Brucella abortus

Brucellae are Gram-negative, facultative, intracellular bacteria that can infect many species of animals and man.

Brucella belongs to the (alpha) 2 subdivision of the proteobacteria, along with ochrobactrum, rhizobium, rhodobacter, agrobacterium, bartonella, and rickettsia.

Brucellosis is a bacterial disease of animals that can be transmitted to humans. The primary impact of brucellosis stems from losses due to reproductive failure in food animals and the loss of human productivity. Since brucellosis threatens the food supply and causes undulant fever, a long, debilitating disease in humans, Brucella species are recognized as potential agricultural, civilian, and military bioterrorism agents. Brucellosis in food animals is controlled by vaccination. Human brucellosis is treatable with antibiotics, though the course of antibiotic treatment must be prolonged due to the intracellular nature of Brucella.

The genus Brucella consists of at least six species, designated on the basis of host preference, antigenic and biochemical characteristics as Brucella melitensis (goats and sheep), Brucella abortus (cattle), Brucella suis (pigs), Brucella canis (dogs), Brucella ovis (sheep) and Brucella neotomae (wood rats). B. abortus, B. melitensis and B. suis can all infect humans with similar serious disease consequences. Recently, Brucella spp. have been isolated from marine mammals and are infectious for humans. B. melitensis, originally isolated as a pathogen of goats and sheep, is highly pathogenic and a frequent cause of human brucellosis. In contrast, human infections with B. ovis and B. neotomae have not been reported, and human infection with B. canis is rare. Although Brucella species exhibit host preference and virulence restrictions, they are genetically highly related and therefore have been proposed to be included under one species B. melitensis.

Synonyms: Micrococcus melitensis, Streptococcus Miletensis.

Brucella abortus biovar 1 str. 9-941

It was originally isolated from a serologically detected, infected cattle herd in northwestern Wyoming. The isolate was identified as B. abortus biovar 1 by the National Veterinary Services Laboratory based on morphology, bacteriologic characteristics, and phage typing. The isolate is nonmotile, nonhemolytic, A-antigen dominant, catalase positive, oxidase positive, urease positive at 3.5 h, nitrate reduction positive, citrate utilization negative, H2S production positive after 2 days of incubation at 37 C, sensitive to thionin dye (1:25,000), and resistant to basic fuchsin, thionin blue (1:500,000), penicillin, and erythritol.

Synonyms: Brucella abortus biovar 1 strain 9-941

Brucella abortus S19

In 1930, Buck reported encouraging results of a vaccine of medium virulence called Bacterium abortus strain 19 in a few heifers. The isolate was recovered from the milk of a Jersey cow in June 1923 and was virulent. The culture was maintained at room temperature for 1 year of more and, when tested in guinea pigs, had lost its virulence. It was the 19th of the stock culture series isolated by Buck. The outstanding characteristics of B. abortus strain 19 are (1) low stable pathogenicity, (2) relatively high immunogenicity, and (3) antigenicity. The attenuation, cultural, and other biological characteristics of strain 19 are stable and were not altered by several passages through guinea pigs or by intravenous passages through pregnant cattle.

Strain 19 was first used to produce a standardized liquid vaccine in the U.S. in 1939. It was introduced for field usage in 1941, and this usage increased greatly during the that decade. The improvements in lyophilization methods during the next several years resulted in almost all strain 19 vaccine being produced in that form.

Brucella melitensis biovar Abortus 2308

A standard laboratory biovar I strain virulent for humans, cattle, and certain other domestic animals.

Strain RB51 is a spontaneous R mutant selected after repeated in vitro passages of B. abortus 2308 (United States Department of Agriculture challenge strain) on media containing rifampin and penicillin.

0.6 to 1.5 um long by 0.5 to 0.8 um wide

Small Gram-negative cocci, cocobacilli, or short rods.

They occur singly, in pairs, short chains, or small clusters.

Flagella, endospores, and capsules are absent although capsule-like structures have been reported in preparations treated with antiserum.

The Brucella cell envelope consists of an outer layer of lipopolysaccharide-protein about 9 nm thick. The polysaccharide chains are exposed, whereas the lipid components are in close proximity to the peptidoglycan layer which forms the major part of the cell wall.

Brucella can present itself upon culture with either a smooth or rough colony morphology, with some strains presenting a mucoid phenotype.

Coupled to the rough versus smooth morphology is the composition of the LPS molecule of Brucella. Smooth organisms have LPS molecules containing a polysaccharide O-chain made from a homopolymer of perosamine (N-formyl-4-amino,4,6-dideoxy mannose), while rough organisms lack this chain on their LPS molecule or possess only a greatly truncated portion of it.

In addition to the LPS the outer membrane of Brucella contains several major proteins.

Matrix and porin proteins penetrate the peptidoglycan layer at irregular intervals and are partially exposed at the cell surface.

A zone of low electron density, usually identified as the periplasmic space and ranging from 3 to 6 nm in depth in smooth phase cells, up to 30 nm in depth in rough phase cells, separates the peptidoglycan layer from the cell membrane.

The cell membrane has an ultra-structure typical of lipoprotein membranes in general.

Polysaccharide granules and small vacuoles are fairly evenly dispersed throughout the cytoplasm.

The genome is 3.3 Mb and is composed of two circular chromosomes of 2,124,242 (Chr I) and 1,162,780 bp (Chr II).

The two chromosomes of brucellae differ in important ways. The origin of replication of the large chromosome (Chr I) is typical of bacterial chromosomes, while that of the small chromosome (Chr II) is plasmid like. Further, most of the essential genes are located on Chr I. The G+C content of the two chromosomes is nearly identical, consistent with the assertion that the assimilation and stabilization of a plasmid was an ancient event in brucellae.

2,124,241 nt

2200 genes, 2030 protein coding, 47 structural RNA, 123 pseudo genes, 18 others

1,162,204 nt

1156 genes, 1055 protein coding, 17 structural RNA, 84 pseudo genes, 7 others

The genome of B. abortus strain 2308 consists of two circular chromosomes, ChrI (2,121,359 bp) and ChrII (1,156,950 bp), coding for 2,280 and 1,214 annotated open reading frames, respectively.

Although the global characteristics of the B. abortus 2308 genome are quite similar to the recently published sequence of the field isolate of B. abortus, a number of strain-specific deletions and polymorphisms were identified.

2,121,359 nt

2236 genes, 2000 protein coding, 50 structural RNA, 186 pseudo genes, 190 others

1156948 bp

1182 genes, 1034 protein coding, 18 structural RNA, 130 pseudo genes, 136 others

While some countries have eliminated or substantially reduced the disease by extensive eradication programs it remains endemic in many areas of the world.

No accurate overall estimate can be made of the prevalence of brucellosis worldwide, because adequate information on the occurrence of the disease in man and animals is not available for many countries, either because of lack of facilities for diagnosis and reporting, or in some instances because of reluctance of governmental authorities to disclose details. In addition, many cases of brucellosis in man are mild or present with atypical clinical manifestations that are not diagnosed correctly.

Areas currently considered to have high brucellosis prevalence areas are the Middle East, the Mediterranean Basin (Portugal, Spain, Italy, Greece, Turkey, Near East, North Africa), South and Central America, South Eastern Europe, Asia, Africa, and the Caribbean.

Mexico remains one of the most important reservoirs of human brucellosis.

Animal brucellosis exists throughout Central America but human disease is not endemic.

South America has been traditionally considered an endemic area of human brucellosis, B melitensis being prevalent in Peru and west Argentina, and B abortus in east Argentina and other South American countries.

Until the 1960s, most human cases in the USA were attributed to Brucella abortus, reaching a high of 6321 cases in 1947. A massive eradication campaign resulted in the elimination of cattle brucellosis and a substantial decline in the incidence of human disease.

In the USA, the only known focus of B. abortus infection left is in bison (50% of the animals tested positive) and elk in the Greater Yellowstone Area. These foci of infections have a very strong impact on the cattle industry in the region. Indeed, spill over from wildlife to cattle is regularly reported around these natural parks.

Brucellosis-free status has been granted by the European Union (EU) to Sweden, Denmark, Finland, Germany, the UK (excluding Northern Ireland), Austria, Netherlands, Belgium, and Luxembourg. Norway and Switzerland are also considered brucellosis-free countries.

A B abortus epidemic has been evolving since 1998 in Northern Ireland, with 89 cases in total.

The Mediterranean basin is an acknowledged endemic region of human brucellosis. The disease was initially described in Malta, where sporadic cases are noted nowadays.

France is an example of successful eradication.

Although massive progress has been achieved in minimising human disease in Spain, the country still has one of the highest annual incidences in Europe.

Portugal has achieved pronounced progress in minimising human brucellosis.

In Italy, human brucellosis has travelled to the south, something explained by socioeconomic factors; the schism of Italy to the rich north and the poor south is nowhere more pronounced than in the incidence of human brucellosis.

Greece remains in the list of the 25 countries with the highest incidence worldwide.

Apart from Greece, two other countries in the Balkan peninsula have the highest disease incidence in Europe. In the Former Yugoslav Republic of Macedonia, human brucellosis is almost an epidemic, although the annual incidence is gradually decreasing. The incidence is also high in Albania, where a substantial degree of under-reporting exists due to inadequate health networks and patient migration to Greece.

