Production, recovery and immunogenicity of the protective antigen from a recombinant strain of Bacillus anthracis.

Anthrax, Woolsorter's disease, and Charbon

Bacillus anthracis

The anthrax bacterium is named Bacillus anthracis because it is rod-shaped when viewed under a microscope. The name "Bacillus" comes from the Latin word "baculus," meaning "rod." Anthrax is derived from the Greek word for coal, the characteristic color and appearance of the eschar in cutaneous anthrax. Anthrax is also known as charbon (pronounced shar-bawn), which is French for coal. Pulmonary anthrax is also known as woolsorter's disease. This is because people who sorted the wool of animals had contracted it in this way.

Ames Strain

The Bacillus anthracis Ames strain, is highly virulent and contains pXO1 and pXO2 plasmids. It was originally isolated from a dead cow in Texas in 1981. The geographic region for this strain is the United States of America and the United Kingdom. Sequencing of the genomes of two isolates have been completed.

Porton Strain of Ames isolate

The Bacillus anthracis Porton Ames isolate (pX01-, pX02-) was sequenced at the Institute for Genomic Research in 1999-2003.

Florida isolate of Ames Strain

The whole genome of Bacillus anthracis strain A2012, the Florida isolate has been sequenced. This isolate was from a victim of a recent bioterrorist anthrax attack.

Pasteur Strain

Sterne Strain

Recently, using mutiple-locus variable number tandem repeat (VNTR) analysis bioterror strain was identified as the veterinary vaccine strain, Sterne 34F2. Geographic region is in China. Sequencing is being considered and may be sequenced in the future.

Strain-91-382C-1

Geographic region is in Canada. Sequencing is underway.

Strain-2PT

Geographic region is in Italy. Sequencing is being considered and may be sequenced in the future.

Strain V770

Geographic region is in Turkey, South Africa, Argentina, and the United States of America. Sequencing is being considered and may be sequenced in the future.

Strain Australian 94

Geographic region is Australia. It is the most virulent observed in recent vaccine animal trials. Sequencing is being considered and may be sequenced in the future.

Strain Kruger A

The Kruger A strain of Bacillus anthracis is similar to Ames but of a lower virulence. Geographic region is South Africa. In Kruger National Park (South Africa), Kruger A isolates have a wider geographic range and greater genetic diversity than Kruger B isolates. Sequencing is being considered and may be sequenced in the future.

Strain Kruger B

The Kruger B strain of Bacillus anthracis is more virulent than Kruger A and has the greatest phylogenetic diversity relative to Ames. Geographic region is South Africa. Sequencing is being drafted (shotgun sequence with eightfold coverage is available).

Strain Vollum 1b

Vollum-1b is a low virulence strain that has been used for many research studies. Geographic region is in the United Kingdom, Spain, and Zimbabwe. Sequencing is underway.

Strain CNEVA 9066

CNEVA 9066 is a phylogenetically diverse strain from France, There is little data available on virulence. Geographic region is in Slovenia, France, and Croatia. Sequencing is underway.

The non-flagellated vegetative cell is large (1-8 micrometers long, 1-1.5 micrometers wide). Spore size is approximately 1 micrometer.

Vegetative cells are rod-shaped. The chains of virulent forms of the bacteria are usually surrounded by a capsule.

Spores ingested by herbivores germinate within the host to produce the vegetative forms; these multiply and express their virulence factors, killing the host (ref76, Figure 1). The vegetative form is square ended and capsulated. Sporulating cells carry elliptic, centrally located spores. Bacilli shed by the dying or dead animal will sporulate on contact with air. Sporulation requires the presence of free oxygen, and the efficiency of the process is influenced by the environmental conditions. The proportion of cells that reach the ultimate stage, a dormant spore, is variable. The various steps of this cycle and current knowledge of the molecular mechanisms they involve are reviewed.

This is the phase where the bacteria have intense growth.

The growth of B. anthracis is stationary.

Endospores are 1 micrometer by 1.5 micrometers in size and are able to reach the alveoli (ie, less than 5 micrometers).

Endospores are nonswelling and oval-shaped.

Endospore is located central-to-subterminal and does not usually swell; carbon dioxide levels within the body inhibit sporulation. Forms long chains in vitro giving them a bamboo appearance; single cells or short chains in direct clinical samples.

The SPORE is a particular stage in the life cycle of the ANTHRAX organism; during this stage it goes into STASIS and remains dormant until something happens in its natural environment.

Dormant spores are highly resistant to adverse environmental conditions including heat, ultraviolet and ionizing radiation, pressure, and chemical agents. They are able to survive for long periods in contaminated soils and thus account for the ecological cycle of the organism. In a suitable environment, spores reestablish vegetative growth. However the bacilli are poor survivors, and it is unclear whether existence of a complete cycle, from germination to resporulation, occurs outside the host. Indeed the particular properties of B. anthracis, compared with those of other Bacillus cereus-group bacilli sharing the same ecological niche, are consistent with a life cycle that almost exclusively takes place in the mammalian host.

The bacteria at the vegetative phase begin to replicate very quickly with the appropriate growth condition.

The intensively grown active bacteria eventually kill the host and the stationary phase forms.

The rate of sporulation by the shed vegetative cells and the proportion which succeed in sporulating are influenced in a complex manner by the environmental conditions into which they fall. Temperature, pH, water, oxygen availability, sunlight, organic matter and the presence of certain cations such as Mn++ are among the many influcencing factors. The spore forms are highly resistant ot adverse environmental conditions.

Within the infected host the spores germinate to produce the vegetative forms.

Bacillus anthracis is Gram-positive, non-motile, aerobic, facultative anaerobic, spore-forming, bacterium.

5227293 bp

Bacillus anthracis strain Ames, complete genome.

Plasmid pXO2 from the Pasteur strain has been sequenced

96,231 bp in length

85 open reading frames

Plasmid pXO2 (60Mda) carries genes required for the synthesis of an antiphagocytic poly-gamma-D-glutamic acid capsule which inhibits phagocytosis of vegetative cells. Plasmid pXO2 carries: three genes required for capsule synthesis (capB, capC, and capA), a gene associated with capsule degradation (dep), and a trans-acting regulatory gene (acpA).

Plasmid pXO1 has been isolated from the Sterne strain (Read et al. 2002).

181,654 bp in length

Plasmid pX01 contains 143 ORFs, covering ~61% of the DNA. Plasmid pXO1 (110-Mda) contains genes required for synthesis of the anthrax toxin proteins: cya which encodes edema factor (EF), lef which encodes lethal factor (LF), and pagA which encodes protective antigen (PA). Plasmid pXO1 also harbors two trans-acting regulatory genes [atxA the toxin gene transactivator], pagR [the negative regulator of pagA], a gene encoding a type I topoisomerase (topA); a resolvase and a transposase, an operon containing three genes (gerXC, -A and -B) whose functions appear to affect germination. The virulence genes of pXO1 are organized in a manner similar to pathogenicity islands (PAIs) located on the chromosomes of other bacterial pathogens (Mock et al., 2001).

5093554 bp

Bacillus anthracis A2012, unfinished sequence, whole genome shotgun sequencing project.

181677 bp

Bacillus anthracis str. A2012 plasmid pXO1, complete sequence.

94829 bp

Bacillus anthracis str. A2012 plasmid pXO2, complete sequence.

Anthrax in animals is hyperendemic or endemic in the following areas of the world: most areas of the Middle East, most areas of equatorial Africa, Mexico, Central Africa, Chile, Argentina, Peru, Bolivia, certain Southeast Asian countries (e.g. Burma (Myanmar), Vietnam, Cambodia, Thailand), Papua New Guinea, China, and some Mediterranean countries. In most of the rest of the world, anthrax occurs only sporadically. In the United States (US), outbreaks in animals have occurred since 1990 in the Midwest (Kansas, Nebraska, North Dakota, South Dakota, Missouri); in the West (California, Nevada); and in Texas and Oklahoma. In the US, the microorganism remains endemic in the soil of Texas, Oklahoma, and the lower Mississippi valley.

An estimated 2,000 to 20,000 human cases of anthrax occur globally each year.

Early descriptions of anthrax date to 3,500 years ago; anthrax may have been responsible for two of the plagues that afflicted Egypt in 1491 BC.

A major outbreak involving nearly 10,000 cases (most of them cutaneous infection) occurred in Zimbabwe during the late 1970s and early 1980s. An epizootic outbreak in cattle occurred at that time in the same area.

An outbreak involving nine cases (five inhalational and four cutaneous) occurred in 1957 in the United States in a New Hampshire goat-hair processing plant. This was the last recognized outbreak of naturally occurring infection in this country.

An outbreak of oropharyngeal anthrax involving 24 cases occurred in Thailand in 1982 following consumption of contaminated meat. Oropharyngeal disease is an unusual manisfestation of infection, which makes this outbreak of particular interest.

In 1941, the British conducted limited experiments by realeasing spores of anthrax on Gruinard Island near Scotland. During 1943 and 1944, an estimated 4 x 10e14 anthrax spores were dispersed on the island through explosive means. Spores were still detectable more than 40 years later. The viable anthrax spores persisted until the island was decontaminated with formaldehyde and seawater in 1986.

The US experimented with biological weapons including anthrax spores in 1950s and 1960s.

