSF specific and can detect antibodies induced by other pestiviruses (bovine viral diarrhoea virus and Border disease virus), which occasionally infect pigs. Therefore, positive ELISA results may need to be confirmed by comparative neutralisation tests, which are laborious and slow. A system of "comparative ELISA" might be a way round this problem. 3-Agriculture. Biosafety level 3-agriculture is maximum containment for animal pathogens. DEFINITION: designed for certain high-risk and exotic microbiological agents that infect livestock or plants (example: hog cholera virus); mandatory building design includes personnel change rooms with showers; personnel and equipment air locks; double-door autoclave; single-pass, directional, and pressure gradient air system; HEPA filtration (or equivalent) on supple and exhaust air with electrical interlocks to prevent pressurization of laboratory during electrical or mechanical breakdowns; central liquid/solid waste sterilization; and sealed interior surfaces; facility designed to protect the environment and requires special testing and certification procedures for commissioning, such as pressure decay testing to confirm integrity of biosecurity barriers and construction techniques. Biological containment of disease agents is more difficult in animal (in vivo) studies than in laboratory (in vitro) manipulations. Laboratory work allows the containment and control of infectious materials during procedures by utilizing standard laboratory practices and techniques and also specialized primary barrier equipment. Animals (livestock and poultry species) infected with disease agents present unique challenges for biosecurity control. Containment of infected animals, shed disease agents, and associated wastes fro infected animals is difficult because standard operating procedures and primary barrier strategies are very limited or not available. As a result, the animal room itself must serve as the biological containment barrier. Some animal pathogen studies (in vivo) warrant additional facility features and procedural controls beyond standard biosafety level 3 requirements to ensure containment and experimental control In the "EU Diagnostic Manual for CSF Diagnosis", the permanent cell line PK(15) (porcine kidney) is recommended. In the European Reference Laboratory (EURL) a clone of this cell line, PK(15)A, and the STE (swine testicular epitheloid) cell line are in use for propagation of CSFV. Cells were propagated in Eagle's minimal essential medium containing 10.0% specific-pathogen-free calf serum, penicillin (100 units per ml), and streptomycin (100 mg per ml). A swine kidney cell line (SK-6), established from a 6-month-old female pig, was subcultured 200 times during a period of 6 years. The cultural pattern was epithelioid. The chromosome complement of the cell line was aneuploid, and the modal number of chromosomes was 39. Cultures grew relatively slowly and 6 to 7 days were required to develop confluent monolayers when 80,000 cells per ml. were seeded. The cells did not produce tumours in hamsters or in young gnotobiotic pigs. The cell line was susceptible to several porcine and other animal viruses. The cultural medium contained Hanks's balanced salt solution (BSS) with 0.05% lactalbumin hydrolysate, 10% bovine serum, 0.5% sodium bicarbonate (8.8%), 100 units of penicillin and 100 mg of streptomycin. The maintenance medium was similar except that the serum was reduced to 2 to 3% and sodium bicarbonate increased to 1.5 to 2.5%. 37 C When the seeding rate was 10,000 cells per 1.0 ml. a confluent monolayer developed in 2 weeks. At a seeding rate of 100,000 cells per 1.0 ml., the cell sheet became confluent on the 6th day, and between these extremes the development of the confluent monolayer was related to the seeding rate. The fluorescent antibody test (FAT) is a rapid test that can be used to detect CSFV antigen in cryostat sections of tonsils, spleen, kidney, lymph nodes or distal portions of the ileum. Tissues should be collected from several animals and transported without preservatives under cool conditions, but not frozen. Cryostat sections are stained directly with anti-CSF immunoglobulin conjugated to fluorescein isothiocyanate (FITC) or indirectly using a secondary FITC conjugate and examined by fluorescence microscopy. During the first stage of the infection, tonsillar tissue is the most suitable, as this is the first to become affected by the virus irrespective of the route of infection. In subacute and chronic cases, the ileum is frequently positive and occasionally may be the only tissue to display fluorescence. A negative FAT result does not completely rule out CSF infection. When