Brucellosis is not endemic in eastern Europe. Characteristically in Poland, the disease is limited to veterinarians or is imported from Mediterranean countries. Brucellosis in Russia nowadays is mainly a disease of the Caucasian districts - eg, Dagestan, where the annual incidence exceeds 100 cases per million of population - and districts neighbouring republics of the former Soviet Union with a high incidence of brucellosis. However, substantial under-reporting may also exist.

The middle east has traditionally been considered as an endemic area. Indeed, five of the ten countries with the highest incidence for human brucellosis are in this area. Syria has the highest annual incidence worldwide, reaching an alarming 1603 cases per million per year according to data from OIE.

Seven republics of the former Soviet Union are included in the 25 countries with the highest incidence of the disease worldwide, while another country of this region, Mongolia, is ranked second.

These countries have emerged as the most important loci of human brucellosis worldwide in recent years, and the seemingly uncontrollable, constantly increasing incidence poses a serious public-health problem, especially in the context of inadequately developed health-care networks.

North Africa has been traditionally considered endemic for brucellosis.

Brucellosis exists throughout sub-Saharan Africa, but essentially nothing is known about its prevalence.

KOREA: Recently, there was a report of an outbreak of human brucellosis among livestock workers and veterinarians in rural area around Jeongeup City, Jeollabuk-Do, Korea, from February 2003 to August 2003.

A total of eleven cases were identified at the local outbreak.

Although brucellosis has mainly been a problem of veterinarians for past five decades, this local sporadic outbreak demonstrated that Brucella abortus biotype 1 in humans has emerged as an important public health problem in ROK (Republic of Korea).

SPAIN: Outbreaks of varying sizes, with different transmission mechanisms and sources of infection nevertheless occur frequently. Outbreaks arise on livestock farms, often involving small numbers of patients. These may be due to direct contact with infected animals or inhalation of bacteria from animal matter while cleaning stables. They may also occur through consumption of unpasteurised farmhouse homemade cheese made from raw milk. There have also been major outbreaks caused by consumption of so-called 'semi-artisan' cheese that is sold in markets. There is also a risk to those working in abattoirs where animals testing positive are sent for slaughter. A total of 143 outbreaks involving almost 1000 human cases were reported from 1999 to 2003.

ITALY: We report on an outbreak of brucellosis in the Experimental Microbiology Laboratory of the Institute of Microbiology and Virology of the University of Sassari, Italy, after an accidental exposure to a laboratory strain of Brucella abortus. Between November 1990 and March 1991, a total of 12 people working at different locations in the laboratory developed acute brucellosis, with an attack rate of 31%. The outbreak originated from the accidental rupture of a polystyrene centrifuge tube containing live microorganisms during transfer of the tube from one room to another. The source of infection was a B. abortus biotype 1 atypical strain previously isolated from a camel.

AUSTRALIA: During the period October 1979 to May 1980, 22 cases of acute brucellosis occurred at a South Australian abattoir.

All infected men had been employed in a particular part of the works. There was a possibility of movement of aerosols, produced on opening the uteri of pregnant cattle, to other parts of the works, putting a larger number of workers at risk of infection. Modifications to the plant greatly reduced the spread of aerosols. No cases of human brucellosis were recorded at this abattoir during the summer of 1980-81.

Animal Human

Brucellosis is a zoonosis that is nearly always transmitted from animal reservoirs directly to man via three routes: (1) direct contact through the conjunctivae, or through abraded or broken skin with excretions, secretions, or tissues of infected animals or contaminated fomites; (2) inhalation of infectious aerosols with invasion occurring through the mucosa of the upper respiratory tract or the lung; and (3) ingestion of tissues, foodstuff, or fluids containing organisms.

Infection may also result from the entry of the bacteria from diseased animals through skin lesions or mucous membranes or from inhalation of contaminated dust or aerosols. Inhalation is often responsible for a significant percentage of cases in abattoir employees. Contamination of skin wounds may be a problem for persons working in slaughterhouses or meat packing plants or for veterinarians.

Brucella spp. persist for several days in milk (even when it turns sour). It may also persist for weeks in ice cream and months in butter.

Therefore, these products always have to be made from pasteurized milk.

Sale of improperly prepared cheese and other dairy products by commercial vendors results in additional cases in urban populations in many countries and in travelers who visit areas where brucellosis is endemic.

Meat of animals with brucellosis may also be a source of infection if eaten when insufficiently cooked. Some particular food habits, such as eating aborted foetuses as seen in Ecuador, may be responsible for human brucellosis.

Animal Animal

The exposure of cattle to B. abortus is the genesis of the transmission process.

In most circumstances the primary escape route of B. abortus is the uterine fluid and placenta expelled by infected cows when they abort or have a full-term parturition. The risk posed to susceptible animals following parturition of infected cattle depends on three factors: the number of Brucella excreted, the survival of these organisms under the prevailing environmental conditions, and the probability of susceptible animals being exposed to enough organisms to establish infection.

The potential for bulls to transmit infection to cows depends on the method of insemination employed. When used for natural mating, the risk of infected bulls transmitting the disease to susceptible cows is considered negligible. However, when used as semen donors for artificial insemination, there is a considerable risk of inseminated cows becoming infected.

It has been suggested that the conjunctival route is important in intensively housed cattle and the oral route is important under range conditions.

Congenital infection is of major epidemiological significance. As high as 20% of heifer calves born to infected cows are persistently infected with Brucella.

Human Human

Human brucellosis is not considered a contagious disease.

Human-to-human transmission by tissue transplantation or sexual contact have occasionally been reported but are, in epidemiological terms, insignificant.

An asymptomatic donor infected with Brucella was shown to be the likely source of infection of a recipient of bone marrow cells. Transmission by shared needles and coitus have been suggested but not proven.

Infection in man is a dead-end process and further transmission to other persons or to other host species occurs so rarely that it can make no contribution to the natural history of the disease.

Cattle are the natural or primary host for B. abortus. Of 266 isolations identified to a source, 241 (90.6%) were from cattle. Of 1722 isolations in France, 1683 (97.7%) were from cattle. Also, 395 (84.8%) of 466 B. abortus cultures in a third survey were from cattle. These data support the belief that cattle (especially female cattle) are primarily responsible for maintaining B. abortus infection.

Typically, brucellosis in domestic animals is viewed as a chronic infectious disease which usually persists for the life of the animal.

As with any infectious disease, the initiation of brucella infections is dependent on the dose and virulence of the bacteria and the relative resistance and susceptibility of the host as determined by both innate and acquired immunity.

Experimental studies involving challenge infections with a variety of strains and dose levels of B. abortus have clearly indicated that within the general population of cattle a significant proportion of individual animals are innately resistant to infection. The host defense mechanism responsible for such resistance and the mode of its inheritance are not fully understood.

Brucella abortus has been isolated from at least nine species of domestic livestock: the cow, horse, pig, sheep, goat, Bactrian camel, dromedary camel, water buffalo, and yak.

While domestic equidae are susceptible to infection with B. abortus, there is little evidence to suggest that they have a significant role in the epidemiology of the disease. In infected horses Brucella tend to localize in the bursae, tendons, muscles, and joints rather than the tissues of the reproductive tract.

The evidence for excretion of the organism to an extent capable of transmitting the disease to other species, including man, is flimsy. A recent study failed to provide any evidence of excretion of B. abortus in horses infected experimentally.

Pigs are not a significant source of B. abortus infection for man; however, they are susceptible to infection, which is usually transient but can be accompanied by excretion of the organism without sero-conversion.

Infection of dogs with B. abortus has been recorded. A serological survey of 216 dogs on 18 dairy farms in Chile revealed that 44% of dogs on 16 farms with bovine brucellosis had positive brucellosis titers; 1 of 18 (6%) of dogs had a positive reaction on a farm from which the disease had been eliminated 1 year previously; and on a farm with no history of bovine brucellosis, all 12 dogs were negative.

Dogs may constitute a greater risk of transmitting the disease to man, as severe infections accompanied by heavy excretion of the organism have been recorded.

Bison and a limited population of elk are considered an active biological reservoir in the U.S.

Over 30 serologic and bacteriologic surveys in the U.S. for brucellosis in white-tailed and mule deer have been published. Relatively few have found any positive results.

The axis deer has been shown to be susceptible to B. abortus infections under experimental conditions. The prevalence of brucellosis in free-ranging populations of axis deer in Texas is unknown.

Little is actually known about brucellosis in moose. There have only been four cases reported in the literature.

The latest report of brucellosis in African buffalo was by Waghela and Karstad, who reported that 30% of the buffalo tested from the Masai Mara area of Kenya had detectable Brucella antibody levels.

Brucellosis is a problem in some populations of Asian buffalo (Bubalis bubalis).

There are several studies in the literature that document the presence of at least serologic evidence of brucellosis in wild canids from most continents.

While Brucella abortus has been isolated from rodents on occasion, most rodent infections seem to be from areas were there are a large number of infected cattle.

One should not overstate the issue of wildlife brucellosis. The preponderance of known Brucella infections is still in domestic livestock.

Brucella has traditionally been considered a biological weapon. It was the subject of extensive offensive research in the past, and still belongs to category B pathogens on most lists.

Its significance as a potential agent of bioterrorism was acknowledged early, and the pathogen remains on the category B biodefense research list of both the Centers for Disease Control and Prevention (CDC) and the National Institute of Allergy and Infectious Diseases (NIAID).

Brucella was one of the agents with which Japan experimented in the infamous 731 Manchurian Unit before and during World War II.

