I. Organism Information

A. Taxonomy Information

1. Species:
   1. Rickettsia typhi (NCBI Taxonomy Browser):
      1. GenBank Taxonomy No.: 785
      2. Description: Like other Gram-negative bacteria, typhus rickettsiae are members of the alpha-group of the purple bacteria. Along with the families Bartonellaceae and Anaplasmatacease, they are members of the order Rickettsiales and the family Rickettsiaceae. The tribe Rickettsieae now has two genera, Rickettsia and Orientia. The genus rickettsia is divided into spotted fever and typhus groups. The typhus group consists of R. prowazekii, R. typhi, R. canada and R. felis (Sexton et al., 1998). Rickettsia typhi, the causative agent of murine typhus, is an obligate intracellular bacterium with a life cycle involving both vertebrate and invertebrate hosts. The rickettsiae are small (ca. 0.4 by 0.9 um), gram-negative, aerobic, coccobacillary, alpha-proteobacteria. R. typhi is one of the leading causes of rickettsioses in the world. Although distributed worldwide, it is most common in warm coastal areas with large rat populations. Rickettsia are classified into two groups; the spotted fever group (SFG), which includes R. conorii, R. sibirica, and R. rickettsii, and the typhus group, which includes R. prowazekii and R. typhi (McLeod et al., 2004). Murine typhus is a zoonosis whose enzootic cycle in nature involves vertebrate hosts (mainly commensal rodents) and arthropod vectors fleas (Siphonaptera) and lice (Phthiraptera) (Azad et al., 1988) Synonyms: Rickettsia mooseri and Dermacentroxenus typhi (NCBI Taxonomy Browser)
      3. Variant(s):
         • Rickettsia typhi str. Wilmington :
           • GenBank Taxonomy No.: 257363
           • Parent: Rickettsia typhi
           • Description: Synonym: Rickettsia typhi ATCC VR-144 (NCBI Taxonomy Browser) R. typhi Strain Wilmington. Source: Human. Geographic Location: North Carolina (Roux et al., 1997).

B. Lifecycle Information :

1. Rickettsia typhi Cell (McLeod et al., 2004):
   1. Size: 0.4 by 0.9 um (McLeod et al., 2004) 0.4 by 1.3 um (Azad et al., 1990)
   2. Shape: Rod (NCBI genome Project)
   3. Picture(s):
      1. American Society for Microbiology-MicrobeLibrary.org (American Society for Microbiology-MicrobeLibrary.org):
         
         
         
         Description: Following the release from the phagosomes, rickettsia grow free in the cytoplasm of cultured cells, dividing by binary fission (seen at arrows). Inset highlights the outer and inner membranes of rickettsia (American Society for Microbiology-MicrobeLibrary.org).
         
   4. Description: Members of the genus rickettsia are small, typical gram-negative coccobacilli measuring approximately 0.7-1.0 um in length by 0.3-0.5 um in width (Hackstadt et al., 1996).


2. Description: Rickettsia typhi, the causative agent of murine typhus, is an obligate intracellular bacterium that infects endothelial cells in mammalian hosts and midgut epithelial cells in the flea host. As typical for the genus Rickettsia, R. typhi contains rickettsial outer membrane protein B (OmpB), a member of the Sca protein family, a surface array protein similar to that present in other gram-negative bacteria and in gene D, and a gene that encodes a 17-kDa predicted lipoprotein. Moreover, it lacks the presence of rickettsial outer membrane protein A (OmpA), a characteristic of spotted fever group rickettsiae. In addition, R. typhi contains an invasin-related hemolysin gene, tlyC. These organisms are well adapted for intracellular life, and within the host cell, R. typhi stimulates host actin polymerization poorly and remains relatively nonmotile, allowing accumulation to significant numbers before the occurrence of mechanical host cell lysis and spread (Dumler et al., 2005).
3. Rickettsia typhi hosts
   
   
   
   Description: Murine typhus is a zoonosis maintained in nature through a cycle involving mainly commensal rodents and their ectoparasites. The classical transmission cycle for murine typhus is rat-flea-rat and accidentally rat-flea-man. Transmission to the vertebrate host presumably results from contamination of the broken skin, respiratory tract, or conjunctivae of the host with infected flea feces or flea tissues. It is usually transmitted to man by the combination of the bite site or skin abrasions with Rickettsia-containing flea feces. The R. typhi life cycle involves intracellular multiplication in both invertebrate and vertebrate hosts and includes the following steps: (a) obligate blood feeders such as adult fleas acquire rickettsiae from rickettsemic vertebrate hosts when taking a blood meal; (b) rickettsiae undergo massive replication within the arthropod host; and (c) after an appropriate incubation period in the flea, rickettsiae are transmitted back to a susceptible vertebrate host upon subsequent feeding (Azad et al., 1990). The classic cycle of R. typhi, the etiologic agent of murine typhus, involves rats (Rattus rattus and R. norvegicus) and the rat flea, Xensopsylla cheopis. The flea has been considered the main vector, and the disease is transmitted by flea bites or contact with rickettsia-containing feces and tissues during or after blood feeding. Although the rat-flea-rat cycle is still the major route of human infection throughout the world, murine typhus exists in some endemic-disease foci where both rats and rat fleas are absent (Azad et al., 1997).
   

C. Genome Summary:

1. Genome of Rickettsia typhi (McLeod et al., 2004):
1. Description: The annotated R. typhi genome sequence has been deposited in GenBank and assigned accession number AE017197 (McLeod et al., 2004).
2. Circular chromosome (NCBI genomes):
   1. GenBank Accession Number: NC_006142 AE017197
   2. Size: 1,111,496 nucleotides (NCBI_genomes).
   3. Gene Count: 838 proteins (McLeod et al., 2004)
   4. Description: The complete genome sequence of R. typhi (1,111,496 base pairs) has been sequenced. The number of genes was 877 genes encoding 3 rRNAs, 33 tRNAs, 3 noncoding RNAs, and 838 proteins. The three rickettsial genomes R. prowazekii, R. conorii and R. typhi share 775 genes: 23 are found only in R. prowazekii and R. typhi, 15 are found only in R. conorii and R. typhi, and 24 are unique to R. typhi (McLeod et al., 2004).
   5. Picture(s):
      1. Circular genome map of R. typhi (McLeod et al., 2004):
         
         
         
         Description: Annotated genome and supplemental data (Annotated genome and supplemental data) download data from FTP site
         