In 1979, a large epidemic of anthrax occurred in the former Soviet Union at Sverdlosk, an industrial city of 1.2 million people just east of the Ural Mountains. The accidental release of Bacillus anthracis spores from a nearby military facility was responsible for the epidemic, which caused at least 77 clinical cases and 66 deaths.

Between 1984 and 1993, only three cases of cutaneous anthrax were reported to the Centers for Disease Control. A fatal case occurred in 1976; when a home craftsman died of inhalational anthrax after working with yarn imported form Pakistan. Approximately 130 cases occurred annually in the US in early 1900s. The incidence has gradually declined over time, with less than 10 cases reported each year since the early 1960s.

About 95% of naturally occurring cases in the United States (US) are cutaneous and 5% are inhalational. Gastrointestinal infection has not been recognized in the country. Only 18 cases of naturally occurring inhalational anthrax were reported in the US during the 20th century, with the most recent case in 1976. All but three were associated with industrial exposures; two of the remaining cases were laboratory-acquired and the source of exposure for the third case remains unknown. Since 1990, only two cases of naturally occurring infection have been reported in the US (one in 1992 and one in 2000); both patients had cutaneous disease. The latter case occurred in North Dakota and resulted from agricultural exposure.

In 2001, an outbreak in the United States involved direct exposure to mail that was deliberately contaminated with anthrax spores. At least five contaminated letters were sent and one was reported to contain 2g of powder, with 100 billion to 1 trillion anthrax spores per gram. Twenty-two confirmed or suspect cases of anthrax infection resulted. Eleven of these were inhalational cases, of whom 5 died; 11 were cutaneous cases (7 confirmed, 4 suspected).

Exposure to infected animals or contaminated animal products. Anthrax is predominantly a disease of animals. Contact with infected tissues of dead animals (e.g. butchering, preparing contaminated meat), which generally leads to cutaneous anthrax, consumption of contaminated undercooked meat, which can lead to gastrointestinal or oropharyngeal anthrax, contact with contaminated hair, wool, or hides (particularly during processing) or contact with products made from them, which can lead to either inhalational or cutaneous anthrax.

Humans Humans

The agent may be present in blood, skin lesion exudates, cerebrospinal fluid, pleural fluid, sputum, and rarely, in urine and feces. Reported rarely with cutaneous anthrax, but has not been recognized with gastrointestinal or inhalational disease.

Contaminated environment reservoir includes soil, air, or animal carcass. B. anthracis spores remain prevalent in soil samples throughout the world and cause anthrax cases among herbivores annually. Ecologic factors (such as abundant rainfall following a period of drought may enhance spore density in soil, although the exact influence of such factors remains poorly understood (Inglesby et al., 2002; Shafazand et al., 1999; Website 2). The results of studies of agricultural outbreaks have suggested that conditions for multiplication are favorable when the soil pH is >6.0 and rich in organic matter. Major changes in the soil microenvironment, such as drought or rainfall, enhance the sporulation. Spores germinate and form vegetative cells in environments rich in nutrients (e.g. glucose, amino acids, nucleosides). Vegetative bacteria have poor survival outside of an animal or human host; colony counts decline to being undetectable within 24 hours following inoculation into water. Conversely, vegetative cells form spores when nutrients in the environment are exhausted. Spores have been shown to survive in the environment for decades (more than 40 years). The environmentally hardy properties of the spore allow it to survive for decades in ambient conditions. Endospores are resistant to drying, heat, ultraviolet light, gamma radiation, and some disinfectants (Inglesby et al., 2002; Website 2).

Aerosol release of weaponized spores is the most likely mechanism for use of anthrax as a biological weapon. Although there is no formal definition of weaponized anthrax, weaponization generally involves: small particle size, high concentration of spores, treatment to reduce clumping, neutralization of the electrical charge, and use of antimicrobial-resistant strains by genetic modification of the organism to increase virulence or escape vaccine protection.

Anthrax is a notifiable disease in all 50 states and is Federally reportable. According to bioterrorism guidelines put forth by Centers for Disease Control (CDC), any case of inhalational (pulmonary) anthrax in the United States should also be reported to the Federal Bureau of Investigation, as it is assumed that inhalational anthrax is so rare in the United States that any case must be due an intentional release. Immediately notify the local or state public health department, local hospital epidemiologist, and local or state public health laboratory. If you are at home, then report the incident to local police. If you are at work, then report the incident to local police, and notify your building security official or an available supervisor. The Laboratory Response Network (LRN) has been developed in the United States to coordinate clinical diagnostic testing for bioterrorism events. LRN has been established through a collaboration of the Association of Public Health Laboratories and the CDC. The network is organized into four laboratory levels (A, B, C, and D). The LRN can be accessed by contacting state public health laboratories. Level A laboratories can perform standard initial tests to rule out (but not definitively identify) B. anthracis, and include Clinical Laboratory Improvement Act (CLIA)-certified clinical laboratories with BSL-2 safety practices. Level B laboratories have core capacity for agent isolation and confirmatory testing and include most state public health laboratories. Level C laboratories have advanced capacity for rapid identification and include selected public health, federal, and academic laboratories. Level D laboratories have the highest level of containment (BSL-4) and expertise in the diagnosis of rare and dangerous biologic agents and include specialized Federal laboratories.

Aerosolized spores may be delivered by missiles, bomblets, artillery fires, point release, or airborne line release. Contamination of food and water may be used. Mail can also be an effective vehicle for disseminating anthrax spores.

A suspicious, unopened letter or package should be marked with a threatening message such as "anthrax": Do not shake or empty the contents of any suspicious envelope or package. PLACE the envelope or package in a plastic bag or some other type of container to prevent leakage of contents. If you do not have any container, then COVER the envelope or package with anything (e.g., clothing, paper, trash can, etc.) and do not remove this cover. Then LEAVE the room and CLOSE the door, or section off the area to prevent others from entering (i.e., keep others away). WASH your hands with soap and water to prevent spreading any powder to your face. Envelope with powder and powder spills out onto surface: DO NOT try to CLEAN UP the powder. COVER the spilled contents immediately with anything (e.g., clothing, paper, trash can, etc.) and do not remove this cover! Then LEAVE the room and CLOSE the door, or section off the area to prevent others from entering (i.e., keep others away). WASH your hands with soap and water to prevent spreading any powder to your face. REMOVE heavily contaminated clothing as soon as possible and place in a plastic bag, or some other container that can be sealed. This clothing bag should be given to the emergency responders for proper handling. SHOWER with soap and water as soon as possible. Do Not Use Bleach Or Other Disinfectant On Your Skin. Question of room contamination by aerosolization: for example: small device triggered, warning that air handling system is contaminated, or warning that a biological agent released in a public space. Turn off local fans or ventilation units in the area. LEAVE area immediately. CLOSE the door, or section off the area to prevent others from entering (i.e., keep others away). SHUT down air handling system in the building, if possible. If possible, list all people who were in the room or area, especially those who had actual contact with the powder. Give this list to both the local public health authorities so that proper instructions can be given for medical follow-up, and to law enforcement officials for further investigation.

Humans

Homo sapiens

The infective dose for cutaneous anthrax is not known.

Extrapolations from animal data suggest that the human LD50 (dose sufficient to kill 50% of persons exposed to it) is 2500 to 55000 inhaled spores. On the basis of experimental studies involving primates, the United States Department of Defense has estimated that the LD50 for inhalational anthrax in humans from weapons-grade anthrax is 2,500 to 55,000 spores. The United States Department of Defense estimates that the LD50 for humans is between 8,000 and 10,000 spores. The LD10 (dose sufficient to kill 10% of persons exposed to it) was as low as 100 spores and data suggest that as few as 1 to 3 spores may cause infection. Extrapolation of dose-response curves involving cynomolgous monkeys suggest that the LD10 in humans following exposure to airborne anthrax spores may be as low as 50 to 98 spores, the LD5 (dose sufficient to kill 5% of persons exposed to it) may be only 14 to 28 spores, and the LD1 (dose sufficient to kill 1% of persons exposed to it) may be only 1 to 3 spores. From data available (1979 accidental release of aerosol in Sverdlovsk, Russia), estimates were made that the median lethal dose of spore-bearing particles less than 5 micrometers in size was 4,100. The minimum infectious inhaled dose in chimpanzees is 40,000 to 65,000 spores. A review of previous outbreaks suggests that prior exposure to radiation, alcoholism, and underlying pulmonary disease are important risk factors for inhalational anthrax. In experimental animals, once toxin production has reached a critical threshold, death occurs even if sterility of the bloodstream is achieved with antibiotics.

The infective dose for gastrointestinal anthrax is not known.

B. anthracis is able to form spores. These spores are the infectious agents and can enter the human body through skin lesions, ingestion or inhalation. Most commonly, spores enter via a skin lesion and germinate locally. The bacteria multiply quickly and secrete a toxin that causes a lesion characterized by edema and necrosis, which develops into a black eschar. Although the lesion usually heals spontaneously, in rare instances the bacteria enter the systemic circulation and replicate to high densities. In these circumstances, the large amount of toxin released by the bacteria can cause shock, respiratory failure and death. When the spores are ingested or inhaled, they are engulfed by macrophages, germinate in central lymph nodes and usually spread systemically. Thus, gastrointestinal and inhalation anthrax are often fatal.

Humans usually do not contract anthrax directly from the soil, unless they work with fertilizers (bonemeal) prepared from infected animals. Also, humans can contract spores from inhalation of aerosolized spores released during a biological weapons attack.