In the former Soviet Union, Brucella was one of the agents developed for offensive purposes by Biopreparat, the extensive Soviet biological weapons program.

As with other agents developed by the Soviet Union, extended field testing was performed on the island of Vozroshdeniye, in the midst of the Aral Sea.

Immediately notify state public health laboratory director (or designate) and state public health department epidemiologist/health officer if Brucella cannot be ruled out and a bioterrorist event is suspected. The state public health laboratory/state public health department will notify local FBI agents as appropriate.

Brucella can be easily aerosolized, and when in air, can be easily transmitted through the airways and induce disease, while staying for a protracted period in this virulent form.

In a hypothetical attack scenario, it was estimated that release of an aerosolized form of brucella under optimal circumstances for dispersion would cause 82,500 cases of brucellosis and 413 fatalities.

Using Brucella as a biological weapon through the food chain could be feasible, but would result in localized clusters of cases: one would have to intervene at a post-industrial level, since pasteurization kills the pathogen.

Because of ethical considerations, the heterogeneous nature of the events leading to Brucella exposure, difficulties in determining the actual risk for individual workers, late recognition of outbreaks, and the small number of persons involved in each outbreak, no controlled studies have been performed to assess the value of administering post exposure prophylaxis to persons at risk. However, anecdotal evidence suggests that administering prophylactic antimicrobial drug therapy may reduce the risk of developing clinical disease.

Isolation of patients is not necessary.

Human

Homo sapiens

World-wide, most cases of human brucellosis are caused by B. melitensis which is considered the most invasive and pathogenic of the three classical species of the genus. Brucella suis is also highly pathogenic and frequently causes serious complications such as deep tissue abscesses. Infections in man from B. abortus are often less serious, and B. canis is considered the lease invasive for man of these four species.

It has been estimated that 10-100 organisms only are sufficient to constitute an infectious aerosol dose for humans.

Humans acquire the infection by direct contact with diseased animals or through ingestion of dairy products prepared from the milk of infected animals. Persons of all ages are susceptible to brucellosis, but most patients in the U.S. are between 20 and 60 years, compatible with the age of the work force. A common route of transmission is through the skin via minor cuts and abrasions, and there is no evidence to suggest that Brucella can penetrate unbroken skin. Infected aerosols can also enter via the conjunctivae or through the respiratory tract. The mucosa of the gastrointestinal tract is another portal of entry and raising the pH of gastric juice with antacids or histamine blocking drugs appears to increase susceptibility to oral infection. In some cases the clinical manifestations may relate to the route of infection, such as pneumonia from aerosol inhalation or gastrointestinal complications from ingestion of contaminated food. Human to human transmission is extremely rare, if it occurs at all. Unusual cases have been traced to transfusions of blood or bone marrow cells from infected but asymptomatic donors.

As a general rule, prevention of human brucellosis depends predominantly on the control of the disease in animals.

It may also be assisted through personal hygiene, environmental sanitation, pasteurization of dairy products, and health education.

There is currently no authorised [sic] human Brucella vaccine in the European Union or the US. There is some limited clinical data on a live, attenuated vaccine-candidate strain from the former Soviet Union and China.

An intradermally administered vaccine derived from B. abortus 19 strain has been used extensively in the Asian Republics of the former Soviet Union, causing a 5-11 fold reduction in the annually reported cases of human brucellosis.

The vaccine offers limited protection of short duration and requires booster doses.

An increased number of hypersensitivity reactions were reported, with 76% local reactions and 3-7% generalized adverse effects.

Due to the frequency of adverse events and the short duration of immunity, it seems that it is no longer used.

Strains of B. abortus 104M have been used in China. A phenol-insoluble peptidoglycan fraction of B. melitensis strain M15 was used in France.

Sub-unit vaccine candidates have also been studied but evidence of efficacy is inconclusive. The potential to develop human Brucella vaccine is limited by the small market potential, which will probably restrict development efforts to national defense agencies only.

Brucella infection occurs through inhalation or ingestion of organisms via the nasal, oral, and pharyngeal cavities. Following penetration of the mucosal epithelium, the bacteria are transported, either free or within phagocytic cells, to the regional lymph nodes.

The spread and multiplication of Brucella in lymph nodes, spleen, liver, bone marrow, mammary glands, and sex organs occurs via macrophages.

Brucella organisms not only resist killing by neutrophils following phagocytosis but also replicate inside macrophages and nonprofessional phagocytes.

They reside in specialized compartments with acidic environments, and multiply using parts of the cytoskeleton, without interrupting cell cycle and function; on the contrary they are apoptosis inhibitors, thus creating a frame for eternal survival and replication.

Survival in macrophages is considered to be responsible for the establishment of chronic infections, allowing the bacteria to escape the extracellular mechanisms of host defense such as complement and antibodies.

After replication, brucellae are released with the help of hemolysins and induced cell necrosis.

The host reacts to this infection with innate and adaptive immune responses. Critical aspects in this response include secretion of IL-12 and IFN-alpha involving APCs and Th1 cells. MHCclass I-restricted CTLs are generated and are required to clear the infection.

Interferon-gamma has a central role in the pathogenesis of brucellosis by activating macrophages, producing reactive oxygen species and nitrogen intermediates; by inducing apoptosis, enhancing cell differentiation and cytokine production; by converting immunoglobulin G to immunoglobulin G2a; and by increasing the expression of antigen-presenting molecules.

It has been long postulated that the outcome of the disease reflects the equilibrium developed between the bacterium and the human immune response, and that relapses and chronic disease should also be viewed in this context.

VIRULENCE FACTORS: The recent availability of genetic techniques to manipulate the Brucella genome permits identification of virulence factors of Brucella at the molecular level.

Example1: Lipopolysaccharide -- Brucella has two forms, smooth and rough. In general, rough strains, containing less or no O polysaccharide (OPS), are less virulent than smooth strains and less resistant to complement attack.

Example2: bacA -- A highly conserved B. abortus homologue of the R. meliloti bacA gene, which encodes a putative cytoplasmic membrane transport protein required for symbiosis, was identified.

Example3: bvrR-bvrS -- The B. abortus two-component regulatory system consisting of the Brucella virulence-related regulatory (BvrR) and sensory (BvrS) proteins is highly similar to the two-component regulatory systems ChvG-ChvI of A. tumefaciens and ExoS-ChvI of R. meliloti, which are equivalent to Salmonella PhoP-PhoQ and Bordetella bronchiseptica BvgA-BvgS systems.

BvrS/BvrR codes for a histidine kinase sensor and controls the expression of molecular determinants necessary for cell invasion.

Example4: virB -- The B. abortus S2308 genome project confirmed the intact virB operon. The A. tumefaciens virB operon encodes a pilus-like structure necessary for secretion of transfer DNA, and the B. pertussis ptl operon encodes the apparatus that allows the secretion of pertussis toxin, suggesting that Brucella may secrete regulatory DNA or protein for intracellular survival.

The incubation period of brucellosis is highly variable, from one to 60 days, up to several months, with an average of 1-2 months.

The case fatality rate is very low in untreated patients (less than 2%). It is usually due to B. melitensis endocarditis or meningitis. Nearly all patients respond to antibiotic treatment, with fewer than 10% manifesting relapses. The systemic symptoms may last for weeks or months. Most of the patients recover within a year, even without antibiotic treatment.

Signs and symptoms are similar in patients whatever the route of transmission and are mostly non-specific.

Physical examination is usually without abnormalities.

The illness may be mild and self-limited or severe. Onset of the disease may be abrupt or insidious (50%).

Brucellosis is a systemic infection that can involve any organ or organ system. It is generally characterised by fever, which may be continuous, intermittent or irregular.

Fever, which is the most common symptom, may be associated with other symptoms such as weakness, profuse sweating chills, diffuse or localised arthralgias, malaise, weight loss and generalised pain.

Fever is invariable and can be spiking and accompanied by rigors, if bacteremia is present, or may be relapsing, mild, or protracted.

Fever: 91%; Constitutive symptoms (e.g., malaise, arthralgias): 26%.

Sweating: 40-90%; Weight loss and generalised pain: 40-70%.

Endocarditis remains the principal cause of mortality in the course of brucellosis. It usually involves the aortic valve and typically requires immediate surgical valve replacement.

Other cardiovascular complications include myocarditis, pericarditis and aneurysms of the aorta and cerebral vessels.

Endocarditis occurs in approximately 2% of patients.

Cutaneous manifestations may include ulcerations, petechiae, purpura, and erythema nodosum.

Rashes: 3%.

Gastrointestinal symptoms such as anorexia, nausea, vomiting, abdominal pain, diarrhoea or constipation are also frequent.

Up to 70% of cases.

Haematological abnormalities may include anaemia, neutropenia and thrombocytopenia.

The blood count is often characterized by mild leukopenia and relative lymphocytosis, along with mild anemia and thrombocytopenia. Pancytopenia in brucellosis is multifactorial and is attributed to hypersplenism and bone marrow involvement. Rarely, marked pancytopenia or isolated deficits can be attributed to diffuse intravascular coagulation, hemophagocytosis, or immunologically mediated cellular destruction.

Relative lymphocytosis: 40%; Isolated thrombocytopenia: 5%; Isolated leukopenia: 2%; Pancytopenia: 2%.

The liver is involved in the great majority of cases as shown by a mild increase of liver function enzymes.