II. Epidemiology Information

Murine typhus is a very widespread rickettsial disease occurring mainly in warm climates. It occurs on all continents, in a variety of environments, ranging from hot and humid to cold and semiarid. Murine typhus is a zoonosis whose enzootic cycle in nature involves vertebrate hosts (mainly commensal rodents) and arthropod vectors (fleas and lice). It occurs commonly in port cities and coastal areas where commensal rodents and their ectoparasites are prevalent. Occasionally, other vertebrate hosts, such as house mice, shrews, opossums, skunks, and cats, that live in or enter rat-infested buildings and human habitations, are involved in murine typhus infection (Azad et al., 1988). Rickettsia typhi is found world-wide, but the number of reported cases does not reflect the current prevalence. The mild and non-specific features of infection suggest that its incidence is probably largely underestimated in tropical countries. However, the disease is prevalent in Texas, USA, in the Mediterranean area (recently reported in Greece, Spain, Portugal, Croatia, Cyprus, and Israel), and in Asia (Thailand, Vietnam, Japan, Indonesia, China) and in Africa. Tissot-Dupont noted that the prevalence of antibodies reactive with R. typhi varied from 1-20% in seven African countries and it was higher in coastal areas where rats are prevalent (Letaief et al., 2005). The macroenvironment of murine typhus consists of a hot, dry climate with little rainfall. The murine typhus microenvironment includes the intimate life cycle of rodents and their fleas, and an adequate food supply for the rodents. Fleas do not propagate successfully in wet environments where the soil is damp as they do in dry environments, so few cases of murine typhus occur in areas of heavy rainfall (Manea et al., 2001).

A. Outbreak Locations:

1. Thailand: An outbreak of febrile disease involving 170 Khmer adults at an evacuation site in Thailand occurred during the dry season of 1986. The illnesses were characterized by persistent fever, retro-orbital headache, myalgias, and clinical response to tetracycline within 2-3 days. The symptoms, effectiveness of tetracycline, and presence of a large rat population raised the suspicion of murine typhus. Fourteen (74%) of 19 patients had elevated or rising antibody titers against Rickettsia typhi, confirming the clinical diagnosis (Brown et al., 2002).
2. Hawaii, USA: Five cases of murine typhus occurring on southwestern Kauai in 1998 are described, following an investigation by the Department of Health. Two cases also had concurrent leptospirosis. Recent habitat changes of peridomestic animals and their fleas may have increased the risk for developing murine typhus. Increased suspicion of typhus by island physicians and more aggressive rodent control activities are recommended (Manea et al., 2001).
3. Texas, USA: A cluster of cases of murine (endemic) typhus has been reported from Texas. From October 25 to November 11, 1982, five persons became ill with fever, temperature greater than or equal to 40 degree C or equal to 104 degree F (all five patients), headache (three patients), and myalgia (two patients). On the 4th or 5th day of illness, three patients developed a macular rash that began on the trunk and spread to the extremities. Blood specimens obtained on December 16, 1982, from three patients demonstrated indirect fluorescent antibody titers of 1:512 or greater to typhus-group rickettsiae; cross-absorption studies performed at CDC using antigens to Rickettsia typhi (the causative organism of endemic typhus) and R. prowazekii (the causative organism of epidemic typhus) indicated the former as the cause of the elevated titers. No serum specimens were obtained from the other two patients. Four patients received appropriate antimicrobial therapy with tetracycline; all five recovered without sequelae (Webb et al., 1983). South Texas continues to be the stronghold of murine typhus in the U.S. Murine typhus there peaks in June. The incubation period averages 5.5 days. Rash is observed in 58%; there is 1% mortality (Walker et al., 1991)

B. Transmission Information:

1. From: Invertebrate To: Vertebrate
   Mechanism: Rat mites and lice may serve as a source of infection to their rodent hosts and to humans by means of their infected feces and by aerosol transmission. Human infection following inhalation of dust in rat-infested premises has been reported. It is usually transmitted to man by the combination of the bite site or skin abrasions with Rickettsia-containing flea feces (Azad et al., 1990). Transmission to the vertebrate host presumably results from contamination of the broken skin, respiratory tract, or conjunctivae of the host with infected flea feces or flea tissues (Azad et al., 1990). X. cheopis is the major source of infection with Ri. mooseri in both man and Rattus. Inhalation or ingestion of flea feces may cause infection. The minimum survival period of survival of Ri. mooseri in X. cheopis was shown to be 52 days. X. cheopis could not transmit the infection by biting, but that infection would follow if crushed fleas or flea feces were placed on the abraded skin (Traub et al., 1978). Traditionally the transmission of R. typhi has been associated with the rat flea Xenopsylla cheopis. Recently the cat flea, Ctenocephalides felis, has been implicated in many urban and suburban outbreaks. The main reservoirs are rats, house mice, opossums, skunks and cats. The transmission of murine typhus begins when the rat or cat flea feeds on an infected animal (Fergie et al., 2000). The transmission of murine typhus begins when the rat or cat flea feeds on an infected animal. The rickettsiae multiply in the flea without causing illness and after 10 days its feces become infectious. Once this happens the flea remains infected for life. The flea defecates when it bites. Skin irritation produced by the bite causes people to scratch and inoculate the wound by this mechanism. The incubation period is 6 to 14 days (Fergie et al., 2000).
   
   
2. From: Vertebrate To: Invertebrate
   Mechanism: Obligate blood feeders such as adult fleas acquire rickettsiae from rickettsemic vertebrate hosts when taking a blood meal (Azad et al., 1990). The commensal rats serve not only as hosts to blood-sucking ectoparasites, but are also regarded as amplifying hosts which make rickettsiae available in the blood to the vectors. Uninfected fleas feeding on such rickettsemic hosts can be readily become infected. Some fleas such as X. cheopis, Leptopsylla segnis, and Ctenocephalides felis are capable of acquiring rickettsiae from infected rats as early as 5 to 7 days after subcutaneous inoculation and as late as day 19. The rickettsiae, when ingested with an infectious blood meal, enter the epithelium of the flea midgut, where they propagate and are subsequently excreted in the feces. Once infected, fleas remain infected for life and their life span is unaffected by the rickettsiae (Azad et al., 1988). Ten days must elapse before the infected fleas can transmit R. typhi to susceptible hosts through infectious feces (Azad et al., 1997).
   