A sterile milky-white suspension (when mixed) made from cell-free filtrates of microaerophilic cultures of an avirulent, nonencapsulated strain of B. anthracis, Sterne strain. It is an aluminum hydroxide-precipitated preparation of protective antigen. The standard anthrax vaccine in the United States is approved by the Food and Drug Administration and is routinely administered to persons at risk for exposure to anthrax spores. The existing supplies are currently being used to immunize all military personnel. Immunization consists of three subcutaneous injections, 0.5 mL each, given 2 weeks apart followed by three additional subcutaneous injections, 0.5 mL each, given at 6, 12, and 18 months. Subsequent booster injections of 0.5 mL of BioThrax at one-year intervals are recommended.

In clinical trials performed between 1955-1959, the calculated vaccine efficacy level against all reported cases of anthrax combined was 92.5% (lower 95% CI=65%). From 1962-1974, based on information from the Centers for Disease Control, 27 cases of anthrax occurred in mill workers. Of those, 24 cases occurred in unvaccinated individuals, one case after the person had been given one dose and two cases occurred after individuals had been given two doses. No documented cases of anthrax were reported for individuals who had received the recommended six doses of anthrax vaccine.

Studies show that vaccinated monkeys were protected for up to 2 years. These studies suggest that at minimum, two doses of vaccine should be effective against an aerosol exposure to anthrax. A protective antibody response usually does not develop until 7 days after the second dose.

The use of BioThrax is contraindicated in subjects with a history of anaphylactic or anaphylactic-like reaction following a previous dose of BioThrax, or any of the vaccine components. Pregnant women should not be vaccinated against anthrax unless the potential benefits of vaccination have been determined to outweigh the potential risk to the fetus. BioThrax should not be administered to individuals with a history of Guillain-Barre Syndrome (GBS) unless there is a clear benefit that outweighs the potential risk of a recurrence. This product should be administered with caution to patients with a positive history of latex sensitivity since the vial stopper contains dry natural rubber. Safety and effectiveness in pediatric patients have not been established. No data regarding the safety of BioThrax are available for persons aged >65 years. Animal studies have not been performed to ascertain whether BioThrax has carcinogenic action or any effect on fertility.

History of anthrax disease may increase the potential for severe local adverse reactions. Patients with impaired immune responsiveness due to congenital or acquired immunodeficiency, or immunosuppressive therapy may not be adequately immunized following administration of BioThrax. The administration to persons with concurrent moderate or severe illness should be postponed until recovery. There are varied pre licensure local and systemic reactions. The most frequently reported adverse events were erythema, headache, arthralgia, fatigue, fever, peripheral swelling, pruritus, nausea, injection site edema, pain/tenderness and dizziness. Approximately 6% of the reported events were listed as serious. Serious adverse events include those that result in death, hospitalization, permanent disability or are life-threatening. The serious adverse events most frequently reported were in the following body system categories: general disorders and administration site conditions, nervous system disorders, skin and subcutaneous tissue disorders, and musculoskeletal, connective tissue and bone disorders. Anaphylaxis and/or other generalized hypersensitivity reactions, as well as serious local reactions, were reported to occur occasionally following administration of BioThrax. None of these hypersensitivity reactions have been fatal. Other infrequently reported serious adverse events that have occurred in persons who have received BioThrax have included: cellulitis, cysts, pemphigus vulgaris, endocarditis, sepsis, angioedema and other hypersensitivity reactions, asthma, aplastic anemia, neutropenia, idiopathic thrombocytopenia purpura, lymphoma, leukemia, collagen vascular disease, systemic lupus erythematosus, multiple sclerosis, polyarteritis nodosa, inflammatory arthritis, transverse myelitis, Guillain-Barre Syndrome, immune deficiency, seizure, mental status changes, psychiatric disorders, tremors, cerebrovascular accident (CVA), facial palsy, hearing and visual disorders, aseptic meningitis, encephalitis, myocarditis, cardiomyopathy, atrial fibrillation, syncope, glomerulonephritis, renal failure, spontaneous abortion and liver abscess. Infrequent reports were also received of multisystem disorders defined as chronic symptoms involving at least two of the following three categories: fatigue, mood-cognition, musculoskeletal system. Reports of fatalities included sudden cardiac arrest (2), myocardial infarction with polyarteritis nodosa (1), aplastic anemia (1), suicide (1) and central nervous system (CNS) lymphoma (1). Adverse events following immunization with BioThrax should be reported to the Medical Affairs Division of BioPort Corporation (517) 327-1675 during regular working hours and (517) 327-7200 during off hours. Adverse events may also be reported to the U. S. Department of Health and Human Services (DHHS) Vaccine Adverse Event Reporting System. Report forms and reporting requirement information can be obtained from VAERS through a toll free number 1-800-822-7967.

Sera collected from vaccinated military personnel are being prepared for testing and potential future use.

Recent reports have shown that neutralizing antibody titers can serve as a reliable surrogate marker for protection against anthrax. Results suggest that both intranasal and subcutaneous route of immunization induce antibody generation against Protective Antigen (PA). Data presented show that immunization with PA intranasally raises considerable protective antibody response and can be a substitute for subcutaneous injection. Being non-invasive, intranasal immunization will be cost effective with negligible side effects and will be very suitable for mass immunization programs.

A mutant form of protective antigen known as dominant negative inhibitor (DNI), completely blocks toxin action. DNIs of protective antigen co-assemble with the wild-type protein and block its ability to translocate the enzymatic moieties across membranes. These mutants strongly inhibit toxin action in cell culture and in an animal intoxication model, suggesting that they could be useful in therapy of anthrax. DNIs not only stop the toxin, but they have the added advantage of eliciting an immune response, thereby boosting the immune system.

Protein-protein interactions can be inhibited by a synthetic, polymeric, polyvalent inhibitor in vivo. Designing and testing of a polyvalent inhibitor (PVI) of anthrax toxin that binds to heptameric PA63 and blocks its interaction with EF and LF has been reported. The anthrax PVI was constructed by linking 22 copies of an inhibitory peptide on a flexible, molecular, Velcro-like polyacrylimide backbone. Even though it is not known exactly where the inhibitory peptide binds, the flexibility of the polyacrylimide backbone increases the chance that at least one of the peptide copies will find the binding site.

A potential antitoxin strategy is based on soluble forms of the anthrax toxin receptor, the site on the surface of the host cell where the anthrax toxin binds. Binding of the toxin to its receptor can be blocked with soluble receptor or anti-Protective Antigen antibodies.

A panel of toxin-neutralizing antibodies have been engineered. High-affinity, recombinant anti-Protective Antigen antibodies may be of therapeutic value for alleviating the symptoms of anthrax toxin in infected individuals and may confer medium-term protection against the progression of anthrax infection. The research targets that late stage, which is beyond treatment and often fatal. The antibody developed by the University of Texas, dubbed 1H, binds with the protective antigen by offering it a more attractive docking surface than the blood cell. The resulting molecule is harmless and eventually clears from the body.

Disease results when Bacillus anthracis spores are introduced into the skin via inoculation of small cuts/abrasions or inapparent skin lesions. Endospores often are phagocytosed by macrophages and carried to regional lymph nodes, causing painful lymphadenopathy and lymphangitis. Low-level germination at the site of introduction leads to localized necrosis with eschar formation and soft-tissue or mucosal edema (which can be massive in some cases). Hematogenous spread with resultant toxemia can occur, although such spread is not common with appropriate antibiotic therapy.

1-7 days (may be as long as 12 days). Data from 21 patients infected in October 2001 indicate a 1-10 day (mean of 5 days) incubation period for cutaneous anthrax. Signs and symptoms become apparent within 5 days of exposure.

Case-fatality rate is currently less than 1% (most people recover with appropriate antimicrobial therapy). In preantibiotic era, case-fatality rates of about 20% were reported. The case fatality rate for untreated cutaneous anthrax is up to 20%, but with early, effective therapy is reduced to less than 5%.

Lymphangitis and painful lymphadenopathy may occur. Regional adenopathy is often an associated feature.

One outbreak in Thailand demonstrated the following cutaneous finding for 13 patients with cutaneous anthrax: Lymphadenopathy (100%).

Edema and necrosis ensues with little purulence noted, which is likely due to the inhibitory function of edema toxin on leukocytes. Edema out of proportion to vesicular size surrounds the lesion. Painless, localized, nonpitting edema surrounds ulcerated area. Malignant edema is rare complication and is characterized by severe edema, multiple bullae, and shock.

One outbreak in Thailand demonstrated the following cutaneous finding for 13 patients with cutaneous anthrax: Edema around lesion (77%).

Fever is often an associated feature.

Malaise is often an associated feature.

Initial lesion is small papule or vesicle (small, painless, often puritic papules). Evolving skin lesion (face, hands, neck, arms) generally ruptures near the end of the first week.

One outbreak in Thailand demonstrated the following cutaneous finding for 13 patients with cutaneous anthrax: Blister (92%).

Within 24 to 48 hours, the papules enlarge and become vesicular (usually, 1 to 2 cm in diameter). By the second day, the papule ulcerates with central necrosis and drying. Fine vesicles may encircle ulcer; these enlarge over next 1- 2 days and may discharge serosanguinous fluid.

One outbreak in Thailand demonstrated the following cutaneous finding for 13 patients with cutaneous anthrax: Ulcer (23%).