Non-caseating epithelioid granulomas indistinguishable from the ones seen in sarcoidosis can be found in liver biopsy. Hepatic abscesses and acute cholecystitis have also been reported.

Hepatitis is common, usually manifesting as mild transaminasemia.

Ascites is often present, either as a temporary exacerbation of preexisting hepatic disease or as frank peritonitis.

In brucellosis, routine laboratory tests are commonly non-specific: mild elevation of serum lactate dehydrogenase and alkaline phosphatase.

Hepatomegaly: 17%; Transaminasemia: 24%.

The clinical presentation of neurobrucellosis includes meningoencephalitis, meningovascular involvement, parenchymatous dysfunction, peripheral neuropathy/radiculopathy (PNP), and various degrees of behavioral abnormalities. Among the clinical manifestations, meningitis has been the most frequent presentation in clinical series and usually presents in an acute or chronic form.

Severe behavioural changes of unknown aetiology occur in some patients.

Neuropsychiatric complaints, which include headache, depression and irritability, are frequent.

Neurologic manifestations of brucellosis occur in 3-5% of patients.

Osteoarticular complications of brucellosis are common and include sacroileitis, which represents the most frequently involved joint, peripheral joint arthritis, bursitis, osteomyelitis and particularly vertebral osteomyelitis or spondylitis. Arthritis of peripheral joints usually involves large joints such as the hips, knees and ankles. Osteoarticular complications are usually due to B. melitensis.

Brucellosis has also been proposed as a cause of reactive arthritis. A second form, characterized by sacroiliitis, is readily diagnosed, also usually in the context of acute brucellosis. On the other hand, a third form of osteoarticular disease, spondylitis, remains notoriously difficult to treat and often seems to result in residual damage. The lumbar spine is the usual site of involvement. Spondylitis can be easily diagnosed with plain radiography, in which the characteristic Pons sign (a steplike erosion of the anterosuperior vertebral margin) can be identified, or with scintigraphy and magnetic resonance imaging. The latter imaging technique is popular and produces impressive scans but is costly and not always available. Osteoarticular complications are sometimes linked to a genetic predisposition, with recent data suggesting an association with HLA-B39.

Up to 40% of cases.

Spondylitis: 6%.

Peripheral arthritis: 22% (8% in hips, 7% in knees, 4% in elbows, 4% in wrists, 4% in other locations); Sacroiliitis: 3%; Spondylitis: 19% (15% lumbar, 3% dorsal, 1% cervical).

The reproductive system is the second most common site of focal brucellosis. Brucellosis can present as epididymoorchitis in men and is often difficult to differentiate from other local disease. The effect of the local inflammation on subsequent testicular function has not been adequately studied. Brucellosis in pregnancy poses a substantial risk of spontaneous abortion.

Epididymoorchitis: 5.7%.

Cough and chest pain are present in 15%-25% of infected patients with a normal chest radiograph. Lung abscesses, nodules and pleural effusions have been reported.

Respiratory complications of brucellosis are considered rare. A recent multinational review of cases with respiratory complications indicated that approximately 16 percent of cases had pulmonary involvement that included lobar pneumonia and pleural effusions.

In countries where brucellosis is enzootic (i.e. present in animal reservoirs), human confirmed cases are based on clinical symptoms associated with positive serology without attempts to isolate Brucella spp., in the vast majority of suspected or confirmed cases. In countries where animal brucellosis has virtually been eradicated, for every single suspected case of human brucellosis, particularly in the presence of positive serology, the emphasis is put on the epidemiological inquiry in order to confirm the case.

Diagnosis: Demonstration of a specific antibody response (>160 or 4-fold rise between acute and convalescent phase); Demonstration by immunofluorescence of Brucella sp. in a clinical specimen; Isolation of Brucella sp. from a clinical specimen.

The World Health Organization (WHO) endorses regimens that combine doxycycline, 100 mg b.i.d., and rifampin, 600-1200 mg daily, for 6 weeks, or doxycycline for 6 weeks and streptomycin, 15 mg/kg daily, for 2-3 weeks. The latter combination is considered superior, but demands parenteral administration. Gentamicin can adequately replace streptomycin, at a dose of 5 mg/kg for 5-7 days. Alternatives include trimethoprim-sulfamethoxazole in various combinations, and combinations including ofloxacin or ciprofloxacin. Quinolone-containing regimens are generally adequate, but cost-effectiveness and the possibility of community resistance are issues to be considered. Triple or quadruple protracted regimens should be used in serious complications, in conjunction with invasive procedures, as indicated. Rifampicin and trimethoprim-sulfamethoxazole are the mainstays of treatment in pregnancy and pediatric populations, respectively.

Doxycyclin -- Minimum inhibitory concentration: 0.06-1ug/ml; Dose -- 100 mg twice daily for 6 wk.

Tetracyclines (doxycycline, tetracycline hydrochloride) generally are considered the drugs of choice for brucellosis. Limited data suggest that combined anti-infective therapy may reduce the likelihood of disease relapse, and some clinicians recommend that another anti-infective (e.g., streptomycin or gentamicin and/or rifampin) be used in conjunction with a tetracycline for the treatment of brucellosis. For treatment of serious brucellosis or when there are complications, including endocarditis, meningitis, or osteomyelitis, some clinicians recommend that an aminoglycoside (streptomycin or gentamicin) be used concomitantly with the tetracycline for the first 7-14 days of therapy; rifampin can also be used in the regimen to reduce the rate of relapse.

Tetracyclines are contraindicated in patients hypersensitive to any of the tetracyclines.

Tetracyclines should not be used in children younger than 8 years of age unless other appropriate drugs are ineffective or are contraindicated.

Doxycycline is contraindicated in nursing women.

Adverse effects reported in 6% or more of patients receiving doxycycline hyclate tablets (containing 20 mg of doxycycline) include headache, common cold, flu symptoms, toothache or tooth disorder, GI symptoms (diarrhea, nausea, dyspepsia), and joint pain.

Use of tetracylcines may result in overgrowth of nonsusceptible organisms, including fungi.

Tetracyclines are among the most potent antibiotics against Brucella, and they have the advantages of oral administration and low toxicity.

Tetracyclines generally are active in vitro and in vivo against the following gram-negative bacteria: Brucella.

Rifampin is the mainstay of treatment in cases of brucellosis during pregnancy, in various combinations.

Rifampin -- Minimum inhibitory concentration: 0.1-2 ug/ml; Dose: 600-1200 mg/day for 6 wk.

Rifampin is used as an adjunct to other anti-infective agents for the treatment of brucellosis. Tetracyclines generally are considered the drugs of choice for the treatment of brucellosis; however, concomitant use of another anti-infective (e.g., streptomycin or gentamicin and/or rifampin) may reduce the likelihood of disease relapse and usually is recommended in serious infections or when there are complications such as meningitis, endocarditis, or osteomyelitis.

Rifampin is contraindicated in patients with a history of hypersensitivity to the drug or any of the rifamycins.

Because rifampin used alone or in conjunction with other drugs has been associated with adverse hepatic effects (e.g., severe liver injury) and adverse hematologic effects, liver function (hepatic enzymes, bilirubin) and hematologic status (complete blood cell and platelet counts) should be assessed prior to initiation of rifampin therapy.

Another consideration in the use of rifampin is its interaction with other drugs. Rifampin is known to accelerate the metabolism of a variety of drugs, including anticoagulants and digitalis, through the induction of hepatic microsomal enzymes.

Unfortunately, the relapse rate in patients treated with rifampin alone was unacceptable high, and for this reason it was recommended that it was best used in combination with other anti-brucella drugs. In some studies the combination of rifampin-doxycycline was comparable to treatment with tetracycline-streptomycin, with a relapse rate of < 5%. In contrast, others reported a relapse rate with rifampin-doxycycline as high as 38.8%.

Rifampin resistance does not appear to be a major cause of relapse in human brucellosis, since it was shown that the antibiotic susceptibility of Brucella strains recovered from patients in relapse were not different from those recovered before therapy was begun. Nevertheless, rifampin resistance among Brucella strains remains a concern. Corbel reported that rifampin-resistant variants occur in vitro, and recently a rifampin-resistant strain of B. melitensis was recovered during relapse from a patient who had been treated for 6 weeks with rifampin-doxycycline.

The use of rifampin in areas in which brucellosis is endemic, where tuberculosis is also usually endemic, raises concern about the development of community resistance to rifampin.

Streptomycin -- Minimum inhibitory concentration: 0.25-16 ug/ml; Dose: 15 mg/kg of body weight intramuscularly for 2-3 wk.

Streptomycin is used in the treatment of brucellosis. Tetracyclines generally are considered the drugs of choice for the treatment of brucellosis; however, concomitant use of another anti-infective (e.g., streptomycin or gentamicin and/or rifampin) may reduce the likelihood of disease relapse and usually is recommended in serious infections or when there are complications such as meningitis, endocarditis, or osteomyelitis. Some experts recommend a 3-drug regimen that includes a tetracycline, an aminoglycoside, and rifampin for the treatment of brucellosis in patients with meningoencephalitis or endocarditis. Although data are limited, alternative regimens that have been suggested for the treatment of brucellosis include co-trimoxazole with or without gentamicin (or streptomycin) or rifampin; ciprofloxacin (or ofloxacin) and rifampin; and chloramphenicol with or without streptomycin.

A specific aminoglycoside preparation is contraindicated in patients with a history of hypersensitivity to that preparation or any ingredient in the formulation.