   

C. Environmental Reservoir:

1. Rat :
   1. Description: The commensal rats serve not only as hosts to blood-sucking ectoparasites, but also are regarded as amplifying hosts which make rickettsiae available in the blood to the vector (Azad et al., 1988). Rattus rats are the main reservoir hosts and animals of all ages are highly susceptible to infections, which persist for 2 to 3 weeks but cause no ill-effects (Kelly et al., 2005). Commensal rodents and shrews are animals which live close to man and they are the reservoir hosts of R. typhi. R. typhi antibody was found in the sera of R. norvegicus, R. rattus, R. exulans, and M. musculus trapped in 8 of 47 markets of the Bangkok Metropolitan Area. R. norvegicus is an important reservoir rodent species transmitting R. typhi to humans who live close to them (Siritantikorn et al., 2003).
   2. Survival Information: Infection with R. typhi in rats is nonfatal and the rickettsiae have been reported to survive in their brains for months after the infection. However, the persistence of rickettsiae in the circulating blood of infected rats is limited to 1 to 2 weeks (Azad et al., 1988).
2. Flea :
   1. Description: Natural infection with R. typhi has been reported for nine species if fleas. Of these, the oriental rat flea Xenopsylla cheopis is considered a major vector of murine typhus on experimental and epidemiological grounds (Azad et al., 1988). The occurrence of R. typhi in extracellular tissues of X. cheopis is supported by the findings of transovarial transmission of the rickettsiae by this species of flea. Because X. cheopis may be able to maintain R. typhi infections by transovarial transmission, this flea may serve as a reservoir of murine typhus (Azad et al., 1990). Ten days must elapse before the infected fleas can transmit R. typhi to susceptible hosts through infectious feces (Azad et al., 1997).
   2. Survival Information: Infected fleas maintain high levels of rickettsiae for life, which may range from months to a year, such fleas can transmit infection to a number of susceptible hosts including humans. Rickettsiae harm neither rat nor flea. Once infected, the flea remains infective for life and its life span and reproductive capacity are unaffected by the infection. Infection with R. typhi exerted no overt pathological effects on the fleas and it neither reduced their survival nor affected their reproductive activities (Azad et al., 1990). Since dried flea feces may remain infective for years, it is reasonable to believe that the feces of X. cheopis may be an aerosol-borne source of infection months after the fleas have disappeared. The minimum survival period of survival of Ri. mooseri in X. cheopis was shown to be 52 days (Traub et al., 1978).
3. House mice :
   1. Description: The main reservoirs are rats, house mice, opossums, skunks and cats (Fergie et al., 2000). In China, Ri. mooseri was recovered from house mice in a home where 6 cases of murine typhus occurred. House mice have been suggested as being of major importance in instances when commensal Rattus were scarce. In other examples they appear to have become involved only as a result of close contact with commensal rattus (Traub et al., 1978).
   2. Survival Information: Ri. mooseri survived in the brains of laboratory mice for periods up to 150 days (Traub et al., 1978).
4. Opossum :
   1. Description: From May 1984 though January 1988, 33 confirmed cases of locally acquired murine typhus were reported in Los Angeles County residents. The results of an investigation of these cases, including serologic testing of suspected reservoir animals, implicate a local suburban ecology of murine typhus, which differs substantially from the classic urban rat-rat flea cycle. Sera from 212 animals were tested for antibodies to R. typhi. These included 38 opossums, 36 roof rats, 35 Norway rats, 10 skunks, 10 resident cats, and 26 other cats from the vicinity where human cases of murine typhus occurred. Sera from 36 opossums and 21 cats from control areas were also tested. Domestic cats and opossums in close proximity to human cases had a high prevalence of seropositivity. 90% of 10 resident cats and 42% of 38 opossums were found to have infection. The opossum serves as a primary reservoir of murine typhus in the local focus and is instrumental in maintaining the infection in nature (Sorvillo et al., 1993).
5. Cat :
   1. Description: Studies in the Los Angeles County areas have shown that Rickettsia typhi can be found in opossums, feral and domestic cats, and roof rats as well as in the classic reservoir, Norwegian rats and their fleas (Reporter et al., 1996). From May 1984 though January 1988, 33 confirmed cases of locally acquired murine typhus were reported in Los Angeles County residents. The results of an investigation of these cases, including serologic testing of suspected reservoir animals, implicate a local suburban ecology of murine typhus, which differs substantially from the classic urban rat-rat flea cycle. Sera from 212 animals were tested for antibodies to R. typhi. These included 38 opossums, 36 roof rats, 35 Norway rats, 10 skunks, 10 resident cats, and 26 other cats from the vicinity where human cases of murine typhus occurred. Sera from 36 opossums and 21 cats from control areas were also tested. Domestic cats and opossums in close proximity to human cases had a high prevalence of seropositivity. 90% of 10 resident cats and 42% of 38 opossums were found to have infection (Sorvillo et al., 1993).
   2. Survival Information: The organism can be recovered from the blood, urine and at least 14 days post infection from the brains of cats. Domestic cats act as transport hosts of infective fleas into the human environment and may also serve as adjunct reservoirs (Sorvillo et al., 1993).

D. Intentional Releases:

1. Intentional Release information :
   1. Description: Collectively, the minimum infectious dose (less than 10 organisms); their ability to be acquired via aerosol; efficient arthropod vector transmission; severe clinical outcome and mortality in untreated patients make rickettsiae a potential bioweapon and bioterror agents. Intentional release of R. prowazekii and/or R. typhi into a crowded, louse-ridden population could initiate a vicious cycle of rapid transmission and high mortality (Azad et al., 2003).
   2. Emergency contact: You may also want to report the situation to your local or state health department. For information about how to contact your state or local health department, go to State and Local Health Departments. If you'd also like to contact CDC, you may do so in the following ways: * 800-CDC-INFO * 888-232-6348 (TTY) * cdcinfo@cdc.gov (CDC, 2003)
   3. Delivery mechanism: Aerosol: The pathogenic rickettsiae can be aerosolized and illegimately used to inflict severe disease (Azad et al., 2003).
   4. Containment: The problem of biohazard containment is both technical and architectural. Because rickettsiae are transmissible by parenteral and aerosol routes, these organisms must be handled in a closed room under relative negative pressure with an antechamber. Work should be performed in an appropriate biohazard containment hood, and the laboratory worker should wear mask, gloves, and protective clothing (Walker et al., 1988).

III. Infected Hosts

1. Homo sapiens:
   1. Taxonomy Information:
      1. Species:
         1. Human :
            • GenBank Taxonomy No.: 9606
            • Scientific Name: Homo sapiens (NCBI Taxonomy Browser)
            • Description: Although murine typhus occurs worldwide and is one of the most prevalent rickettsial infections of humans, only a small number of cases are now known to occur annually in the United States (Fergie et al., 2000). Murine typhus is a very widespread rickettsial disease occurring mainly in warm climates. It occurs on all continents, in a variety of environments, ranging from hot and humid to cold and semiarid. Murine typhus is a zoonosis maintained in nature through a cycle involving mainly commensal rodents and their ectoparasites. The classical transmission cycle for murine typhus is rat-flea-rat and accidentally rat-flea-man (Azad et al., 1988).
      
      
   2. Infection Process:
      1. Infectious Dose: The minimum infectious dose is less than 10 organisms. Pathogenic rickettsiae have a variable incubation period ranging from 3-15 days depending upon the route of rickettsial entry and rickettsial load. Rickettsial species have a minimum infectious dose making them a potential bioterror agent (Azad et al., 2003).
      2. Description: Murine typhus is a relatively mild febrile illness resulting from infection with Rickettsia typhi, a small (0.4 x 1.3 um), gram-negative, obligate intracellular bacterium. It is usually transmitted to man by the combination of the bite site or skin abrasions with Rickettsia-containing flea feces (Azad et al., 1990).
      