The remaining ulcer progresses to a black eschar. The eschar sloughs off in 2 to 3 weeks. After 1 to 2 days, painless black eschar forms over ulcerated area. Eschar sloughs off after 12-14 days.

Lesions resolve without complications or scarring in 80%-90% of patients. One outbreak in Thailand demonstrated the following cutaneous finding for 13 patients with cutaneous anthrax: Eschar (85%).

Differential diagnosis. Two key features that distinguish cutaneous anthrax from other conditions in the differential diagnosis are the painlessness of the lesion and the relatively large extent of the associated edema.

Cutaneous anthrax

These treatment recommendations were made during the US 2001 anthrax outbreak. In other settings, antimicrobial susceptibility testing should be used to guide therapy decisions. Adults: Ciprofloxacin, 500 mg PO twice daily or Doxycycline, 100 mg PO twice daily for 60 days. Children: Ciprofloxacin, 10-15 mg/kg PO every 12 hr, not to exceed 1 g/day or Doxycycline: >8 yr and >45 kg: 100 mg PO every 12 hr; >8 yr and <45 kg: 2.2 mg/kg PO every 12 hr <8 yr: 2.2 mg/kg PO every 12 hr for 60 days.

American Academy of Pediatrics recommends treatment of young children with tetracyclines for serious infections. Pregnant women: Same as for nonpregnant adults (high death rate from the infection outweighs risk posed by antimicrobial agent). Treat for 60 days. Although tetracyclines and ciprofloxacin are not recommended for pregnant women, their use may be indicated for life-threatening illness. Adverse effects on developing teeth and bones are dose-related; therefore, doxycycline might be used for a short time (7-14 days) before 6 mo of gestation. Immunocompromised persons: Same as for nonimmunocompromised persons and children for 60 days. Initial therapy is oral although, cutaneous anthrax cases with signs of systemic involvement, extensive edema, or lesions on the head or neck require intravenous therapy, and a multidrug approach is recommended. Ciprofloxacin or doxycycline should be considered first-line therapy. Amoxicillin (500 mg orally 3 times daily for adults or 80 mg/kg/day divided every 8 hr for children) is an option for completion of therapy after clinical improvement. Oral amoxicillin dose is based on need to achieve appropriate minimum inhibitory concentration. Treatment of cutaneous anthrax does not prevent the evolution of the skin lesions; however, it usually will prevent progression to systemic disease. In cases of naturally occurring cutaneous anthrax, previous recommendations have indicated that treatment for 7 to 10 days is adequate; however, in the setting where inhalational exposure is also likely, treatment should be continued for 60 days.

Cutaneous anthrax is the most common naturally occurring form accounting for more than 90 percent of all anthrax cases worldwide.

Naturally occurring cutaneous anthrax is uncommon in children, probably because children have less opportunity for exposure to infected animals. Other modes of transmission (such and person-to-person or transmission via fomites) may be more common for young children who acquire cutaneous anthrax. The clinical presentation of cutaneous anthrax in children usually is similar to the presentation in adults. Progression to severe systemic disease can occur.

Occurs when individuals working with animal hides, wool, or bonemeal, inhale the spores. Also, inhalation anthrax may occur from inhalation of aerosolized spores released during a biological weapon attack. Spore-bearing particles deposit in the alveolar spaces. Aerosolized anthrax spores >5 micrometer in size are deposited in the upper airways (pharynx, larynx, and trachea) and effectively trapped or cleared by the mucociliary system. Spores between 2 and 5 micrometer in size are able to reach the alveolar ducts and alveoli. Endospores are introduced into the body via inhalation. Endospores are 1 micrometer by 1.5 micrometer in size. Endospores are phagocytosed by macrophages and carried to regional lymph nodes. Spores then germinate inside macrophages and become vegetative cells, which leave the macrophages and multiply in the lymphatic system. Bacteria enter the bloodstream and lead to septic shock and toxemia; hematogenous spread can lead to hemorrhagic meningitis.

2-43 days (may be longer). Data from 21 patients infected in October 2001 indicate a 5-11 day (mean of 7 days) incubation period for inhalational anthrax is 1-5 days, and possibly, up to 60 days. Initial incubation period of ~11 days. The incubation for anthrax is hours to 7 days. Most cases present within 48 hours post-exposure.

Inhalational anthrax is expected to account for most serious morbidity and mortality. Illness may be biphasic, with an initial prodrome (that includes symptoms such as fever, malaise, fatigue, anorexia) followed by sudden increase in fever, severe respiratory distress, diaphoresis and shock, if left untreated. Case-fatality rate in Sverdlovsk outbreak: 86%, US outbreak: 45% (lower observed case-fatality rate in US outbreak likely due to early diagnosis and aggressive therapy). Almost all inhalation anthrax cases in which treatment was begun after onset of significantly severe symptoms have been fatal, regardless of treatment. Despite medical therapy, most patients with inhalation anthrax die within 24 hours of the onset of the acute phase of the illness. However, in nonhuman primate trials, animals have responded to aggressive therapy. Whereas the case-fatality of the previous 18 cases of inhalational anthrax in the US was 88%, the current rate among the current cases (11 cases) was 45%. This may reflect differences in dose or in the infecting strain or the institution of prompt and aggressive treatment for the recent cases. Once respiratory distress develops, mortality rates may approach 90%. Begin treatment when inhalational anthrax is suspected, do not wait for confirmatory testing. Limited data from the October 2001 infections indicate that early treatment significantly decreases the mortality rate.

Sudden appearance of several cases of severe acute febrile illness with fulminent course and death or acute febrile illness in persons identified as being at risk following a specific attack.

Abrupt onset of "flu-like" symptoms, fever, chills, severe malaise, non- or minimally productive cough, headache, dyspnea, chest pain, followed in 2 to 5 days by severe respiratory distress, pleural effusions, mediastinitis, hemorrhagic meningitis, sepsis, shock.

Fever and chills; alternatively, there may be hypothermia with the development of shock. Fever seen in first stage: insidious onset (1-4 days) and second stage: rapid deterioration (24 hours).

Observed fever and chills in 10 out of 10 patients with inhalational anthrax following US anthrax attacks in October to November 2001.

Sweats, often drenching, diaphoresis. Diaphoresis seen in second stage: rapid deterioration (24 hours).

Observed in 7 out of 10 patients with inhalational anthrax following United States anthrax attacks in October to November 2001.

Fatique, malaise, lethargy. Fatique and malaise seen in first stage :insidious onset (1-4 days).

Observed in 10 out of 10 patients with inhalational anthrax following United States anthrax attacks in October to November 2001.

Cough, minimal or nonproductive. Nonproductive cough seen in first stage: insidious onset (1-4 days).

Observed in 9 out of 10 patients with inhalational anthrax following United States anthrax attacks in October to November 2001.

Nausea or vomiting

Observed in 9 out of 10 patients with inhalational anthrax following United States anthrax attacks in October to November 2001.

Acute phase of severe respiratory distress with dyspnea, enlarged mediastinal lymph nodes may lead to partial tracheal compression and alarming stridor, and cyanosis. Enlarged lymph nodes may be directly visualized on chest computed tomography. Stridor, cyanosis and acute dyspnea seen in second stage: rapid deterioration (24 hours).

Observed dyspnea in 8 out of 10 patients with inhalational anthrax following United States anthrax attacks in October to November 2001. Abnormal chest computed tomographic scan was observed in 100% with mediastinal lymphadenopathy widening in 88% of patients with inhalational anthrax following US anthrax attacks in October to November 2001.

Chest discomfort or pleuritic pain, precordial pressure. Precordial pressure seen in first stage: insidious onset (1-4 days).

Observed in 7 out of 10 patients with inhalational anthrax following United States anthrax attacks in October to November 2001.

Myalgia. Seen in first stage: insidious onset (1-4 days).

Observed in 6 out of 10 patients with inhalational anthrax following United States anthrax attacks in October to November 2001.

Headache

Observed in 5 out of 10 patients with inhalational anthrax following United States anthrax attacks in October to November 2001.

Confusion

Observed in 4 out of 10 patients with inhalational anthrax following United States anthrax attacks in October to November 2001.

Abdominal pain

Observed in 3 out of 10 patients with inhalational anthrax following United States anthrax attacks in October to November 2001.

Sore throat

Observed in 2 out of 10 patients with inhalational anthrax following United States anthrax attacks in October to November 2001.

Pulmonary lymphatic drainage can be blocked, leading to pulmonary edema. True pneumonia rarely occurs, although a focal, hemorrhagic, necrotizing pneumonic lesion may be seen. Auscultation of the lungs is remarkable for crackles and signs of pleural effusions.

Sixty percent of the recent inhational cases had pulmonary effusions present, which were reported in a few of the previous cases in US. Abnormal chest radiograph was observed in 100% with pleural effusions observed in 88% of patients with inhalational anthrax following US anthrax attacks in October to November 2001. Abnormal chest computed tomographic scan was observed in 100% with pleural effusion in 100% of patients with inhalational anthrax following US anthrax attacks in October to November 2001.

Rhinorrhea

Observed in 1 out of 10 patients with inhalational anthrax following US anthrax attacks in October to November 2001.

Bacteremia and toxemia, septic shock, metastatic infection, and death. Septic shock and coma seen in second stage: rapid deterioration (24 hours).

Edema and lethal toxin cause massive hemorrhagic mediastinitis that is typical of inhalational anthrax. Regional hemorrhagic lymphadenitis of mediastinal and peribronchial lymph nodes causes the occurrence of hemorrhagic mediastinitis. Seen in second stage: rapid deterioration (24 hours).