Aminoglycosides should be used during pregnancy only in life-threatening situations or severe infections for which safer drugs cannot be used or are ineffective.

The major adverse effect of streptomycin therapy is vestibular dysfunction, which is especially common in the elderly.

Parenteral administration of streptomycin mandates either hospital admission or the existence of an adequate health care network - both of which are often absent in areas of endemic disease.

Used alone, streptomycin is less effective than tetracycline, but in combination with other agents appears to lessen the rate of relapse.

When used alone, both streptomycin and tetracycline are reported to have a high rate of clinical relapse.

The drug is administered by mouth and is preferred over tetracycline for children and pregnant women with brucellosis.

Trimethoprim-sulfamethoxazole -- Minimum inhibitory concentration: 0.38-8 ug/ml; Dose: 960 mg twice daily for 6 wk.

Oral co-trimoxazole is considered an alternative to tetracyclines for the treatment of brucellosis when tetracyclines are contraindicated, including brucellosis in pediatric patients. To decrease the incidence of relapse, many clinicians recommend that rifampin be used in conjunction with co-trimoxazole or a tetracycline. For treatment of serious brucellosis or when there are complications, including endocarditis, meningitis, or osteomyleitis, some clinicians recommend that an aminoglycoside (streptomycin or gentamicin) be used concomitantly with co-trimoxazole or a tetracycline for the first 7-14 days of therapy; rifampin can also be included in the regimen to reduce the risk of relapse.

Co-trimoxazole is contraindicated in patients with known hypersensitivity to trimethoprim or sulfonamides, with marked hepatic damage or severe renal impairment when renal function status cannot be monitored, or with documented megaloblastic anemia secondary to folate deficiency.

The manufacturers of co-trimoxazole recommend that the drug not be used in infants younger than 2 months of age.

The most frequent adverse effects of co-trimoxazole are adverse GI effects (nausea, vomiting, anorexia) and sensitivity skin reactions (e.g., rash, urticaria), each reportedly occurring in about 3.5% of patients.

Hypersensitivity and hematologic reactions are the most serious adverse effects of co-trimoxazole, reportedly occurring in less than 0.5% of patients.

When used in a fixed combination (80 mg TMP/400mg SMZ), the drug has proved highly effective in treating brucellosis.

Some authors have reported a relapse rate of approximately 40%, even when the drug was used for 45 days, however, this finding has not been universal, especially in children, where the success rate is high.

Ofloxacin -- Minimum inhibitory concentration: 0.1-2 ug/ml; Dose - 400 mg twice daily for 6 wk.

Ofloxacin has been used alone in a limited number of patients for the treatment of brucellosis caused by Brucella canis, B. abortus, or B. melitensis.

For the treatment of brucellosis, a 6-week regimen of oral ofloxacin in a dosage of 400 mg once daily in conjunction with oral rifampin (600 mg once daily) has been effective in some patients.

Ofloxacin is contraindicated in patients with a history of hypersensitivity to the drug or to other quinolones.

Safety and efficacy of ofloxacin in children younger than 18 years of age have not been established.

There are no adequate and controlled studies to date using ofloxacin in pregnant women.

As with other anti-infectives, use of ofloxacin may result in overgrowth of nonsusceptible organisms, especially enterococci or Candida. Resistant strains of some organisms (e.g. Pseudomonas aeruginosa, staphylococci) have developed during ofloxacin therapy.

Relapse has occurred occasionally following initial apparent response, and more study is needed to evaluate efficacy of the drug in the treatment of brucellosis.

Chronic brucellosis remains an enigma, and even the definition of this clinical syndrome is controversial.

Many patients who have had brucellosis describe occasional recurrences of symptoms similar to those they experienced while acutely ill; however, since the symptoms of brucellosis are nonspecific, it is often difficult to ascertain the cause.

Some investigators have suggested that chronic brucellosis results from cellular immune dysfunction, however there is little evidence to support this hypothesis. In fact, the contrary may be the case, since it is reported that Brucella is comparable to BCG in its ability to stimulate cellular immunity, and B. abortus strain 19 vaccine has been used to enhance resistance to neoplasms in experimental animals and humans. Nevertheless, some investigators have administered immunostimulant drugs, such as levamisole, to animals and humans to restore in vitro lymphocyte defects. Levamisole is the optical isomer of the anthelminthic drug tetramisole, which is reported to have immunostimulant properties. Several uncontrolled studies have claimed benefit from using levamisole to treat brucellosis in humans.

This stable variant, termed strain 19, has been used extensively to immunize cattle against infection with virulent B. abortus. While strain 19 may also be less virulent for humans, a number of well-documented cases of human illness have been reported following accidental inoculation with the live bacterial strain.

Guinea Pig (Cavia porcellus)

Brucella abortus

Studies using guinea pigs to determine virulence of recently isolated brucella strains are almost as old as records of documenting brucella itself. Guinea pigs are probably the animals that are most susceptible to brucella infection. As few as 11 cells of some brucella strains are sufficient to cause infection.

All brucellae, with exceptions such as B. ovis, were pathogenic for guinea pigs. Lesions were consistently recorded in the liver, spleen, lungs, and lymph nodes a few hours after subcutaneous inoculation. The organism could be isolated from blood, lymph nodes and internal organs.

The guinea pig may be used as an experimental model to study the congenital or neonatal transmission of brucellosis.

The guinea pig model is considerably more valuable than the mouse model for the evaluation of new vaccines. Occasionally, results that were promising in mice failed to materialize in guinea pigs, whereas the results obtained using guinea pigs were usually correlated with those obtained in other animals.

Delayed hypersensitivity is a common manifestation of human brucellosis, and the phenomenon plays an important role in the pathogenesis of this disease. Allergic tests are used for diagnosis of brucellosis in humans and animals, mainly in goats and sheep. The allergens, methods of sensitization, and concentration of allergens are usually tested in guinea pigs.

The guinea pig has been used experimentally to evaluate the therapeutic effects of tetracycline and other chemotherapeutic agents.

Mouse (Mus musculus)

Brucella abortus

Mice develop chronic infections, not only when challenged with virulent brucella strains, but also with attenuated vaccine strains.

Genetic factors are important in mice. Strain 19 caused a chronic infection in CBA/H, while BALB/c, C57BL/10, and B10Br were more resistant to infection.

Virulent brucella multiplies in the spleen and other organs of mice, and resistance is acquired. One month after inoculation, mice are very resistant to intravenous challenge with other virulent brucella strains.

Pregnant mice were challenged with B. abortus 544, and 60% of the newborn were infected.

Mice have been used to study the in vivo action of antibiotics. Trials showed that, in these animals, rifampicin was as good as or even better than tetracycline. Ampicillin and the trimethoprim-sulfametoxazole combination showed slight activity.

Rabbit (Oryctolagus cuniculus)

Brucella abortus

Normal rabbits are partially susceptible to brucella infection.

Local inflammatory reactions were produced in rabbits by intradermal injection of living brucella, and no differences were observed in the degree of dermal pathogenicity of the 3 species of brucella.

In one experiment, New Zealand rabbits weighing from 3.5 to 4.2 kg were inoculated intramuscularly with 10^2 to 10^4 cfu of B. abortus 2308. A poor relationship was observed between the doses given and the number of rabbits infected. The maximum of 50% having positive splenic cultures was obtained at levels 10^4 and 10^6 cfu.

The same levels of infection and serological responses were obtained with Dutch rabbits weighing 1.7 to 2.3 kg following i.m. inoculation of B. abortus 2308.

Pregnancy increases susceptibility to generalize brucella infection.

Despite the increase in systemic susceptibility to brucella infection, the infecting organism was not recovered from the uterus of pseudopregnant or progesterone-treated rabbits.

Rat (Rattus Norvegicus)

Brucella abortus

Rats are relatively resistant to Brucella infection. It was necessary to administer a high dose (several million cells) to produce generalized infection, and the spleen was usually free of Brucella a month after experimental infection.

The urine of rats contained B. abortus 24 to 28 h after feeding them with infected materials.

Some reports show that gray rats (Rattus norvegicus) are more susceptible to B. abortus than to B. melitensis and B. suis.

Hamster (Mesocricetus auratus - Syrian or Golden Hamster)

Brucella abortus

Based on results reported to date, the hamster does not appear to be a good animal model in which to study B. abortus infection, because great individual differences in susceptibility exist. Other experimental conditions, such as routes of inoculation, lapsed time from challenge to sacrifice, etc., need to be studied, however, before the usefulness of this species in brucellosis research can be completely evaluated.

Gerbil (Meriones unguiculatus)

Brucella abortus

Very limited data have been accumulated on brucellosis research in gerbils. This species is susceptible to infection by the i.m. inoculation of B. abortus, as few as 20 brucella species being sufficient to produce disease in some individuals. However, the variation in susceptibility from one individual to another is significant.

Cattle

Bos taurus

Brucella abortus is the principal cause of brucellosis in domestic cattle.

Susceptibility of cattle to B. abortus infection is influenced by the age, sex, and reproductive status of the individual animal. Sexually mature, pregnant cattle are more susceptible to B. abortus infection than sexually immature cattle of either sex. Even among pregnant cattle, susceptibility to infection may increase with the length of gestation.

In most circumstances the primary escape route of B. abortus is the uterine fluid and placenta expelled by infected cows when they abort or have a full-term parturition.