suspicion of CSF continues, further samples should be obtained or attempts made at virus isolation in cell culture (e.g. pig kidney [PK-15]) or another cell line of pig origin that is as sensitive and known to be free from Pestivirus contamination. Isolation of virus in cell cultures is a more sensitive but slower method for diagnosis of CSF than immunofluorescence on frozen sections. Isolation is best performed in rapidly dividing PK-15 cells seeded on to cover-slips simultaneously with a 2% suspension of the tonsil in growth medium. Other pig cell lines may be used, but should be demonstrably at least as sensitive as PK-15 cells for isolation of CSFV. The cultures are examined for fluorescent foci by FAT after 24-72 hours. The tonsil is the most suitable organ for virus isolation from pigs that died or were killed for diagnostic purposes. Alternatively, spleen, kidney or lymph nodes can be used. Neutralisation tests are performed in cell cultures using a constant-virus/varying-serum method. As CSFV is noncytopathic, any non-neutralised virus must be detected, after multiplication, by an indicator system. The fluorescent antibody virus neutralisation (FAVN) test and the NPLA are the most commonly used techniques. Both tests can be carried out in microtitre plates. The peroxidase system has the advantage that the results can be read by the naked eye. The neutralizing peroxidase-linked antibody ( NPLA ) assay was standardized and compared with the micro-plaque reduction test (PRT) on series of sera from pigs infected with different strains of swine fever virus (SFV) and bovine virus diarrhoea virus (BVDV), swine fever reference sera and field sera. The NPLA system was found to be as sensitive as the PRT, it detected SFV antibody in 17 out of 18 pigs 3 weeks after intranasal exposure and differentiated between antibody against SFV and BVDV. With varying concentrations of SFV parallel lines of neutralization with a slope of about 120 degrees were obtained with sera of different origin. The regression coefficient of approximately -1.74 implies that a 10-fold increase in the virus dose will result in an approximate 3.8-fold decrease in the serum titre. The NPLA assay has a high capacity and has been found to be a great asset in large scale surveys for detection of neutralizing antibody against SFV. 0% (small sample) 0% (small sample) Marker vaccines must be used in combination with an assay that can discriminate between infected and vaccinated pigs. The use of a marker vaccine requires the reliable induction and detection (sensitive and specific) of discriminatory antibody after infection of vaccinated pits. Vaccination of the pig with the E2 subunit vaccine or with Flc11 virus does not induce CSFV specific antibody against the Erns glycoprotein. We have developed an ELISA assay that detects antibody against the Erns glycoprotein of CSFV in infected pigs. The Erns ELISA was found to be less sensitive (75%) than an ELISA for the detection of antibody against the E2 protein (92%) when filed sera collected from CSFV-infected pig hers were investigated. Sera collected from pigs that were vaccinated with an E21 subunit vaccine and challenged with different strains of CSFV were also tested. In this scenario the sensitivity of the Erns ELISA was 85% when sera were tested that had be collected more than 5 weeks after challenge. These results indicate that the Erns ELISA can be used to detect CSF-infected pigs in herds vaccinated with the E2 subunit vaccine if the sample size is adapted to compensate for the lower sensitivity. The high specificity of both ELISAs makes them suitable for screening large pig herds with low levels of false-positive reactions. For rapid diagnosis of CSF in live pigs, antigen-capture enzyme-linked immunosorbent assays (ELISAs) have been developed for screening herds suspected to have been infected recently. The ELISAs are of the double-antibody sandwich type, using monoclonal and/or polyclonal antibodies against a variety of viral proteins in either serum, the blood leukocyte fraction or anticoagulated whole blood (clarified tissue homogenate may be added here as it is a suitable material for ELISA). The technique is relatively simple to perform, does not require tissue culture facilities, is suitable for automation and can provide results within half a day. The disadvantage of being less sensitive than virus isolation, especially in adult pigs and mild or subclinical cases, may be compensated by testing all pigs of the suspect herd showing pyrexia. However, the lowered specificity of these tests should also be taken into consideration. IMPROVED ELISA: The antigenic region (residues 109 to 160) of classical swine