Mediastinal widening on chest radiograph. Seen in second stage: rapid deterioration (24 hours).

Abnormal chest radiograph was observed in 100% with mediastinal widening in 70% and infiltrates, consolidation in 70% of patients with inhalational anthrax following United States anthrax attacks in October to November 2001. Abnormal chest computed tomographic scan was observed in 100% with infiltrates, consolidation in 75% of patients with inhalational anthrax following United States anthrax attacks in October to November 2001.

Meningismus. Seen in second stage: rapid deterioration (24 hours).

Meningitis in approximately 50% of the cases"

Median WBC count at presentation was 9,800/mm cubed (range: 7,500/mm cubed to 13,300/mm cubed). Peak WBC during illness was 26,400/mm cubed (range: 11,900/mm cubed to 49,600/mm cubed).

Differential WBC count for neutrophils (>70%). Neutrophil band forms present (>5%).

Observed Neutrophilia in 70% and bands in 40% of patients with inhalational anthrax following United States anthrax attacks in October to November 2001.

Elevated transaminases, SGOT or SGPT (>40 U/L)

Observed in 90% of patients with inhalational anthrax following United States anthrax attacks in October to November 2001.

Hypoxemia (alveolar-arterial oxygen gradient >30mm Hg on room air oxygen saturation <94%).

Observed in 60% of patients with inhalational anthrax following United States anthrax attacks in October to November 2001.

Metabolic acidosis

Observed in 20% of patients with inhalational anthrax following United States anthrax attacks in October to November 2001.

Features that distinguish inhalational anthrax from other conditions in the differential diagnosis include the presence of a widened mediastinum and pleural effusions on chest radiograph or CT with minimal evidence of pneumonia. Several features can be used to distinguish inhalational anthrax from influenza-like illness (ILI): Most patients with ILI have rhinorrhea, which is uncommon among patients with inhalational anthrax. Most patients with inhalational anthrax have shortness of breath, which is uncommon among patients with ILI. Nausea and vomiting are more common among patients with inhalational anthrax. Patients with inhalational anthrax are likely to have abnormalities on chest radiographs at the time of initial presentation, including mediastinal widening, infiltrates, and pleural effusion.

Inhalational anthrax

These treatment recommendations were made during the US 2001 anthrax outbreak. In other settings, antimicrobial susceptibility testing should be used to guide therapy decisions. Ciprofloxacin or doxycycline should be considered an essential part of first-line therapy for inhalational anthrax. Steroids may be considered an adjunct therapy for patients with severe edema and for meningitis based on experience with bacterial meningitis of other etiologies. Initial therapy may be altered based on clinical course of patient; one or two antimicrobial agents (eg, ciprofloxacin or doxycycline) may be adequate as patient improves. Initial IV Therapy: Adults: Ciprofloxacin, 400 mg every 12 hr or Doxycycline, 100 mg every 12 hr and One or two additional antimicrobials (agents with in vitro activity include rifampin, vancomycin, penicillin, ampicillin, chloramphenicol, imipenem, clindamycin, and clarithromycin). Children: Ciprofloxacin, 10-15 mg/kg every 12 hr, not to exceed 1 g/day or Doxycycline: >8 yr and >45 kg: 100 mg PO every 12 hr >8 yr and <45 kg: 2.2 mg/kg PO every 12 hr <8 yr: 2.2 mg/kg PO every 12 hr And One or two additional antimicrobials (see agents listed under therapy for adults). If intravenous ciprofloxacin is not available, oral ciprofloxacin may be acceptable because it is rapidly and well absorbed from gastrointestinal tract with no substantial loss by first-pass metabolism. Maximum serum concentrations are attained 1-2 hours after oral dosing but may not be achieved if vomiting or ileus is present. American Academy of Pediatrics recommends treatment of young children with tetracyclines for serious infections. Pregnant women: Same as for nonpregnant adults (high death rate from the infection outweighs risk posed by antimicrobial agent). Although tetracyclines are not recommended for pregnant women, their use may be indicated for life-threatening illness. Adverse effects on developing teeth and bones are dose-related; therefore, doxycycline might be used for a short time (7-14 days) before 6 months of gestation. Immunocompromised persons: Same as for nonimmunocompromised persons and children. Oral Regimens (continue therapy for 60 days [IV and PO combined]): Adults: Patients should be treated with IV therapy initially. Treatment can be switched to oral therapy when clinically appropriate: Ciprofloxacin, 500 mg PO twice daily or Doxycycline, 100 mg PO twice daily. Children: Patients should be treated with IV therapy initially. Treatment can be switched to oral therapy when clinically appropriate: Ciprofloxacin, 10-15 mg/kg PO every 12 hr, not to exceed 1 g/day or Doxycycline: >8 yr and >45 kg: 100 mg PO every 12 hr >8 yr and <45 kg: 2.2 mg/kg PO every 12 hr <8 yr: 2.2 mg/kg PO every 12 hr Pregnant women: Patients should be treated with IV therapy initially. Treatment can be switched to PO when clinically appropriate. Oral therapy regimens are the same as for nonpregnant adults. Immunocompromised persons: Same as for nonimmunocompromised persons and children.

If meningitis is suspected, doxycycline may be less optimal because of poor central nervous system penetration. Because of concerns of constitutive and inducible beta-lactamases in Bacillus anthracis isolates, penicillin and ampicillin should not be used alone. Consultation with an infectious disease specialist is advised. Other agents with in vitro activity include tetracycline, linezolid, macrolides, aminoglycosides, and cefazolin. B anthracis strains are naturally resistant to sulfamethoxazole, trimethoprim, cefuroxime, cefotaxime sodium, aztreonam, and ceftazidime.

Inhalational anthrax is uncommon in children. For example, none of the cases in the Sverdlovsk inhalational anthrax outbreak occurred in children and reports of inhalational disease among children are rare.

Adults (including immunocompromised patients): Ciprofloxacin, 500 mg PO twice daily or Doxycycline, 100 mg PO twice daily. Duration for 60 days. Pregnant women and breastfeeding mothers: Ciprofloxacin, 500 mg PO twice daily or Doxycycline, 100 mg PO twice daily [Amoxicillin, 500 mg orally three times daily, may be used if isolate involved in exposure is determined to be susceptible to penicillin]. Duration for 60 days. Children (including immunocompromised patients): Ciprofloxacin, 10-15 mg/kg PO every 12 hr, not to exceed 1 gm/day or Doxycycline: >8 yr and >45 kg: 100 mg PO every 12 hr >8 yr and <45 kg: 2.2 mg/kg PO every 12 hr <8 yr: 2.2 mg/kg PO every 12 hr for 60 days [Note: Amoxicillin, 80 mg/kg/day divided every 8 hr, not to exceed 500 mg/dose, may be used if the isolate involved in exposure is determined to be susceptible to penicillin]. Duration for 60 days.

Pathogenesis of gastrointestinal anthrax is not clear, since this condition is relatively rare. After intestinal absorption, bacteria are transported to mesenteric and other regional lymph nodes where there is multiplication and dissemination, development of hemorrhagic adenitis, ascites, and bacteremia. Like cutaneous anthrax, the gastrointestinal form of the disease presents within 5 days of ingestion of contaminated meat.

1-7 days (usually 2-5 days)

The case fatality rate for gastrointestinal anthrax is between 25% and 60%. The effect of early antibiotic treatment on outcome has not be studied. In the Thailand outbreak of oropharyngeal disease, the case fatality rate was 13%. In another report of 6 cases of pharyngeal anthrax, the case fatality rate was 50%. The prognosis for oropharyngeal and GI anthrax is poor, with case fatality rates 50 to 100 percent, even with aggressive therapy. Lethality approaches 100% if untreated but data is limited. Rapid, aggressive treatment may reduce mortality. If the patient survives, symptoms last about 2 wk.

Nausea

Headache

Observed in 100% of 143 patients in an outbreak in Uganda.

Vomiting (may be coffee-ground or blood-tinged).

Observed in 90% of 143 patients in an outbreak in Uganda.

Watery or bloody diarrhea.

Observed in 80%; bloody in only 5% of 143 patients in an outbreak in Uganda. Observed in 4% of 24 patients in an outbreak of oropharyngeal anthrax in Thailand. Diarrhea (4%).

Massive abdominal swelling (ascites) may develop 2-4 days after onset (fluid may be clear or purulent). Hematogenous spread with resultant toxemia can occur.

Abdominal pain or tenderness was observed in 85% of 143 patients in an outbreak in Uganda.

Hematemesis, hematochezia

Fever may be low-grade

Observed in 70% of 143 patients in an outbreak in Uganda. Observed in 96% of 24 patients in an outbreak of oropharyngeal anthrax in Thailand.

Necrotic ulcer or eschar involving the hard palate, tonsils, or posterior oropharyngeal wall and/or intestinal lesions.

Acute Phase. Observed mouth or pharyngeal ulcerative or necrotic lesions in 100% of 24 patients in an outbreak of oropharyngeal anthrax in Thailand (pseudomembranes also were noted in some patients). Observed bleeding from the mouth in 4% of 24 patients in an outbreak of oropharyngeal anthrax in Thailand.

Sore throat or difficulty swallowing (dysphagia), hoarseness, sensation of a "lump in throat".