The risk that a susceptible animal will be exposed to an infective dose of B. abortus depends largely on the husbandry practices under which the cattle are managed.

Test-and-slaughter programs, in conjunction with vaccination and, in a later stage, whole herd depopulation, are the major methods of control and eventually eradication of animal brucellosis.

The first effective Brucella vaccine was based on live Brucella abortus strain 19, a laboratory-derived strain attenuated by an unknown process during subculture. This induces reasonable protection against B. abortus, but at the expense of persistent serological responses.

The presence of LPS with an O-chain on strain 19 explains the appearance and persistence of antibodies in serum following administration of this vaccine. These antibodies are detected in the serological assays used for the diagnosis of brucellosis and are the major problem associated with strain 19 vaccination since they prevent easy differentiation of vaccinated from infected cattle. Appearance and persistence of these antibodies depends on age, dose and route of vaccination. Their production makes the continued use of the vaccine incompatible with simultaneous application of test and slaughter procedures for the control of brucellosis.

The author compared the incidences of brucellosis in 153 dairy herds before and following adult cattle vaccination. There was a reduction of greater than 85% in infected cattle removed from the herds by the third postvaccinal herd test.

McDiarmid reported from 7 years of experience with about 500 cows that one dose of vaccine will confer adequate immunity for at least five pregnancies.

Although strain 19 is of low virulence for cattle, vaccination of pregnant cows can result in abortions. This event is rather rare, however, ranging from less than 1 up to 2.5% under field conditions.

A less frequent adverse consequence of strain 19 vaccination is the development of an arthropathy associated with Brucella antigen-containing immune complexes but not live organisms in the affected joint.

Illnesses in cattle, especially calves, such as anorexia, dullness, and muscular stiffness have been observed a few days following vaccination. More severe sings of paresis and anaphylaxis have also occurred.

The RB51 vaccine strain, a genetically stable, rough morphology mutant of B. abortus strain 2308 that lacks the polysaccharide O-side chain on the surface of the bacteria, replaced the S19 vaccine in 1996. The RB51 vaccine is used in 49 states, Puerto Rico, and the U.S. Virgin Islands; it was developed by serial passage in selective media, which resulted in a strain that was equally immunogenic, but less virulent, than the S19 vaccine. In mice, sheep, and cattle, RB51 protects against experimental challenge with B. abortus and is less abortifacient than S19 if administered during pregnancy; abortions have been reported rarely among cattle vaccinated during mid-gestation.

As expected, 100% of the cattle subcutaneously vaccinated with RB51 develop antibodies to R antigens that can be detected in a dot ELISA and other tests. On the contrary, vaccination with RB51 does not significantly interfere in classical tests such as the rose bengal, tube agglutination and the complement fixation test.

When used in single vaccination protocols its protective effect in cattle is similar to that induced by strain 19. Current experiments underway in the field under both high and low brucellosis prevalence indicate that immunity induced by strain RB51 (at least 1 year after vaccination) is similar to or better than that induced by strain 19.

The results indicate that vaccination with RB51 prevented 59.4% of abortions, 58.6% of cow infections, and 61.0% of fetal infections. The relative risk (RR) revealed that non-vaccinated animals have 2.462 (95% CI 1.029-5.889) times higher risk of aborting than RB51-vaccinated animals.

To date, over 5,000,000 calves have been vaccinated subcutaneously (SC) with the recommended dose of 1-3.4x1010 organisms without deleterious effects. Unpublished observations regarding protection efficacy suggest that immunization should start with animals not younger than 4 months. Pregnant cattle can be safely vaccinated SC with 109 RB51 organisms without the induction of abortions or placentitis. Intravenous inoculation of pregnant cattle with 10(10) organisms lead to placental and fetal infection, but not to abortion suggesting that vaccination of non-pregnant, adult cattle with a full dose should be safe although controlled studies employing the recommended SC route and a larger number of cattle are needed to confirm this.

Brucella invasion of the mucosal epithelium of the conjunctiva and lachrymal ducts elicits an acute inflammatory reaction in the submucosal tissues.

Invading brucellae which have escaped the submucosal defenses are distributed to regional lymph nodes by lymphatic drainage. It is not known whether the brucellae which colonize the regional lymph nodes are carried there within phagocytic cells or arrive as free organisms.

Infected lymph nodes are enlarged due to both lymphoid and reticuloendothelial hyperplasia, and to the infiltration of inflammatory cells.

Failure to destroy B. abortus within the draining lymph node results in persistence of infection and the eventual escape of the agent via the blood. Brucellae are able to survive within host leukocytes and may utilize both neutrophils and macrophages for protection from humoral and cellular bactericidal mechanisms during the periods of hematogenous spread.

During the bacteremic phase, brucellae may localize in a wide variety of tissues. However, the bacteria are most frequently isolated from lymphoid tissues, the mammary gland, and the reproductive tract. Infections may also become established in bones, joints, the eye, and occasionally, the brain. In males, secondary localization occurs most frequently in lymph nodes, the testes, epididymis, and accessory sex organs.

The extent and severity of placentitis in B. abortus infection is highly variable. At one extreme, widespread destruction of placentomes and fetal membranes is found, while at the other extreme only focal damage with minimal placentitis is noted. Brucella abortions may occur in both of these situations.

Incubation periods of bovine brucellosis range between 53 to 251 days.

Typically, brucellosis in domestic animals is viewed as a chronic infectious disease which usually persists for the life of the animal. Brucella-infected animals generally develop granulomatous inflammatory responses which are often located within lymphoid tissues and organs with a prominent reticuloendothelial component. The localization and persistence of brucellae within these tissues and organs follow in the wake of widespread distribution of the bacteria during a generalized stage of infection. Localization of brucellae within the female and male reproductive tracts accounts for the principal clinical symptoms of infection - abortion and male infertility.

It must be remembered that the only obvious clinical sign of brucellosis in domestic animals is abortion, and this is not pathognomic. Diagnosis can only be made on the basis of laboratory testing, the demonstration of the causal organism, and the detection of significant levels of specific antibody being complementary methods for diagnosis.

Three therapeutic regimens were evaluated in 121 cows naturally infected with Brucella melitensis or Brucella abortus, using a combination of long-acting oxytetracycline (LA-OTC), streptomycin (ST) and OTC-intramammary infusion (IMI). Cessation of shedding of Brucella in udder secretions and absence of Brucella in selected tissues were considered criteria for successful treatment. Regimen A (tested on 35 cows) consisted of LA-OTC 25 mg/kg administered intramuscularly (i.m.) every 3 days for 42 days, ST 25 mg/kg i.m. daily for 8 days, and OTC-IMI 20 ml/teat daily for 4 days. Regimen B (tested on 53 cows) was similar to regimen A, except that ST was administered every 2 days for 16 days and OTC-IMI every 2 days for 8 days. Both regimens were equally effective in eliminating Brucella organisms from all cows involved in the tests and no relapses were recorded. However, regimen C, which was similar to regimen A, except that ST was administered every 3 days for 24 days and OTC-IMI every 3 days for 12 days, resulted in the elimination of Brucella organisms from only 30 (91%) of 33 cows. Before commencement of the therapeutic regimens, B. melitensis biovar 1 or 2 had been repeatedly isolated from udder secretions of 103 cows and B. abortus biovar 1 from mammary secretions of 18 cows.

Biosafety Level 2, Biosafety Level 3, and Animal Biosafety Level 3

Brucellosis continues to be the most commonly reported laboratory-associated bacterial infection. B. abortus, B. canis, B. melitensis, and B. suis have all caused illness in laboratory personnel. Hypersensitivity to Brucella antigens is also a hazard to laboratory personnel. Occasional cases have been attributed to exposure to experimentally and naturally infected animals or their tissues.

Laboratory-acquired infections are occasionally reported and the inhalation of infective aerosols produced accidentally by microbiological techniques is the most frequent source of infection.

The agent may be present in blood, cerebrospinal fluid, semen, and occasionally urine. Most laboratory-associated cases have occurred in research facilities and have involved exposure to Brucella organisms being grown in large quantities. Cases have also occurred in a clinical laboratory setting: direct skin contact with cultures or with infectious clinical specimens from animals (e.g., blood, uterine discharges) are commonly implicated in these cases. Aerosols generated during laboratory procedures have caused large outbreaks. Mouth pipetting, accidental parenteral inoculations, and sprays into eyes, nose and mouth have also resulted in infection.

Biosafety Level 2 practices are recommended for activities with clinical specimens of human or animal origin containing or potentially containing pathogenic Brucella spp. Biosafety Level 3 and Animal Biosafety Level 3 practices, containment equipment and facilities are recommended, respectively, for all manipulations of cultures of the pathogenic Brucella spp. listed in this summary [above], and for experimental animal studies. Vaccines are not available for use in humans.

Preserve original specimens pursuant to a potential criminal investigation and possible transfer to an appropriate Laboratory Response Network (LRN) laboratory. FBI and state public health laboratory/state public health department will coordinate the transfer of isolates/specimens to a higher-level LRN laboratory as appropriate

Culture in static liquid medium is not recommended and much better yields are obtained in well-aerated shaken liquid medium. Smooth strains are particularly liable to undergo dissociation to nonsmooth variants in static liquid culture.

On suitable medium growth is not usually evident in less than 48 h, especially on primary isolation. Laboratory-adapted strains tend to grow more vigorously and will often produce visible colonies after 24-h incubation.