      
   3. Disease Information:
      1. Endemic Flea-Borne typhus (i.e., Murine typhus or endemic typhus) :
         1. Pathogenesis Mechanism: Organisms in the feces enter the host through irritated abraded skin. The bacterium is then hematogenously spread and ultimately invades endothelial cells. Transmission can also occur via inhalation of aerosolized fecal particles. To enter the host cell, R. typhi induces phagocytosis by an unknown mechanism. Once within the cell, the organisms rapidly escape the phagosome, multiply within the cytoplasm, and then exit the host cell by burst lysis, allowing subsequent spread to other endothelial cells (McLeod et al., 2004).
         
         
         
         2. Incubation Period: Rickettsia typhi has an incubation period of 6-14 days (Azad et al., 2003).
         
         
         
         3. Prognosis: Murine typhus in general is associated with complete clinical recovery even without antibiotic treatment. The fatality rate from endemic typhus in the US has been estimated at less than 1% (Fergie et al., 2000). Although the mortality rate is low (1% of reported cases), in severe cases R. typhi can cause meningoencephalitis, interstitial pneumonia, and disseminated vascular lesions. Without specific treatment, 99% of those infected will clear the disease within weeks, making proper accounting of R. typhi infections difficult (McLeod et al., 2004). Case fatality ranges between 1% and 4% (Dumler et al., 2005).
         
         
         
         4. Diagnosis Overview: A diagnosis of rickettsial disease is based on two or more of the following: 1) compatible clinical symptoms and epidemiologic history, 2) the development of specific convalescent-phase antibodies reactive with a given pathogen or antigenic group, 3) a positive polymerase chain reaction test result, 4) immunohistologic detection of a microorganism, or 5) isolation of a rickettsial agent. Ascertaining the place and the nature of potential exposures is particularly important for accurate diagnosis, as many rickettsial diseases have strong geographic links or are associated with exposure to specific animal reservoir species or arthropod vectors (CDC: Rickettsial agents).
         
         
         
         5. Symptom Information (Dumler et al., 2005):
            • Syndrome -- Murine typhus:
              • Description: Rickettsia typhi is the causative agent of murine typhus (endemic typhus). Infection with R. typhi causes fever, headache, and myalgia and leads to disseminated, multisystem disease, including infection of the brain, lung, liver, kidney, and heart endothelia, lymphohistiocytic vasculitis of the central nervous system, diffuse alveolar damage and hemorrhage, interstitial pneumonia, pulmonary edema, interstitial myocarditis and nephritis, portal triaditis, and cutaneous, mucosal, and serosal hemorrhages (McLeod et al., 2004). The clinical illness is characterized by fever, headache, a maculopapular rash and myalgia. A frank shaking chill and repeated rigors are present at the onset, associated with severe frontal headache and fever. Within a few hours, nausea and vomiting occur. Prostration, malaise, and weakness are enough to force cessation of activity in adults. The usual febrile course in murine typhus lasts about 12 days in adults and the temperature ranges from 102-104 (degrees)F. The early cutaneous lesions usually are sparse and hidden on the inner surface of the arm or the axilla. Most patients then develop a dull red macular rash on the upper part of the abdomen, shoulders, chest, arms, and thighs. The rash later becomes maculopapular, unlike epidemic typhus which is persistently macular. The murine rash typically develops on the fifth febrile day. Eighty percent of patients develop a rash. In the early course of the illness an irritating nonproductive cough is frequently present. In the second week rales can be detected in the basilar lung fields. Accelerated pulse and hypotension can occur. Headache, usually frontal, is the most common neurologic manifestation of murine typhus. Transient partial deafness can occur (Hudson et al., 1997). In severe cases R. typhi can cause meningoencephalitis, interstitial pneumonia and disseminated vascular lesions (Fergie et al., 2000).
              • Observed: Often unrecognized, murine typhus occurs with high prevalence in the tropics and has been reported in travelers returning from coastal tropical and subtropical regions (Letaief et al., 2005).
            • Anorexia:
              • Observed: 35% (Dumler et al., 2005).
            • Chills:
              • Observed: 44%-87% (Dumler et al., 2005).
            • Cough:
              • Observed: 35% (Dumler et al., 2005).
            • Fever:
              • Description: The usual febrile course in murine typhus lasts about 12 days in adults and the temperature ranges from 102-104 (degrees)F (Hudson et al., 1997).
              • Observed: Sudden onset of fever and headache were reported in all cases (Letaief et al., 2005) 100% (Gikas et al., 2004) 96% (Dumler et al., 2005).
            • Headache:
              • Description: Headache, usually frontal, is the most common neurologic manifestation of murine typhus (Hudson et al., 1997).
              • Observed: Sudden onset of fever and headache were reported in all cases (Letaief et al., 2005). 88% (Gikas et al., 2004).
            • Hepatosplenomegaly:
              • Description: Children presented with hepatosplenomegaly. Abdominal ultrasound revealed diffusely enlarged liver and spleen (Bitsori et al., 2002).
              • Observed: Some studies record the presence of hepatomegaly in up to 24% of patients (Dumler et al., 2005).
            • Lymphadenopathy:
              • Description: Children presented with lymphadenopathy. Patients showed enlarged abdominal lymph nodes (Bitsori et al., 2002)
            • Meningitis:
              • Description: Cerebrospinal fluid findings usually include mild pleocytosis with predominantly lymphocytes. The presence of erythrocytes in the cerebrospinal fluid has been attributed to the vasculititis caused by the Rickettsiae species (Galanakis et al., 2002).
              • Observed: In children, neurologic involvement in R. typhi occurs in 2 to 4% of cases. Murine typhus should be included in the differential diagnosis of subacute meningitis and meningoencephalitis in children who are residents of endemic areas (Galanakis et al., 2002).
            • Myalgia:
              • Observed: 33% (Dumler et al., 2005).
            • Nausea:
              • Observed: 48% (Dumler et al., 2005).
            • Neurologic signs:
              • Description: Neurologic signs and symptoms have been reported to occur in up to 45% of patients, usually manifested as confusion, stupor, seizures or localized findings such as ataxia (Dumler et al., 2005).
              • Observed: 45% (Dumler et al., 2005).
            • Ocular manifestations:
              • Description: Ocular manifestations of typhus are due to the fact that rickettsial organisms are intracellular parasites that have a tropism for vascular endothelium, resulting in an acute hemorrhagic perivasculitis with thrombosis and hemorrhage. Every part of the eye can be involved in epidemic or endemic typhus. Optic neuritis, constricted visual fields, retinal hyperemia, retinal edema, papillary hyperemia and conjunctivitis are the most common ocular manifestations. Macular edema, Jensen's (peripapillary) chorioretinitis, perivasculitis and extensive venous thrombosis can occur in murine typhus (Hudson et al., 1997).
              • Observed: We describe two patients with retinal manifestatons of serologically confirmed acute murine typhus infection. Both patients had evidence of retinal whitening in the acute setting. This retinal whitening may be due to the venous thrombosis common in patients with typhus or may be a retinitis associated with the disease. The patient in the second case was clearly able to related an exposure to rats; however, the first patient reported an exposure to cat fleas (Dumler et al., 2005)
            • Pneumonia:
              • Description: There were four cases of pneumonia, with interstitial infiltrates on chest X-ray film in three cases and alveolar infiltrates in one case (Letaief et al., 2005).
              • Observed: Four cases out of a total of seven cases reported (Letaief et al., 2005)
            • Rash:
              • Description: When rash is identified, it is described as macular or maculopapular in 78% and petechiae are noted in less than 10%. These lesions are most often distributed in the trunk (88% of cases), but involvement of the extremities (greater than 45%) is not infrequent. The initial rash distribution is equally frequent on the extremities and on the trunk. The rash may also be present on the palms and soles (Dumler et al., 2005). A rash noted in four patients (57%), began around the fifth day of the onset and was maculopapular and non-confluent. It was distributed over the trunk and limbs, sparing the face, palms and soles (Letaief et al., 2005). The early cutaneous lesions usually are sparse and hidden on the inner surface of the arm or the axilla. Most patients then develop a dull red macular rash on the upper part of the abdomen, shoulders, chest, arms, and thighs. The rash later becomes maculopapular, unlike epidemic typhus which is persistently macular. The murine rash typically develops on the fifth febrile day (Hudson et al., 1997).
              • Observed: Eighty percent of patients develop a rash (Hudson et al., 1997). 57% (Letaief et al., 2005). 81.6% (Gikas et al., 2004). Rash is noted in only 18% of patients at presentation and over the course of the illness, between 50% and 80% will develop this sign (Dumler et al., 2005).
            • Splenomegaly:
              • Observed: Some studies record the presence of splenomegaly in up to 10% of patients (Dumler et al., 2005).
            • Vomiting:
              • Observed: 40% (Dumler et al., 2005).
         