Acute Phase. Observed sore throat, dysphagia in 63% of 24 patients in an outbreak of oropharyngeal anthrax in Thailand. Observed hoarseness in 8% of 24 patients in an outbreak of oropharyngeal anthrax in Thailand. Observed Sensation of a "lump in throat" in 8% of 24 patients in an outbreak of oropharyngeal anthrax in Thailand.

Edema of cervical tissues (possibly resulting in upper airway obstruction).

Acute Phase. Observed pharyngeal edema in 10% of 143 patients in an outbreak in Uganda. Observed neck swelling in 100% of 24 patients in an outbreak of oropharyngeal anthrax in Thailand. Observed respiratory distress in 25% of 24 patients in an outbreak of oropharyngeal anthrax in Thailand.

(Cervical or regional lymphadenopathy)

Acute Phase

Septic shock and death

Median WBC count for 13 patients with oropharyngeal anthrax in Thailand outbreak was 15,635/mm cubed (range: 5,100/mm cubed to 30,570/mm cubed).

Mean percentage of neutrophils was 79.6% (range, 73% to 91%).

Oropharyngeal and Gastrointestinal anthrax

These treatment recommendations were made during the United States 2001 anthrax outbreak. In other settings, antimicrobial susceptibility testing should be used to guide therapy decisions. Ciprofloxacin or doxycycline should be considered an essential part of first-line therapy for inhalational anthrax. Steroids may be considered an adjunct therapy for patients with severe edema and for meningitis based on experience with bacterial meningitis of other etiologies. Initial therapy may be altered based on clinical course of patient; one or two antimicrobial agents (eg, ciprofloxacin or doxycycline) may be adequate as patient improves. Initial IV Therapy: Adults: Ciprofloxacin, 400 mg every 12 hr or Doxycycline, 100 mg every 12 hr and One or two additional antimicrobials (agents with in vitro activity include rifampin, vancomycin, penicillin, ampicillin, chloramphenicol, imipenem, clindamycin, and clarithromycin). Children: Ciprofloxacin, 10-15 mg/kg every 12 hr, not to exceed 1 g/day or Doxycycline: >8 yr and >45 kg: 100 mg PO every 12 hr >8 yr and <45 kg: 2.2 mg/kg PO every 12 hr <8 yr: 2.2 mg/kg PO every 12 hr And one or two additional antimicrobials (see agents listed under therapy for adults). If intravenous ciprofloxacin is not available, oral ciprofloxacin may be acceptable because it is rapidly and well absorbed from gastrointestinal tract with no substantial loss by first-pass metabolism. Maximum serum concentrations are attained 1-2 hours after oral dosing but may not be achieved if vomiting or ileus is present. American Academy of Pediatrics recommends treatment of young children with tetracyclines for serious infections. Pregnant women: Same as for nonpregnant adults (high death rate from the infection outweighs risk posed by antimicrobial agent). Although tetracyclines are not recommended for pregnant women, their use may be indicated for life-threatening illness. Adverse effects on developing teeth and bones are dose-related; therefore, doxycycline might be used for a short time (7-14 days) before 6 months of gestation. Immunocompromised persons: Same as for nonimmunocompromised persons and children. Oral Regimens (continue therapy for 60 days [IV and PO combined]): Adults: Patients should be treated with IV therapy initially. Treatment can be switched to oral therapy when clinically appropriate: Ciprofloxacin, 500 mg PO twice daily or Doxycycline, 100 mg PO twice daily. Children: Patients should be treated with IV therapy initially. Treatment can be switched to oral therapy when clinically appropriate: Ciprofloxacin, 10-15 mg/kg PO every 12 hr, not to exceed 1 g/day or Doxycycline: >8 yr and >45 kg: 100 mg PO every 12 hr >8 yr and <45 kg: 2.2 mg/kg PO every 12 hr <8 yr: 2.2 mg/kg PO every 12 hr Pregnant women: Patients should be treated with IV therapy initially. Treatment can be switched to PO when clinically appropriate. Oral therapy regimens are the same as for nonpregnant adults. Immunocompromised persons: Same as for nonimmunocompromised persons and children.

May occur as complication of cutaneous, inhalational, or gastrointestinal anthrax and symptoms of primary site of infection usually will be present; however, meningitis may be the presenting illness.

Varies according to primary source of infection

Illness is generally fatal. Death usually occurs 1 to 6 days after illness onset

Characteristic features of bacterial meningitis include fever, nuchal rigidity, headache, change in mental status, seizures.

Report of two cases demonstrated elevated WBC counts in both patients at presentation (24,000 with 84% neutrophils and 18,000 with 90% neutrophils).

Meningeal involvement is usually bloody and may be associated with subarachnoid hemorrhage.

Meningeal involvement in up to 50% of cases.

Anthrax meningitis has been reported in children and may be the presenting feature.

The guinea pig has been the animal model most often used to test anthrax vaccine efficacy.

Golden Syrian hamsters were used in vaccine efficacy studies and reported that they were well protected by vaccination with the STI-1 Russian human live vaccine against challenge by the virulent B. anthracis H-7 isolate. However, golden Syrian hamsters were not a good model for studying the efficacy of the current US human anthrax vaccine, anthrax vaccine adsorbed (AVA).

The inbred BABL/c mice were also used in anthrax research.

Cattle

Bos taurus

Sheep

Ovis aries

Goat

Capra hircus

Pig

Sus scrofa

American bison

Bison bison

Water Buffalo

Bubalus bubalis

Livestock or other herbivores (eg, cattle, sheep, goats, pigs, bison, water buffalo) acquire infection from consuming contaminated soil or feed.

Syrian hamster

Mesocricetus auratus

Syrian hamsters have been used as model animals for anthrax research.

Guinea pig

Cavia porcellus

Guinea pig has been used as a model system for anthrax research.

Mouse

Mus musculus

A variety of mice have been used as model animals for anthrax research.

Biosafety Level 2

Biosafety Level 2 practices, containment equipment, and facilities are recommended for activities using clinical materials and diagnostic quantities of infectious cultures. Animal Biosafety Level 2 practices, containment equipment, and facilities are recommended for studies utilizing experimentally infected laboratory rodents. The B. anthracis cells present in clinical samples are primarily vegetative, which are not easily transmitted to laboratory workers. However, most hospital laboratories are not sufficiently staffed, trained, or equipped for environmental testing. The recent case of cutaneous anthrax in a laboratory worker illustrates this potential. The agent may be present in blood, skin lesion exudates, cerebrospinal fluid, pleural fluid, sputum, and rarely, in urine and feces. Direct and indirect contact of the intact and broken skin with cultures and contaminated laboratory surfaces, accidental parenteral inoculation, and rarely, exposure to infectious aerosols are the primary hazards to laboratory personnel.

Because sporulation of B. anthracis requires oxygen and therefore does not occur inside a closed carcass, regulations in most countries forbid postmortem examination of animals when anthrax is suspected. If heat treatment or incineration of the contaminated material is possible, this should be done in preference to chemical decontamination and disinfection. For certain materials or animal by-products, irradiation with gamma rays or particle bombardment or fumigation with a gaseous disinfectant such as ethylene oxide may be appropriate. In fatal human cases, postmortem should be discouraged; cremation is preferable to burial where local custom permits. Bedding and contaminated materials should be bagged and incinerated, autoclaved (121+1 degree C core temperature for 30 min) or fumigated as appropriate. Whether room fumigation is necessary will depend on the perceived level of contamination in the room where the patient died. Immersion in 4% formaldehyde (10% formalin) for >12 hours is an alternative but full penetration of the fluids must be ensured. Disinfection of contaminated surfaces involves a three-step approach aimed at (i) preliminary disinfection, (ii) cleaning, and (iii) final disinfection. Preliminary disinfection: One of the following disinfectants may be used in amounts of 1-1.5 liters per square meter for an exposure time of 2 hours: 10% formaldehyde (approximately 30% formalin), 4% glutaraldehyde (pH 8.0-8.5), or a high pressure cleaner may be used but, to avoid spreading the contamination, the pressure should not exceed 10 bar. Cleaning: Where practical, cleaning of all surfaces should be done by straightforward washing and scrubbing using ample hot water. The operator should wear protective clothing, face and hands included. Cleaning should be continued till the original colors and surfaces are restored and the waste water is free of dirt particles. At the end of the process, residual water should be removed and the surfaces dried. High pressure cleaners are again discouraged because of the greater potential to spread the contamination through aerosols. If used, however, the water jet should be applied at a pressure of 80-100 bar delivering 13-15 litres/minute. Final disinfection: One of the following disinfectants should be applied at a rate of 0.4 liters per square meter for an exposure time of at least 2 hours: 10% formaldehyde (approximately 30% formalin), 4% glutaraldehyde (pH 8.0-8.5), 3% hydrogen peroxide, or 1% peracetic acid.

Biosafety Level 3

Biosafety Level 3 practices, containment equipment, and facilities are recommended for work involving production quantities or concentrations of cultures, and for activities with a high potential for aerosol production including suspect powders. The agent may be present in blood, skin lesion exudates, cerebrospinal fluid, pleural fluid, sputum, and rarely, in urine and feces. Direct and indirect contact of the intact and broken skin with cultures and contaminated laboratory surfaces, accidental parenteral inoculation, and rarely, exposure to infectious aerosols are the primary hazards to laboratory personnel.