fever virus (CSFV) protein Erns and the N-terminal antigenic region (residues 1 to 136) of protein E2 were constructed in the form of a fused, chimeric protein, C21ErnsE2, for use as an enzyme-linked immunosorbent assay (ELISA) antigen for the serodiagnosis of CSFV infection. Tested with 238 negative-field (CSFV-free) sera from Canadian sources, the specificity of the ELISA was determined to be 93.7%. All 20 sera from experimentally infected pigs representing a variety of animals, virus strains, and days postinfection (dpi; range, 7 to 210) were detected as positive (100%). In contrast, an ELISA based on an Erns fragment (Erns(aa 109-160)) or an E2 fragment (E2(aa 1-221)) identified only 18 (90%) of 20 sera from infected pigs as positive, missing two targets collected at 7 dpi. These data suggest that use of the chimeric antigen C21ErnsE2 would improve serodiagnostic sensitivity and allow for the detection of CSFV infection as early as 7 dpi. LIN et al. IMPROVED ELISA - 0% (based on small sample) The use of a panel of three monoclonal antibodies (MAbs), either horseradish peroxidase (HRPO) or FITC-conjugated, or used in conjunction with an anti-mouse conjugate and specifically detecting all field strains of CSFV, vaccine strains of CSFV and ruminant pestiviruses, respectively, would allow an unambiguous differentiation between field and vaccine strains of CSFV on the one hand, and between CSFV and other pestiviruses on the other. A prerequisite is that the MAb against CSFV recognizes all field strains and that the anti-vaccine MAb recognizes all vaccine strains used in the country. No single MAb selectively reacts with all ruminant pestiviruses. The use of an MAb to differentiate a CSF vaccine strain can be omitted in nonvaccination areas. A polyclonal anti-CSF immunoglobulin conjugated to HRPO serves as a positive control. Caution should be exercised when using evidence of a single Mab as sole confirmation of an isolate as CSF. The FAT involves the use of an anti-CSF immunoglobulin prepared from a polyclonal antibody to CSFV that will not distinguish between the antigens of different pestiviruses. Conjugates used for the FAT on cryostat sections or inoculated cell cultures should be prepared from anti-CSFV gamma-globulins raised in specific pathogen free pigs. The working dilution of the conjugates (at least 1/30) should combine a maximum brilliance with a minimum of background. Strains of modified live virus (MLV) vaccine multiply mainly in the regional lymph nodes and in the crypt epithelium of the tonsils. Pigs vaccinated with MLV strains may yield a positive FAT for 2 weeks after vaccination. Rabbit inoculation is used to differentiate between lapinised and field strains of CSFV. In contrast to field strains, lapinised strains given intravenously cause a febrile reaction and induce an immune response in rabbits. Pigs infected with ruminant pestiviruses can give false-positive FAT reactions. Congenital infections with ruminant pestiviruses can cause clinical signs and pathological lesions indistinguishable from those in chronic CSF . Infections by CSFV or ruminant pestiviruses can be differentiated by testing sera from the dam and litter mates, or from other contacts of an FAT-positive piglet, for neutralising antibodies to each virus. Another method of differentiating these viruses is by the inoculation of seronegative piglets with a suspension of suspect material, followed 5 weeks later by virus neutralisation (VN) tests on their sera for the respective antibodies. However, VN tests may take several days, and animal inoculation methods take several weeks. A fluorogenic-probe hydrolysis (TaqMan)-reverse transcriptase PCR assay for classical swine fever virus (CSFV) was developed and evaluated in experimentally infected swine. The assay detected CSFV, representing different phylogenetic groupings, but did not amplify viral RNA from related pestiviruses. The assay met or exceeded the sensitivity (1 to 100 50% tissue culture infective doses per ml) of viral cultures of samples from experimentally infected animals. Viral RNA was detected in nasal and tonsil scraping samples 2 to 4 days prior to the onset of clinical disease. The assay can be performed in 2 h or less, thus providing a rapid method for the diagnosis of classical swine fever. CCCTGGGTGGTCTAAG CATGCCCTCGTCCAC CCTGAGTACAGGACAGTCGTCAGTAGTT Specific oligonucleotide primers and the fluorogenic probe were designed to target a highly conserved region within the 5prime UTR of the CSFV genome (GenBank accession number NC_000294.1) 5.7 (4/69) 0.00 (0/65) Grummer B Grummer B, Fischer S, Depner K, Riebe R, Blome S, Greiser-Wilke I. Dtsch Tierarztl Wochenschr 2006 113 4 138 142 