After 48 h growth at 37 C on serum dextrose agar or similar transparent solid medium, most Brucella strains will produce colonies 0.5 to 1.0 mm in diameter. These are raised, convex, and have a circular outline. Their color and texture depend upon the colonial phase of the organism. In the case of smooth strains, the colonies are transparent and pale yellow ("droplet of honey" appearance) with a shiny surface when viewed in transmitted light. In reflected light, the colonies have a bluish translucence. Nonsmooth colonies tend to be more opaque, with a granular surface and can vary in color from dead white to dark brown; off-white to buff are probably the most frequently seen colors. Unlike smooth colonies which are easily emulsified in water or saline to produce uniform suspensions, nonsmooth colonies are difficult to disperse and tend to form gritty, slimy, or lumpy suspensions depending on the degree of dissociation.

Selective media are usually required for the culture of specimens from the filed, especially fetal membranes which are usually grossly contaminated.

For most purposes, serum dextrose agar is a suitable solid medium. Serum dextrose broth is the equivalent liquid medium.

Brucella broth: tryptone 10 g, peptamine 10 g, dextrose 1 g, yeast extract 2 g, sodium chloride 5 g, sodium bisulfite 0.1 g, supplement [cycloheximide, bacitracin, circulin and polymyxin B], and 0.25 mL of 4% sodium citrate as anticoagulant.

37 C

The blood broth culture in 10% CO2 is the simplest and most often used bacteriologic procedure. However, the relative proportion of successful blood cultures reported varies between 85.4 and 17%.

Conventional blood cultures are seldom positive by the 4th day of incubation; the majority are positive between the 7th and 21st days and 2% are positive after the 27th day. For this reason, it is recommended that cultures be maintained for at least 45 days before declaring them negative.

Unless Castaneda's method is used, a culture suspected of Brucella has to be subcultured on solid media for identification.

Bone marrow cultures are considered the gold standard for the diagnosis of brucellosis, since the relatively high concentration of brucella in the reticuloendothelial system makes it easier to detect the organism. Furthermore, bacterial elimination from the bone marrow is equivalent to microbial eradication. However, harvesting bone marrow for culture remains an invasive, painful technique, and results have not been universally reproducible.

MAJOR CHARACTERISTICS OF BRUCELLA: (a) Small, gram-negative coccobacilli. (b) Grows only in aerobic blood culture bottles after 2-4 days. (c) Grows as typical colonies on BAP (Sheep blood agar) and CHOC (chocolate agar) within 48 h. Isolates typically do not grow on MAC (MacConkey) or EMB, although pinpoint colonies have been infrequently observed on these media after extended incubation times (7 days). Colony morphology on BAP: Brucella will appear as punctate colonies after 48 h. Colonies are non-pigmented and non-hemolytic. (d) Positive for oxidase, catalase, and urea.

PRESUMPTIVE IDENTIFICATION OF BRUCELLA SPECIES: (a) Brucella species will grow on subculture after 48 h of incubation in 5 to 10% CO2 on CHOC and BAP. (b) The organism does not show typical gram negative rod colony morphology on MAC within 48 hours, which will alow it to be separated from some other gram-negative coccobacilli. (c) The colonies typically show "dust-like" growth after overnight incubation, and a minimum of 48 h is necessary to get sufficient growth for further identification. (d) Colonies are smooth, convex, and raised with an entire edge (i.e., they have no distinguishing features).

Whole cell.

The antibodies detected are those directed against the surface molecules.

IgM, IgG, IgA.

Because of its simplicity, the SAT is the most widely used of all serologic tests for brucellosis. Wright and Smith were the first to describe the presence of agglutinins in sera of both animals and humans infected with Brucella.

This test may be done as a tube or a plate test.

The SAT is normally conducted by making doubling dilutions of the serum in phenol saline in round-bottomed tubes and adding an equal volume of the standard antigen. After mixing, the tubes are incubated overnight at 37C, and the degree of agglutination is then read by comparing the opacity against standards representing various degrees of agglutination. The resulting titer should then be converted to international units. Antigens may be prepared from suspensions grown in liquid medium by batch or continuous culture and are equally satisfactory, provided the satisfactory precautions are taken to prevent dissociation.

Titers above 1:160 are considered diagnostic in conjunction with a compatible clinical presentation. However, in areas of endemic disease, using a titer of 1:320 as diagnostic may be more specific.

Serum agglutination tests have a major drawback in that they are not suitable for patient follow-up, since titers can remain high for a prolonged period.

The agglutination test is very sensitive to antibody resulting from vaccination.

Specificity: 94% and 99.5% when interpreted at the 30- and 60-IU levels, respectively.

Sensitivity: 98.3% and 93.1% for each of these levels.

The antigen consists of Brucella cells stained with Rose Bengal and suspended in buffer at pH 3.65 +/- 0.05.

Agglutinating antibodies.

IgM, IgG, IgA.

The RB test is a modification of the acid-plate-agglutination test introduced by Pietz for the screening of bovine brucellosis, and uses a suspension of B. abortus smooth cells stained with Rose Bengal dye buffered at pH 3.65. The potential usefulness of the RB test for diagnosing human brucellosis was suggested by the Food and Agriculture Organization/World Health Organization Committee and this method has replaced the rapid slide test of Huddleson which was prone to false-negative results.

The test is usually conducted on ruled enamel strips, on a glass or ceramic tile, or in a WHO hemagglutination plate. Thirty microliters of the serum and antigen are applied, each having been allowed sufficient time to attain room temperature. The reaction mixture is rocked or oscillated for 4 min, and then the tests are read by examining for agglutination in good light.

The RBT is very sensitive to vaccinal antibody, seriously limiting its use in vaccinated animals.

The RB test can give false-positive reactions with sera from patients infected with Yersinia enterocolitica O:9, or healthy individuals who have been exposed to smooth Brucella. However, no false-positive reactions were found with patients infected with tularemia or those vaccinated against Vibrio cholerae.

In our laboratory, of 173 sera from patients with acute brucellosis, only one was RB-negative.

As early as 1938, complement fixation was considered by Russian workers as the most specific and valuable serologic test for brucellosis.

The basis for the complement fixation test (CFT) is that dilutions of serum from cattle, sheep or goats (swine sera may be used as well but require addition of normal porcine serum to supplement as a modifying factor), antigen (usually whole cells) and a pretitrated amount of complement (guinea pig serum is used as a source of complement while indigenous complement in the test serum is inactivated by heating for 30-60 min at 56 C) are added together. If antibody is present in the serum, it will bind to the antigen and providing the antibody is IgG1 isotype, complement will be activated. An indicator system is then added. It consists of sheep erythrocytes sensitized with rabbit antibody. If the test serum contained antibody, complement is not available and lysis of the erythrocytes will not take place. Alternately, if no antibody was present, the available complement activated by interaction with receptors on the Fc portion of the rabbit antibody will lyse the erythrocytes, releasing hemoglobin, which is assessed visually, or using a spectrophotometer.

Nonspecific reactions are rare, although recently a phenomenon was recognized in Great Britain in which 0.5% of all samples tested in the county of Lancashire failed the CFT.

To cite a few reports from the literature, Alton et al. found that all culturally positive animals reacted to the CFT. Nicoletti reported that the CFT correctly identified 98% of culturally positive animals.

The antiglobulin test was developed to detect antibodies which, although they combine with the antigen, do not give rise to agglutination. The presence of these so-called "incomplete agglutinins" can be detected using an antibody directed against the IgG fraction of the species of animal being tested. These reagents can be obtained commercially. The test is performed in two phases. First, the conventional SAT is carried out, and after reading, those tubes that do not show any agglutination are centrifuged and the deposited cells washed thoroughly. The presence, if any, of the nonagglutinating Brucella antibody on the Brucella antigen is detected by adding the antiglobulin reagent at its working dilution and either reincubating the tubes and reading after 24-h of incubation or conducting the test on a slide.

Depending on the specificity of the antiglobulin reagent, all the major immunoglobulins can take part in the test and it is undoubtedly more sensitive than the ordinary tube agglutination test. It is reported to be ov value in the early stages of the disease as well as in clearing nonspecific agglutination reactions.

Diagnosis of a relapse is particularly difficult and is most often based on the presence of high titers in the Coombs test. However, this is a long and technically difficult test, requiring skilled personnel, and so it is not routinely performed in many clinical laboratories.

Specificity: 99.8% (> 1/160 diagnostic threshold titer).

Sensitivity: 91.5% (> 1/160 diagnostic threshold titer).

S-LPS from Brucella abortus 413

The competitive enzyme immunoassay (CELISA) for the detection of serum antibody to Brucella is a multispecies assay which appears to be capable of differentiating vaccinal and cross-reacting antibodies from antibodies elicited by field infection in cattle.

The CELISA is based on a MAb specific for a common and repeating epitope on the O-polysaccharide portion of the S-LPS, and the MAb competes with antibodies to cross-reacting antigens; specificity can be increased by use of a MAb with a selected affinity for an antigen.

In the absence of anti-Brucella antibody in the test serum, the MAb binds, resulting in color development. If the test is positive, the test serum competes with the MAb for the epitope sites, and inhibition of MAb binding is inversely proportional to subsequent color development.