         
         6. Treatment Information:
            • Tetracycline: Tetracycline and chloramphenicol are considered the drugs of choice against infection with R. typhi, while reports on fluoroquinolones have shown conflicting results (Gikas et al., 2004). Rickettsial Infections- For the treatment of Rocky Mountain spotted fever, louse-borne (epidemic) typhus, Brill-Zinsser disease, endemic (murine) typhus, Q fever, and rickettsialpox, the usual adult dosage of oral tetracycline hydrochloride generally is given for at least 3-7 days or until the patient has been a febrile for approximately 2-3 days. The usual adult oral dosage of tetracycline hydrochloride is 1-2 g daily given in 2-4 divided doses. The usual oral dosage of tetracycline hydrochloride for children older than 8 years of age is 25-50 mg/kg daily given in 2-4 divided doses. Because food and or milk reduce gastrointestinal absorption of tetracycline and its hydrochloride salt, oral preparations of the drug should be given one hour before or 2 hours after meals and or milk. To reduce the risk of esophageal irritation and ulceration, tetracycline capsules or tablets should be administered with adequate amounts of fluid and probably should not be given at bedtime or to patients with esophageal obstruction or compression (AHFS 2005).
              • Applicable: Tetracylines are used for the treatment of rickettsial infections and are considered drugs of choice for most rickettsial infections. The US Centers for Disease Control and Prevention (CDC) and some clinicians state that doxycline is the preferred tetracycline for the treatment of typhus fevers (epidemic typhus, murine typhus), spotted fevers (Rocky Mountain spotted fever, Mediterranean spotted fever, African tick-bite fever, Queensland tick typhus, North Asian tick fever, oriental spotted fever, rickettsialpox, cat flea typhus), scrub typhus, Q fever, and ehrlichiosis (ehrlichosis, Sennetsu fever). For seriously ill patients with suspected rickettsial disease, anti-infective therapy should be initiated based on clinical and epidemiologic evidence while laboratory confirmation is pending. For typhus and spotted-fever group rickettsioses, chloramphenicol may be used if tetracyclines are contraindicated. Tetracyclines in appropriate dosage forms are administered orally, IV, or by deep IM injection (AHFS 2005).
              • Contraindicator: Tetracyclines are contraindicated in patients hypersensitive to any of the tetracyclines. Tetracyclines should not be used in children younger than 8 years of age unless other appropriate drugs are ineffective or contraindicated. Tetracyclines can cause fetal toxicity when administered to pregnant women but potential benefits from use of the drugs may be acceptable in certain conditions despite the possible risks to the fetus. Tetracyclines are distributed into milk. Some clinicians recommend that tetracyclines not be used in nursing women, if possible, because of the potential for dental staining in the infant (AHFS 2005). All tetracyclines form a stable calcium complex in any bone-forming tissue. As a result, tetracyclines may cause permanent yellow-gray-brown staining of the teeth as well as enamel hypoplasia (MICROMEDEX 2001).
              • Complication: Patients who experience CNS symptoms while receiving minocycline should be cautioned about driving vehicles or operating hazardous machinery during therapy. Dizziness, headache, and vertigo have also been reported rarely with other tetracycline derivatives. Some commercially available tetracycline preparations (e.g. doxycycline, minocycline oral suspension, oxytetracycline and tetracycline) contain sulfites that may cause allergic-type reactions, including anaphylaxis and life-threatening or less severe asthmatic episodes, in certain susceptible individuals. Liver toxicity has occurred following IV administration of tetracycline to pregnant women. Some commercially available preparations of tetracycline hydrochloride contain the dye tartrazine which may cause allergic reactions including bronchial asthma in certain susceptible individuals (AHFS 2005).
              • Success Rate: Tetracycline- 2 to 3 days may be necessary to achieve therapeutic concentrations of tetracycline (MICROMEDEX 2001) Children who received an appropriate antibiotic (21 doxycycline, 2 tetracycline) had defervescence in a mean of 35 +/- 19 hours (range 4 to 66 hours)after initiation of therapy and after a mean of 11 +/- days of fever (range, 5 to 19) (Fergie et al., 2000)
              • Drug Resistance: Resistance to tetracyclines may be natural or acquired. Resistance is usually caused by decreased permeability of the cell surface as a result of mutation or the presence of an inducible plasmid-mediated resistance factor which is acquired via conjugation. Plasmid-mediated resistance can be transferred between organisms of the same or different species. Complete cross resistance usually occurs between demeclocycline, doxycycline (AHFS 2005)
            • Doxycyline: For the treatment of Rocky Mountain spotted fever, endemic (murine) typhus, and rickettsialpox, doxycyline generally is given in the usual oral dosage for at least 3-7 days or until the patient has been a febrile for approximately 2-3 days. Because a single dose of doxycycline is usually effective for the treatment of louse-borne (epidemic) typhus, Brill-Zinsser disease, and scrub typhus, many clinicians state that adults should receive 100-200 mg of doxycycline as a single oral dose and children should receive 50 mg as a single dose for the treatment of these rickettsial infections (AHFS 2005).
              • Applicable: Doxycycline calcium, doxycycline hyclate, and doxycycline monohydrate are administered orally. When oral therapy is not feasible, doxycycline hyclate may be administered by slow IV infusion. To reduce the risk of esophageal irritation and ulceration, capsules containing doxycycline should be administered with adequate amounts of fluids. The usual oral dosage of doxycycline for adults and children older than 8 years of age weighing more than 45 kg is 200 mg on the first day of treatment followed by 100 mg daily given in 1 or 2 divided doses. For severe infections, these patients may receive 100 mg every 12 hours. The usual oral dosage of doxycycline for children older than 8 years of age weighing 45 kg or less is 4.4 mg/kg given in 2 divided doses on the first day of treatment followed by 2.2 mg/kg daily given in 1 or 2 divided doses. For severe infections, oral dosages up to 4.4 mg/kg daily may be used in these children (AHFS 2005).
              • Contraindicator: All tetracyclines form a stable calcium complex in any bone-forming tissue. As a result, tetracyclines may cause permanent yellow-gray-brown staining of the teeth as well as enamel hypoplasia. Therefore, use of tetracyclines is not recommended in patients in infants and children 8 years of age and younger age unless other medications are unlikely to be effective or are contraindicated (MICROMEDEX 2001).
              • Complication: Single-dose doxycycline therapy was effective in nearly 80% of patients in one study but is not routinely advocated because relapse may occur (Dumler et al., 2005).
              • Success Rate: Children who received an appropriate antibiotic (21 doxycycline, 2 tetracycline) had defervescence in a mean of 35 +/- 19 hours (range 4 to 66 hours)after initiation of therapy and after a mean of 11 +/- days of fever (range, 5 to 19) (Fergie et al., 2000).
            • Chloramphenicol: Although teracyclines generally are the drugs of choice for the treatment of Rocky mountain spotted fever and other rickettsial infections, chloramphenicol is the drug of choice for rickettsial infections when tetracyclines cannot be used. Chloramphenicol generally is considered the drug of choice for the treatment of rickettsial infections in children younger than 8 years of age and in pregnant women, since tetracyclines should be avoided in these patients (AHFS 2005).
              • Applicable: Chloramphenicol should be used only for the treatment of serious infections caused by susceptible bacteria or Rickettsia when potentially less toxic drugs are ineffective or contraindicated. The usual IV dosage of chloramphenicol for adults and children with normal renal and hepatic function is 50 mg/kg daily given in equally divided doses every 6 hours. The IV dosage of chloramphenicol for neonates and children in whom immature hepatic and/or renal function is suspected is 25 mg/kg daily (AHFS 2005).
              • Contraindicator: Chloramphenicol crosses the placenta. No studies have established the safety and efficacy of chloramphenicol use in pregnancy. Caution should be used in the therapy of premature and full-term infants to avoid toxicity, including gray syndrome (MICROMEDEX 2001).
              • Complication: Some clinicians suggest that the risk of serious, sometimes fatal, adverse effects associated with chloramphenicol therapy be weighed against the risk of tetracycline therapy in children younger than 8 years of age and in pregnant women (AHFS 2005).
            • Ciprofloxacin: Ciprofloxacin has been used with some success in a limited number of patients for the treatment of various rickettsial infections. Although tetracyclines generally are the drugs of choice for the treatment of rickettsial infections, some clinicians suggest that either ciprofloxacin or ofloxacin may be considered an alternative for the treatment of these infections when tetracycline cannot be used (AHFS 2005).
              • Applicable: The following regimens are considered equivalent: Ciprofloxacin conventional tablets 250 mg every 12 hours- ciprofloxacin 200 mg IV every 12 hours; ciprofloxacin conventional tablets 500 mg every 12 hours- ciprofloxacin 400 mg IV every 12 hours; ciprofloxacin conventional tablets 750 mg every 12 hours- ciprofloxacin 400 mg IV every 8 hours. The duration of ciprofloxacin therapy depends on the type and severity of infection, and should be determined by the clinical and bacteriologic response of the patient. Ciprofloxacin is administered orally as conventional tablets containing the hydrochloride, as an oral suspension containing the base. IV therapy with the drug is generally reserved for patients who do not tolerate or are unable to take the drug orally (AHFS 2005).
              • Contraindicator: Because of the risk of crystalluria, the manufacturer recommends that the usual dosage of the drug not be exceeded (AHFS 2005).
      