Spores germinate when they enter an environment rich in amino acids, nucleosides, and glucose, such as that found in the blood or tissues of an animal or human host. The rapidly multiplying vegetative bacilli will only form spores after local nutrients are exhausted, such as when anthrax-infected body fluids are exposed to ambient air.

Rapid growth on sheep blood agar (SBA); Grows well on blood agar plates within 18-24 hours. Growth on SBA or equivalent medium forms spores which are not encapsulated. SBA can be used for cutaneous swab , stool, and sputum specimens. For primary growth media, B. anthracis grows well on SBA but does not grow on MacConkey agar (MAC). MacConkey agar can be used for cutaneous swab and stool samples. Phenyl ethyl alcohol agar (PEA) can be used for stool samples. Chocolate agar (CA) can be used for sputum samples. Tryptic soy broth (TSB) can be used for wet mount procedure. Conventional broth or agar MIC (minimum inhibitory concentration) determinations currently appear to be the most reliable methods for determining susceptibility of B. anthracis.

The optimal growth temperature for the organism is 35 degrees celcius. Spores grow readily on all ordinary laboratory media at 37 degrees celcius. The organism generally exists in the endospore form in nature; germination of spores outside an animal host may occur when the temperature is between 8 degrees celcius and 45 degrees celcius and presence of adequate nutrients.

When grown above 45 degrees celcius, the bacteria becomes attenuated or avirulent due to loss of the capsule.

12 degrees celcius

Germination of spores outside an animal host may occur when the relative humidity is >95%.

Germination of spores outside an animal host may occur when the pH between 5 and 9.

pH 7.4

pH 7.0

Comma-shaped projections may give "Medusa head" appearance on Sheep Blood Agar. Colonies have been described as having a ground-glass appearance and the consistency of beaten-egg whites. Colonies are 2 to 5 mm in diameter after 16 to 18 hours of incubation. Forms mucoid capsule when grown on agar with sodium bicarbonate and incubated in carbon dioxide -enriched atmosphere; capsule can be visualized with India ink preparation. On culture, plated colonies are usually large (4 to 5 mm), opaque, and irregular, with characteristic comet tail protrusions. Disturbed sections of the colony often stand up like "beaten egg whites". Oxygen is needed for sporulation but not germination of spores. Spores grow in culture plates, soil, and tissue of dead animals. They do not form in the blood or tissues of infected living animals.

Direct examination of bacterial micromorphology may demonstrate broad encapsulated gram-positive rods (approved for Level A laboratories). Gram stain can be performed on appropriate clinical specimens (eg, vesicular fluid, swabs from cutaneous lesions, cerebrospinal fluid (CSF), pleural fluid, peritoneal fluid, sputum or oropharyngeal ulcers). Two positive Gram stain findings, one from CSF and buffy-coat smear, recently were reported in cases of inhalational anthrax. Gram's stains of the vesicular fluid may show rare leukocytes and Gram-positive rods. The organism appears to be present in large numbers in advanced cases, which suggests the probable utility of direct smears in those presenting with advanced disease. Endospores and free spores can be seen in cultures and generally are not seen in direct microscopic examination of patient samples.

The sensitivity of the Gram stain and other biologic stains (eg, H&E, silver stain) for direct detection of anthrax cells in infected tissues or blood has not been established.

Buffy-coat smears may be positive in patients with bacteremia. The specific usefulness of buffy coat for early diagnosis of bacteremia has been out of favor owing to early reports of low predictive value, but its use for anthrax has not been adequately studied.

India ink staining can be performed for capsule visualization directly on clinical specimens. Used to improve visualization of encapsulated B. anthracis in clinical samples such as blood, blood culture bottles, or cerebrospinal fluid. The capsule will appear as a well-defined clear zone around the cells.

A negative result should not be used to rule out B. anthracis. Interpretation of results requires trained/experienced staff.

Direct immunofluorescent assays (DFA) for cell-wall-associated polysaccharide and capsule produced by vegetative cells (demonstration of both antigens provides confirmatory identification). Included in Standard confirmatory testing (performed by Level B or C laboratories).

B. anthracis is characterized by the absence of hemolysis on sheep blood agar, lack of motility, absence of salicin fermentation, gelatin hydrolysis, and lack of growth on phenylethyl alcohol medium. Susceptible to lysis by gamma phage (provides confirmatory testing when demonstrated concomitantly with the presence of a capsule). Included in standard confirmatory testing (performed by Level B or C laboratories).

Nasal swab cultures were used in the 2001 United States outbreak as an epidemiologic tool to assess exposure to inhalational anthrax; however, nasal swabs are not recommended for use in the clinical setting. According to CDC, collection of nasal swabs is not indicated to: diagnose anthrax, determine risk of exposure and the need for antimicrobial prophylaxis, determine when antimicrobial prophylaxis should be stopped, or supplement random environmental sampling. Although nasal swabs should not be used to determine the need for antimicrobial prophylaxis, if a swab is performed for some reason and is positive, then the patient should receive a course of postexposure antibiotics, since a positive nasal swab indicates exposure to aerosolized B. anthracis.

Culture of clinical specimens is the "gold standard" for diagnosis of anthrax (initial isolation approved for Level A laboratories). Culture a stool and blood sample for diagnosis of gastrointestinal anthrax. Culture should be performed using standard 5% sheep blood agar. Motility is measured by wet mount (working in a BSL-2 cabinet) or by motility test medium. Spores are visualized by Gram stain from cultures incubated without CO2. India ink for demonstration of capsule can be used on cultures grown on media supplemented with sodium bicarbonate. Suspicious isolates should be forwarded to a Level B or C laboratory for confirmatory identification. Blood culture sensitivity is compromised when samples are collected after administration of even one or two doses of antibiotics; therefore, cultures should be obtained before antibiotic therapy is initiated. If antibiotics have been administered, alternate diagnostic methods should be considered. The most useful microbiologic test is the standard blood culture, which should show growth in 6 to 24 hours but cultures must be obtained before initiation of antibiotic therapy.

Standard confirmatory testing performed by Level B or C laboratories include wet mount and malachite green stain.

Performed at Level C and D laboratories, should be performed on clinical isolates. National Committee for Clinical Laboratory Standards (NCCLS) standard protocols for broth microdilution have been used with staphylococcal breakpoints. Concerns about penicillin use hinge on potential inducible penicillinases and poor penetration into macrophages.

Widened mediastinum, infiltrates, pleural effusion

Hemorrhagic pleural effusions

Hyperdense hilar and mediastinal nodes, mediastinal edema, infiltrates, pleural effusion.

A two-step enzyme-linked immunosorbent assay (ELISA), which measures antibody directed against protective antigen (PA). Serologic testing (performed at Level D laboratories) can be used for retrospective diagnosis. Development of measurable antibodies in recent cases required 10 to 16 days after onset of overt disease, but peak IgG levels may not be seen until 40 days after symptom onset. Serum should be collected during acute illness, and 14, 28, 42, and 60 days after onset. Requests for serologic testing can be made through the LRN or by contacting CDC.

The first-stage assay has been reported to be 80% specific; the specificity increases after competitive blocking by PA. This test is still considered investigational.

The first-stage assay has been reported to be 98.6% sensitive. This test is still considered investigational.

Used for rapid detection of B anthracis antigens. Is under investigation at level C and D laboratories.

The specificity of these tests is generally unknown or unpublished owing to the scarcity of cases. In addition, access to certain detection protocols is controlled through the Laboratory Response Network.

The sensitivity of these tests is generally unknown or unpublished owing to the scarcity of cases. In addition, access to certain detection protocols is controlled through the Laboratory Response Network.

A sensitive and specific method for detection of B anthracis in affected tissues utilizing antibody directed against cell wall and capsule components. This test is unaffected by prior administration of antibiotics or formalin fixation. IHC used in pathologic examinations of experimentally infected animals and in recent human cases was more sensitive than standard staining methods. IHC is not widely available, but requests for testing can be made through the LRN. Generally performed by Level C or D laboratories. Consider punch biopsy for immunohistochemical testing if the patient has received antibiotics or has a negative Gram stain and culture, despite high index of suspicion for anthrax.

"Smart ticket" is commercially available. Detection technology is Embedded flow immunochromatography. The test, targets spore antigen. Turnaround time is <5 minutes. Currently used on surfaces and powders. NO published validation. Detection limits are unknown. Centers for Disease Control does not have enough scientific data to recommend the use of these assays. Until validation testing is complete and guidelines for effective use are developed, PCR- or immune-based assay results for B anthracis should not be used alone, but should be confirmed with samples analyzed by culture methods to make public health decisions.

"Guardian bio-threat alert test-strips" are commercially available. Detection technology is Lateral flow immunochromatography. The test target is single, unspecified. Turnaround time is <15 minutes. Currently used in the environment. NO published validation. Detection limits are unknown. Until validation testing is complete and guidelines for effective use are developed, PCR- or immune-based assay results for B anthracis should not be used alone, but should be confirmed with samples analyzed by culture methods to make public health decisions.

The Canary, which is being developed at the Massachusetts Institute of Technology Lincoln Laboratory, is an innovative example of the devices that detect pathogens based on unique surface molecules. The sensors consist of B cells of the immune system that have been genetically altered to emit light when their calcium levels change.

Anthrax spores are packed full of dipicolinic acid (DPA). Molecules that fluoresce when bound to DPA have shown promise in chemically based anthrax detectors. The Cyranose detection system made by Cyrano Sciences in Pasadena, Calif., could possibly "smell" the presence of DPA in an air sample laced with anthrax spores.