The test detects IgG antibody, which is useful for evaluating treatment effectiveness, for monitoring clinical conditions, and for prognosis. It is relatively easier to perform than the CFT, a technically complicated test that requires continuous titration of reagents, and is somewhat faster than the TAT. Fewer cross-reactions with antigens of other microorganisms (or antibodies) occur, and the use of MAb detection reagents enables standardization. The CELISA is a suitable test for human brucellosis and could be adopted as the confirmatory test.

A survey was performed with 911 sera. Of the sera, 341 were from an asymptomatic population that tested negative with conventional serological tests (screening and confirmatory). Based on these samples, the CELISA specificities were determined to be 99.7 and 100% with cutoff values of 28 and 30% inhibition (%I), respectively.

For the 51 culture-positive patients, CELISA was positive for 100%.

The antigen consists of an LPS fraction prepared by heat extraction from a washed culture of B. abortus strain 1119-2.

The dipstick assay is a rapid test that detects Brucella-specific IgM antibodies. The technique provides a quick result, is easy to perform, and does not require trained personnel.

The detection of Brucella-specific immunoglobulin M (IgM) antibodies allows the diagnosis of patients with brucellosis at an early stage or acute disease and also may help to discriminate between patients in the early phase of brucellosis and those with chronic brucellosis.

The dipstick assay consists of a strip of nitrocellulose-containing specific antigen applied in a distinct line, and a non-enzymatic detection reagent.

The detection reagent consists of a monoclonal antihuman IgM antibody conjugated to Palanyl red.

Specific IgM antibodies that are detected in the dipstick assay are present in the serum of patients during the early stages of the disease. Patients with a long period of evolution will probably have a negative dipstick test, but can be diagnosed with the aid of the Coombs test and classical clinical findings.

Only 4 of 297 samples from the noncase patients gave a positive result in the dipstick assay, giving a specificity of 98.6%.

The sensitivity of the dipstick assay was 89.0% for the samples collected within 2 months after the onset of the disease and 83.1% for the samples collected 2 to 4 months after the onset of the disease. The sensitivity dropped to 32.6 and 29.8% for the two groups of samples collected after 4 and 6 months of treatment, respectively.

Coloured B. melitensis bacteria killed by formaldehyde treatment.

Brucellacapt is an inmmunocapture-agglutination technique, which detects all antibodies against Brucella.

The use of Brucellacapt in the diagnosis of human brucellosis could help to detect the disease in patients with long evolution times, which cannot be detected with SAT. Brucellacapt is also easier to perform than Coombs test.

Although Brucellacapt can have advantages respect other classical tests, it can hardly replace a rapid screening tests as RB or dipstick in a first diagnostic, because Brucellacapt is more complex, expensive and slow. However, Brucellacapt could be a second level test such as the Coombs test which offers similar sensitivity and specificity.

The Brucellacapt test (Vircell SL) was performed as specified by the manufacturer. Briefly, 50 ul samples of serum dilutions were added to wells of a U-bottom microtiter plate coated with anti-total human immunoglobulin. Then 50 ul of an antigen suspension was added to all the wells. The plates were sealed with adhesive tape and incubated at 37 C for 24 h in a dark humid chamber. Positive reactions show agglutination over the bottom of the well. Negative reactions are indicated by a pellet at the center of the bottom of the well.

Specificity of the Brucellacapt - 97.5%.

Ninety-six percent of the patients were Brucellacapt positive at the onset of the disease. The only negative patient became positive 15 days after. This sensitivity was similar to Coombs (100%) and higher than SAT (73%).

Polysaccharide B.

Agar gel immunodiffusion (AGID) and single radial immunodiffusion (SRD) tests were the first tests to distinguish vaccinal antibody from that resulting from field strain infection with B. abortus. An antigen, polysaccharide B (composed of a cyclic glucose molecule and a small amount of OPS, the active part of the preparation), derived from B. melitensis was used, either incorporated into the agar matrix in SRD, followed by addition of test serum to a well cut in the agar matrix or in the AGID, added to a well in the agar matrix adjacent to another containing test serum. If antibody was present, a ring of precipitate would appear within a couple of hours or after a longer incubation period with sera containing less antibody. Similarly, in the AGID test, opposing wells in the agar matrix, filled with antigen and test serum would produce a precipitin band if the serum contained antibody. While these tests provided data not available by other means, their sensitivity was insufficient for wide scale diagnostic use and neither test is recommended by the OIE for bovine brucellosis.

The fluorescence polarization assay (FPA) was developed as a test that could be performed outside the diagnostic laboratory, allowing for rapid and accurate diagnosis. The basis of the test is that a molecule in solution rotates randomly at a rate inversely proportional to its size. If the molecule is labeled with a fluorescent marker and is examined by plane polarized light, a small molecule will rotate through a given angle faster than a larger molecule. The time of rotation may be measured using horizontal and vertical measurements. For diagnosis of brucellosis, a fluorescence polarization analyzer is used to obtain a background measurement of fluorescence of diluted serum. Antigen consisting of an OPS fragment, approximately 22 kDa in size, labeled with fluorescein isothiocyanate is added and incubated for 2 min, followed by a final reading in the analyzer which automatically subtracts the background reading. The net result is presented in millipolarization units. The FPA can be performed almost anywhere using a portable analyzer which receives power from a laptop computer, using serum, milk or EDTA anticoagulated blood. The test is rugged, relatively inexpensive, simple and very rapid. The FPA has been validated for a large number of species, including cattle, swine, bison and a number of cervids and is an alternate OIE test for bovine and swine brucellosis diagnosis.

Based on 340 sera from asymptomatic blood donors with no evidence of brucellosis, the specificity of the FPA was 97.9 % using a cut-off value of 72 mP.

Sera from Brucella-infected patients (11 Brucella melitensis, 32 Brucella abortus, 32 Brucella suis and one Brucella sp.) yielded a sensitivity estimate of 96.1 %.

The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens.

Successful amplification of a predicted 800-bp amplicon from B. abortus and other species of Brucella demonstrated that the sequences were highly conserved and that the test could be extended to the entire genus.

TGCTAATACCGTATGTGCTT

TAACCGCGACCGGGATGTCAA

To assess specificity, the assay was applied to a panel of 17 other bacteria. No products were amplified from any non-Brucella species except Ochrobactrum anthropi, the closest known relative to Brucella.

PCR assays have been developed to differentiate among Brucella species and/or biovars. These assays are directed toward genetic loci that are variable among the species/biovars. Such targets are uncommon in Brucella since the genus is remarkably homogeneous and has been proposed to be a single species.

We describe a PCR assay that comprises five oligonucleotide primers which can identify selected biovars of four species of Brucella. Individual biovars within a species are not differentiated. The assay can identify three biovars (1, 2, and 4) of B. abortus, all three biovars of B. melitensis, biovar 1 of B. suis, and all B. ovis biovars. These biovars include all of the Brucella species typically isolated from cattle in the United States, a goal of the present research. The assay exploits the polymorphism arising from species-specific localization of the genetic element IS711 in the Brucella chromosome.

The multiplex design consists of one common primer anchored in the IS element and a species-specific primer that binds to the unique sequence flanking that insertion site. The assay primers were chosen so that species discrimination was determined by the size of the amplicon.

The assay was named the AMOS-PCR assay for the Brucella species.

GACGAACGGAATTTTTCCAATCCC

TGCCGATCACTTAAGGGCCTTCAT

AAATCGCGTCCTTGCTGGTCTGA

TGCCGATCACTTAAGGGCCTTCAT

CGGGTTCTGGCACCATCGTCG

TGCCGATCACTTAAGGGCCTTCAT

GCGCGGTTTTCTGAAGGTTCAGC

TGCCGATCACTTAAGGGCCTTCAT

Six closely related bacteria (Agrobacterium radiobacter, Agrobacterium rhizogenes, Ochrobactrum anthropi, Rhizobium leguminosarum, Rhizobium meliloti, and Rhzodospirillum rubrum) and two control bacteria (Bordeteila bronchiseptica and Escherichia coli) tested negative by the assay.

The performance of the assay with U.S. field isolates was highly effective. When 107 field isolates were screened by the described method, there was 100% agreement with the identifications made by conventional methods.

Because the brucellosis eradication program uses slaughter and quarantine as control measures, it would benefit from faster methods of bacterial identification. Distinguishing vaccine strains from strains that cause infections among vaccinated herds in the field is essential. To accomplish this, our PCR-based, species-specific assay (B. J. Bricker and S. M. Halling, J. Clin. Microbiol. 32:2660-2666, 1994) was updated to identify Brucella abortus vaccine strains S19 and RB51. Three new oligonucleotide primers were added to the five-primer multiplex Brucella AMOS PCR assay. Identification is based on the number and sizes of six products amplified by PCR.

GACGAACGGAATTTTTCCAATCCC

TGCCGATCACTTAAGGGCCTTCAT

AAATCGCGTCCTTGCTGGTCTGA

TGCCGATCACTTAAGGGCCTTCAT

CGGGTTCTGGCACCATCGTCG

TGCCGATCACTTAAGGGCCTTCAT

GCGCGGTTTTCTGAAGGTTCAGC

TGCCGATCACTTAAGGGCCTTCAT

CCCCGGAAGATATGCTTCGATCC

TGCCGATCACTTAAGGGCCTTCAT

GCGCCGCGAAGAACTTATCAA

CGCCATGTTAGCGGCGGTGA

Six closely related bacteria (Agrobacterium radiobacter, Agrobacterium rhizogenes, Ochrobactrum anthropi, Rhizobium leguminosarum, Rhizobium meliloti, and