      
   4. Prevention:
      1. Reducing contact with vectors and reservoir hosts:
         • Description: Prevention of infections with flea borne bacterial pathogens is best achieved by minimizing contact with the vectors and reservoirs of the organisms. Steps should be taken to eliminate rodents in the household. Rodent fleas, particularly Xenopsylla cheopis must be controlled simultaneously, otherwise outbreaks of murine typhus will occur after the rats die and their fleas seek alternative hosts (Kelly et al., 2005). Prevention is directed toward rodent and flea eradication programs. The Department of Health must be notified of all murine typhus cases as soon as possible in order to monitor the rodent/flea population and take appropriate action to prevent further disease spread. The Department of Health (local district) Vector Control staff is available for rodent trapping, and flea eradication at exposure sites. People cleaning enclosed areas that may harbor rodents should wear a protective mask or respirator to avoid inhalation of dust containing flea feces. Skin should be protected from flea feces by covering exposed areas with appropriate clothing such as long sleeved shirts, long pants, socks and shoes, and use of topical insect repellents (Manea et al., 2001). The best preventive measure against rickettsioses is to avoid typical risk settings when traveling in areas of endemicity. For instance, rodents, dogs, and domestic livestock should not be touched, and bush vegetation likely to be infested with ticks or mites should not be entered. If this is not possible, measures aimed at minimizing the risk of arthropod bites should be taken. Recommended to use protective clothing, preferably impregnated with permethrin or another pyrethroid. Topical repellents should be used on any exposed skin, but because of short-lasting effect against many of the implicated vectors (only 1-2 h) for many products, frequent application is recommended. Daily self-checking and removal of ticks and mites during travel should be encouraged (Jensenius et al., 2004). Measures to control rodents have resulted in a decreased incidence of murine typhus, but it is also likely that it is being under diagnosed because many medical practitioners do not include it in their differential diagnosis of pyrexia of unknown origin. Four recent cases are described, and historical aspects of this disease in Australia are presented (O'Connor et al., 1996).
         • Efficacy:
           • Rate: Antimicrobial therapy should be continued until 2 to 3 days after defervescence. After initiation of therapy, patients become a febrile at a median interval of 3 days (Dumler et al., 2005).
           • Duration: Antimicrobial therapy should be continued until 2 to 3 days after defervescence (Dumler et al., 2005).
      