Moennig V Floegel-Niesmann G Greiser-Wilke I Vet J 2003 165 1 11 20 Mayer D Thayer TM Hofmann MA Tratschin JD Virus Res 2003 98 2 105 116 de Smit AJ Bouma A Terpstra C van Oirschot JT Vet Microbiol 1999 67 4 239 249 Kern B Depner KR Letz W Rott M, Thalheim S, Nitschke B, Plagemann R, Liess B Zentralbl Veterinarmed B 1999 46 1 63 67 Stegeman A Elbers A de Smit H Moser H, Smak J, Pluimers F Vet Microbiol 2000 73 2-3 183 196 Fritzemeier J Teuffert J Greiser-Wilke I Staubach C, Schluter H, Moennig V Vet Microbiol 2000 77 1-2 29 41 Mintiens K Deluyker H Laevens H Koenen F, Dewulf J, De Kruif A J Vet Med B Infect Dis Vet Public Health 2001 48 2 143 149 Edwards S Fukusho A Lefevre PC Lipowski A, Pejsak Z, Roehe P, Westergaard J Vet Microbiol 2000 73 2-3 103 119 Paton DJ Greiser-Wilke I Res Vet Sci 2003 75 3 169 178 Edwards S Vet Microbiol 2000 73 2-3 175 181 Risatti GR Callahan JD Nelson WM Borca MV J Clin Microbiol 2003 41 1 500 505 Risatti G Holinka L Lu Z Kutish G, Callahan JD, Nelson WM, Brea Tio E, Borca MV J Clin Microbiol 2005 43 1 468 471 Van Gennip HG Vlot AC Hulst MM De Smit AJ, Moormann RJ J Virol 2004 78 16 8812 8823 Brown C J Vet Med Educ 2003 30 2 112 114 Hietela SK Ardans A J Vet Med Educ 2003 30 2 155 156 Ribbens S Dewulf J Koenen F Laevens H, de Kruif A Vet Q 2004 26 4 146 155 Vilcek S Stadejek T Ballagi-Pordany A Lowings JP, Paton DJ, Belak S Virus Res 1996 43 2 137 147 Moennig V Vet Microbiol 2000 73 2-3 93 102 Schnyder M Stark KD Vanzetti T Salman MD, Thor B, Schleiss W, Griot C Vet Rec 2002 150 4 102 109 Gomez-Villamandos JC Carrasco L Bautista MJ Sierra MA, Quezada M, Hervas J, Chacon Mde L, Ruiz-Villamor E, Salguero FJ, Sonchez-Cordon PJ, Romanini S, Nunez A, Mekonen T, Mendez A, Jover A Dtsch Tierarztl Wochenschr 2003 110 4 165 169 Hofmann MA Brechtbuhl K Stauber N Arch Virol 1994 139(1-2):217-29. 1-2 217 229 Ishikawa K Nagai H Katayama K Tsutsui M, Tanabayashi K, Takeuchi K, Hishiyama M, Saitoh A, Takagi M, Gotoh K, et al Arch Virol 1995 140 8 1385 1391 Turner C Williams SM J Appl Microbiol 2000 Nov 89 5 760 767 de Smit AJ Vet Q 2000 Oct 22 4 182 188 Bouma A de Smit AJ de Kluijver EP Terpstra C, Moormann RJ Vet Microbiol 1999 66 2 101 114 Kasza L Shadduck JA Res Vet Sci 1972 13 1 46 51 Terpstra C Woortmeyer R Dtsch Tierarztl Wochenschr 1990 97 2 77 79 Pirtle EC Woods L Am J Vet Res 1968 29 1 153 164 Maurer R Stettler P Ruggli N Hofmann MA, Tratschin JD Vaccine 2005 23 25 3318 3328 van Oirschot JT Vet Microbiol 2003 96 4 367 384 Lin M Trottier E Clin Diagn Lab Immunol 2005 12 7 877 881 Terpstra C Bloemraad M Vet Microbiol 1984 9 2 113 120 Terpstra C Epizootiology Liess B Classical Swine Fever and Related Viral Infections 1987 201 216 Martinus Nijhoff Publishing Boston, MA, United States Biront P Leunen J Vaccines Liess B Classical Swine Fever and Related Viral Infections 1987 181 200 Martinus Nijhoff Publishing Boston, MA, United States Rusk JS Biosafety Classification of Livestock and Poultry Animal Pathogens Brown C Bolin C Emerging Disease of Animals 2000 13 23 ASM Press Washington DC Animal and Plant Health Inspection Service US Department of Agriculture Classical Swine fever: Still a threat 1999 US Department of Agriculture Washington DC http://www.oie.int/eng/normes/MMANUAL/A_summry.htm World Organisation for Animal Health http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9823 http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=11096 http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=170646 http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=279150 http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=99465 http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=217896 http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=149596 http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=68621 http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=72372 http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=72373 http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=72374 http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=72375 http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=72376 http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=11097 http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=11098 http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=68631 http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=68626 http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=68633 http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=68614 http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=68637 http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=68638 http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=68630