Researchers at Northwestern University in Evanston, Illinois, report creating simple nano-scale electronic chips that can detect DNA from anthrax and other organisms in minutes. An unusual salt concentration-dependent hybridization behavior associated with these nanoparticle probes was exploited to achieve selectivity without a thermal-stringency wash. The chips appear to be vastly more sensitive than other high-speed techniques. And, unlike many such tests, they don't rely on the polymerase chain reaction. The method was used to detect target DNA at concentrations as low as 500 femtomolar with a point mutation selectivity factor of ~ 100,000:1.

PCR-based assays, such as those developed by Centers of Disease Control and the Mayo Clinic. PCR is still considered investigational and should be used in conjunction with standard culture. Both assays have the potential for detecting anthrax in samples collected after antibiotic treatment and have the potential for rapid culture identification. Generally performed by Level C or D laboratories. Polymerase chain reaction (PCR) of buffy-coats has been successfully used for diagnosis of other bloodstream infections both before and after antibiotic treatment.

Commercial/Investigational anthrax-specific tests for environmental sampling. Center for Disease Control molecular-based assays are available through the Laboratory Response Network but are investigational. Detection technology is "Real-time" PCR; SmartCycler and Light Cycler platforms. The test, targets sequences on pOX1, pOX2, and the chromosome. Turnaround time is <1 hour. Currently used for the environment and clinical samples. Published validation is in progress. Detection limits are unknown. Until validation testing is complete and guidelines for effective use are developed, PCR- or immune-based assay results for B anthracis should not be used alone, but should be confirmed with samples analyzed by culture methods to make public health decisions.

Specificity is 100%

Sensitivity is 10 spores

Commercial/Investigational anthrax-specific tests for environmental sampling. Mayo Clinic/Roche Light Cycler assays are investigational. Detection technology is "Real-time" PCR; Light Cycler platform. The test, targets sequences on the Lethal Factor (lef) gene on pOX1 and Protective Antigen gene (pag) on pOX2. Turnaround time is <1 hour. Currently used not specified. NO published validation. Detection limits are unknown. Until validation testing is complete and guidelines for effective use are developed, PCR- or immune-based assay results for B anthracis should not be used alone, but should be confirmed with samples analyzed by culture methods to make public health decisions.

Unknown

The University of South Florida and The Center for Biological Defense has developed a new method to more safely and rapidly detect anthrax in powders and on surfaces. The new sample method reduces the time needed to detect even traces of anthrax from three to four days to six to eight hours. The technique combines three simple processes- germination, sonication, and autoclaving- to prepare a sample for molecular identification by PCR and confirmation of B anthracis. This method detects less than 10 anthrax spores per sample and may even detect as few as 1 or 2 spores. Until validation testing is complete and guidelines for effective use are developed, PCR- or immune-based assay results for B anthracis should not be used alone, but should be confirmed with samples analyzed by culture methods to make public health decisions.

Unknown

The GeneXpert system, developed by Cepheid, in Sunnydale, Calif., is an example of a gene-centered approach to detection. Inside the cartridge, sound waves bombard material to be tested, causing any cells to break open and release DNA. If a pathogen of interest is present, its DNA will be amplified in the reaction tube, and the edges of the arrowhead will fluoresce. Results within approximately 30 minutes.

Redmond company/Genelex has developed an "anthrax sniffer" air monitoring device. The anthrax monitor sucks in twice as much air as a human does. It will catch tiny particles in a vial of fluid that, for safety's sake, will kill any deadly bacteria. Each day, the vial gets sent to Genelex for high-speed DNA sampling. Within hours, the lab would know if anthrax spores are present. Genelex says its air monitor can find as few as 50 spores. This product has not been scientifically or independently tested. The Centers for Disease Control does not recommend or endorse any particular anthrax detectors.

A mass-screening protocol for the diagnosis of anthrax from nasal swabs based on an enrichment step in liquid medium was devised. Incubation for growth was performed in autoclavable vials and racks which allow real-time PCR analysis of sterilized cultures. A dual-color PCR was set up with primers and probes for the chromosomal marker rpoB and the plasmid marker lef. Specific primer and probe sets were designed for the differentiation of Bacillus anthracis from B. cereus and for the differentiation of the Sterne vaccine strain from field isolates and the Ames strain, which was used in the recent anthrax bioterrorist attack. The present protocol thus combines the high specificity and sensitivity of real-time PCR with excellent biosafety and the low hands-on time necessary for the processing of large numbers of samples, which is extremely important during control programs involving the processing of large numbers of samples.

TTTTTATGACAAGAAATATTGCCTTT CAGCTTCCTCCCCTTTTACTTC

TGTACAGGGGGCGGGCGGTC

TTGAGTGGTCCCGTCTTTATCCCCC

TTGCTTGAAATTTATGAGCGTCTAC ATTGTTCCTTCTGCCGCTAAAA

TGTAGGTCGCTACAAGATCAACAAG

AAGCGCTATGATTTAGCAA

TATGTCATCTTTCTTTGGCTCAATAG TTTATGCACCGGAAGCTTTTAA

CAACGGATGCTGTCAAGATATG

AAATGGGAAAAGATAAAACAGCACTATCA

A TaqMan real-time PCR for identification of B. anthracis was developed, based on the two plasmids, pX01 and pX02, both of which are necessary for pathogenicity, as well as on the chromosomally encoded rpoB gene. Bacteria picked from colonies or pelleted from liquid cultures were directly inoculated into the PCR mix, thus avoiding time-consuming DNA preparation and minimizing handling risks. B. anthracis spores were cultivated for a few hours in enrichment broth before PCR analysis, or used directly for real-time PCR, thus allowing to confirm or exclude potential attacks approximately 23 h after the material has arrived in the laboratory.

CCACCAACAgAAAATgCC AAATTTCACCAgTTTCTggATCT

ACTTGTGTCTCGTTTCTTCGATCCAAAGCG

CGGATCAAGTATATGGGAATATAGCAA CCGGTTTAGTCGTTTCTAATGGAT

CTCGAACTGGAGTGAAGTGTTACCGCAAAT

ACGTATGGTGTTTCAAGATTCATG ATTTTCGTCTCATTCTACCTCACC

CCACGGAATTCAAAAATCTCAAATGGCAT

A 277-bp long DNA fragment, Ba813, was isolated from an avirulent Bacillus anthracis strain 7700 genomic library. Two oligonucleotides derived from the Ba813 sequence were used as primers in polymerase chain reaction tests on genomic DNA from 28 Bacillus anthracis and from 33 heterologous bacteria strains. A specific, 152-bp long DNA fragment was amplified only when Bacillus anthracis DNA was used as the target. The amplified product was analysed by non-radioactive sandwich hybridisation in microtiter plates using two oligonucleotides. The capture oligonucleotide C1 was covalently linked onto aminated wells of microtiter plates. The detection oligonucleotide D3 was labelled with biotin. The hybrid molecules were detected by avidin conjugated with alkaline phosphatase and chromogenic substrate. Amplification of Ba813 sequence may provide the basis for rapid and reliable assay for the detection and identification of Bacillus anthracis.

TTAATTCACTTGCAACTGATGGG AACGATAGCTCCTACATTTGGAG

Bacillus anthracis can be identified on the basis of the detection of virulence factor genes located on two plasmids, pXO1 and pXO2. Thus isolates lacking both pXO1 and pXO2 are indistinguishable from closely related B. cereus group bacteria. A multiplex PCR assay for characterization of B. anthracis isolates, and simultaneous confirmation of the species identity independent of plasmid content was developed. The assay amplifies lef, cya, pag (pXO1) and cap (pXO2) genes, and a B. anthracis specific chromosomal marker, giving an easy-to-read profile. This system unambiguously identified virulent (pXO1+/2+) and avirulent (pXO1+/2-, pXO1-/2+ and pXO1-/2-) strains of B. anthracis and distinguished `anthrax-like' strains from other B. cereus group bacteria.

CAGAATCAAGTTCCCAGGGG TCGGATAAGCTGCCACAAGG CTACAGGGGATTTATCTATTCC ATTGTTACATGATTATCAGCGG CAGCATGCGTTTTCTTTAGC CCCTTAGTTGAATCCGGTTT GGTTTAGTACCAGAACATGC CGGCTTCAAGACCCC GGATATGAACCCGTACTTGTAA TAAATCCGCACCTAGGGTTGC CTTTTGCATATTATATCGAGC GAATCACGAATATCAATTTGTAGC GAAATAGTTATTGCGATTGG GGTGCTACTGCTTCTGTACG ACTCGTTTTTAATCAGCCCG GGTAACCCTTGTCTTTGAAT TTAATTCACTTGCAACTGATGGG AACGATAGCTCCTACATTTGGAG

Commercial fatty-acid analysis, molecular sequencing, molecular subtyping (multilocus variable-number tandem repeat analysis [MLVA]), used by the Centers for Disease Control and others for strain tracking.

Ramirez

D. M.

Leppla

S. H.

Schneerson

Shiloach

Production, recovery and immunogenicity of the protective antigen from a recombinant strain of Bacillus anthracis.

Journal of Industrial Microbiology and Biotechnology

2002 28 4 232 238

Pannucci

Okinaka

R. T.

Sabin

Kuske

C. R.

Bacillus anthracis pXO1 plasmid sequence conservation among closely related bacterial species.

Journal of Bacteriology

2002