      
   5. Model System:
      1. Guinea pig:
         1. Model Host: Cavia porcellus (NCBI taxonomy Browser)
         2. Description: Rickettsia mooseri infection has been studied in syngeneic guinea pigs inoculated intradermally with the objective of developing a model for the study of immune mechanisms. R. mooseri infection in this laboratory animal is often studied as a model of typhus infections. In this report R. mooseri infections of guinea pigs initiated by intraperitoneal (i.p.), intradermal (i.d.), and intravenous (i.v.) inoculations are evaluated to determine the optimal dose and route of infection for the study of acquired immunity to R. mooseri infection. Intraperitoneal (i.p.) inoculation of guinea pigs with blood collected from patients with typhus fever may produce a typhus-like febrile disease in this animal. This susceptibility to infection and the similarities between the histopathology of experimental typhus in guinea pigs and typhus fever in humans led early investigators to employ guinea pigs to propagate rickettsiae and to study treatment and immunity. The intradermal inoculation of relatively small numbers of rickettsiae make it possible to determine the characteristics of the infection i.e. the dissemination, proliferation, and clearance of rickettsiae, the antibody response, the delayed-type hypersensitivity (DTH) skin reactions, and the development of resistance to a second homologous challenge. Experiments were performed to compare and evaluate infections resulting from inoculation of doses of R. mooseri ranging from 10(1) through 10(8) plaque-forming units by i.p., i.d., and i.v. routes. Large doses [greater than 10(6) PFU] introduced by any of the three routes resulted in a rapid antibody response. As the number of PFU injected was decreased to 10(6), the appearance of antibodies was delayed for several days. On the basis of these preliminary tests, the infection resulting from the i.d. inoculation of a relatively small dose (8.2 x 10(2)PFU or approximately 3.4 x 10(3) guinea pig i.d. 50% infectious doses) of R. mooseri in 0.1 ml into the outer aspect of the guinea pig right thigh was selected for the following study. After i.d. inoculation, rickettsiae were recovered first from the site of inoculation, then from the draining lymph nodes, and subsequently from deep organs (spleen and kidney). It is possible that the early infection of lymphatic tissues allows these organisms to establish residence in a cell population within which they subsequently achieve systemic distribution. Groups of give guinea pigs each, infected by i.d. inoculation of 8.2 x 10(2) PFU into a hind limb, were challenged 3, 5, 7, 9 or 21 days after primary infection by an inoculation of 8.2 x 10(2) PFU. At each test interval, five normal guinea pigs were also challenged. The relative dynamics of infection were assessed by following the development of lesions at the sites of i.d. challenge. After initiation of the primary infection guinea pigs challenged on day 5. 6, 9 or 21 displayed a marked capacity to resist the effects of the second i.d. R. mooseri challenge. It is probable that this resistance to second challenge reflects the development of immunity (Murphy et al., 1978).
      2. Rat:
         1. Model Host: Rattus norvegicus (NCBI Taxonomy Browser)
         2. Description: Quantitative studies of selected features of peripherally induced Rickettsia mooseri infection in Rattus norvegicus derived white laboratory rats revealed a unique association between microbe and amplifying vertebrate host which appears to be especially conducive to maintenance of the enzootic cycle. Rats of all ages, from 1-day-old babies to adults, are highly susceptible to percutaneous infection with R. mooseri, approximately 1 organism constituting an ID(50). The course of the systemic infection, as measured by the rise and fall of R. mooseri titers in blood, brain and kidney and the serum antibody response was almost identical in adult and newborn rats. Rickettsiemia in both age groups was detectable for about 10 days in the face of mounting serum antibody titers. Neither newborn (1-3 days old) nor adult rats showed detectable signs of illness, deleterious effect on growth, or mortality despite the demonstrated systemic infection, even when the peripheral inoculum of R. moosieri was 10(4)-10(5) PFU. This stands in contrast to certain other mammals, such as guinea pigs and man, which show various overt pathological responses to infection. Failure of rats, which serve as an amplifying host, to become ill or to die as a result of R. mooseri infection would seem especially advantageous for maintaining the enzootic transmission cycle. In this study R. mooseri was not recovered from blood, brain or kidneys of rats beyond about 35 days after inoculation. Serum antirickettsial antibodies persisted for at least 60 weeks post infection i.e., longer than the usual life span of rats in nature (Arango-Jaramillo et al., 1984).
2. Fleas:
   1. Taxonomy Information:
      1. Species:
         1. Cat flea (NCBI Taxonomy Browser):
            • GenBank Taxonomy No.: 7515
            • Scientific Name: Ctenocephalides felis (NCBI Taxonomy Browser)
            • Description: The cat flea, Ctenocephalides felis, another pulicid, readily parasitizes a variety of large-sized hosts, such as carnivores, and is only rarely found in rodents. C. felis feeding on a cat with subclinical Ri. mooseri infection can acquire the infection. Two isolations of Ri. mooseri from C. felis from an opossum have been reported and this species may serve as a vector when opossums are acting as a source of infection (Traub et al., 1978).
         2. Echidnophaga gallinacea :
            • Scientific Name: Echidnophaga gallinacea (Traub et al., 1978)
            • Description: The sticktight flea, Echidnophaga gallinacea, a pulicid, has been imported into the U.S.A., where it infests a variety of hosts, including rats. Two strains of Ri. mooseri have been isolated from this species one in which X. cheopis and L. segnis from the same host were both positive and experimental transmission and the presence of infected flea feces have been reported. This fleas does not attach to man, but will crawl on a human host. On their ordinary prey the remain attached to their hosts for days (Traub et al., 1978).
         3. Leptosylla segnis :
            • Scientific Name: Leptosylla segnis (Traub et al., 1978)
            • Description: Leptopsylla segnis is a parasite of the house mice and commensal rats in many parts of the world. This species (like its host, house mice) has been found naturally infected in China in a house where 8 of 9 residents had contracted murine typhus. Multiplication of Ri. mooseri within L. segnis has been reported. This species does not bite man and that L. segnis does not ordinarily attack humans and cannot be an important vector to man (Traub et al., 1978).
         4. Ceratophyllus (Monopsyllus) anisus. (NCBI Taxonomy Browser):
            • GenBank Taxonomy No.: 360615
            • Scientific Name: Monopsyllus anisus (NCBI Taxonomy Browser)
            • Description: Oriental murine fleas, Monopsylla anisus was cited as being infected with Ri. mooseri in nature (Traub et al., 1978).
         5. Nosopsyllus fasciatus :
            • Scientific Name: Nosopsyllus fasciatus (Traub et al., 1978)
            • Description: Nosopsyllus fasciatus, a certophyllid flea is at times commonly found on commensal rats in temperate regions. Natural infection was claimed in this species in 1931, it was shown that it can acquire Ri. mooseri, as demonstrated by inoculation and by multiplication within the flea, laboratory transmission was also demonstrated. N. fasciatus was present on house mice (Mus) in Australia during a mouse irruption [sic] in the winter and they consider that an aerosol dust contaminated with feces of the unspecified mouse fleas accounts for outbreaks of murine typhus experienced in the area. Regardless of its vector ship concerning man, N. fasciatus may prove to be important in transmission from rat to rat and indirectly responsible for a spillover into man. As the feces of fleas can be infected with Ri. mooseri, and be infective as well, the question of the role of flea larvae in the ecology of murine typhus may merit investigation, since, for example the larvae of N. fasciatus have been observed to ingest semi digested host blood directly from the anus of the adult flea (Traub et al., 1978).
         6. Oriental rat flea (NCBI Taxonomy Browser):
            • GenBank Taxonomy No.: 163159
            • Scientific Name: Xenopsylla cheopis (NCBI Taxonomy Browser)
            • Description: Natural infection with R. typhi has been reported for nine species of fleas. Of these, the oriental rat flea, X. cheopis, is considered a major vector of murine typhus of experimental and epidemiological grounds (Azad et al., 1988).
         7. Pulex irritans (NCBI Taxonomy Browser):
            • GenBank Taxonomy No.: 173820
            • Scientific Name: Pulex irritans (NCBI Taxonomy Browser)
            • Description: Pulex irritans, the so-called human flea infests a variety of large mammals, such as pigs, opossums and man. Nine specimens were collected from a house rat in Addis Ababa. It has been found to be equally capable of acquiring and transmitting Ri. mooseri to laboratory animals as X. cheopis. Feces of P. irritans were infective for long periods (Traub et al., 1978).
         8. Xenopsylla astia (NCBI Taxonomy Browser):
            • GenBank Taxonomy No.: 163158
            • Scientific Name: Xenopsylla astia (NCBI Taxonomy Browser)
            • Description: Like X. cheopis, two other Xenopsylla fleas, X. astia and X. brasiliensis have been introduced with rats into many parts of the world. Both of these species have been stated as being effective as X. cheopis as laboratory vectors. Ri. mooseri isolated from a pool of seven mixed X. cheopis and X. astia fleas and from host rats collected in the house of a patient and also reported isolation from other mixed pools of Xenopsylla, including X. cheopis (Traub et al., 1978).
         9. Xenopsylla brasiliensis (NCBI Taxonomy Browser):
            • GenBank Taxonomy No.: 163158
            • Scientific Name: Xenopsylla brasiliensis (NCBI Taxonomy Browser)
            • Description: Like X. cheopis, two other Xenopsylla fleas, X. astia and X. brasiliensis have been introduced with rats into many parts of the world. Both of these species have been stated as being effective as X. cheopis as laboratory vectors (Traub et al., 1978).
      
      
   2. Infection Process:
      
      No infection process information is currently available here.
      
      
   3. Disease Information:
      
      No disease information is currently available here.
      
      
   4. Prevention:
      
      No prevention information is currently available here.
      
      
   5. Model System:
      
      No model system information is currently available here.
      
      
3. Lice:
   1. Taxonomy Information:
      1. Species:
         1. Human lice (NCBI Nucleotide Browser):
            • GenBank Taxonomy No.: 121225
            • Scientific Name: Pediculus humanus (NCBI Nucleotide Browser)
            • Description: Human lice may acquire Ri. mooseri if infesting a murine typhus patient, and subsequently transmit the infection to other people. Rickettsia mooseri was isolated from lice (Pediculus humanus) from a patient ill with murine typhus in Kashmir (Traub et al., 1978).
         2. Human body louse (NCBI Nucleotide Browser):
            • GenBank Taxonomy No.: 121224
            • Scientific Name: Pediculus humanus corporis (NCBI Nucleotide Browser)
            • Description: Two strains of Rickettsia mooseri were isolated from Pediculus humananus corporis, the human body louse from patients with murine typhus in Ethiopia (Traub et al., 1978).
         3. Rat lice (NCBI Taxonomy Browser):
            • GenBank Taxonomy No.: 160141
            • Scientific Name: Hoplopleura (NCBI Taxonomy Browser)
            • Description: Rat lice (Polyplax and Hoplopleura) have been found both naturally infected and capable of transmitting experimental infection and must be seriously considered as potentially important intramurid vectors and as a possible source of transmission to man via the aerosol route (Traub et al., 1978).
      
      
   2. Infection Process:
      
      No infection process information is currently available here.
      
      
   3. Disease Information:
      
      No disease information is currently available here.
      
      
   4. Prevention:
      
      No prevention information is currently available here.
      
      
   5. Model System:
      
      No model system information is currently available here.
      
      
4. Tick:
   1. Taxonomy Information:
      1. Species:
         1. Hyalomma (NCBI Taxonomy Browser):
            • GenBank Taxonomy No.: 34625
            • Scientific Name: Hyalomma (NCBI Taxonomy Browser)
            • Description: Isolation of a strain of Ri. mooseri from Hyalomma from cattle in Ethiopia reported (Traub et al., 1978).
         2. Boophilus (NCBI Taxonomy Browser):
            • GenBank Taxonomy No.: 6940
            • Scientific Name: Boophilus (NCBI Taxonomy Browser)
            • Description: Reported the purported isolation of Ri. mooseri from a pool of Boophilus ticks collected off bushes in India and claimed complete cross protection in guinea pigs when challenged with Ri. mooseri strains from a human and fleas (Traub et al., 1978).
      
      
   2. Infection Process:
      
      No infection process information is currently available here.
      
      
   3. Disease Information:
      
      No disease information is currently available here.
      
      
   4. Prevention:
      
      No prevention information is currently available here.
      
      
   5. Model System:
      
      No model system information is currently available here.
      
      
5. Mammals:
   1. Taxonomy Information:
      1. Species:
         1. Black rat or roof rat (NCBI Taxonomy Browser):
            • GenBank Taxonomy No.: 10117
            • Scientific Name: Rattus rattus (NCBI Taxonomy Browser)
            • Description: Nearly all reported human cases of Murine typhus have been associated with sites with large rat populations, mainly Rattus norvegicus and R. rattus. Although the distribution of these two species of rats extends far beyond the known range of murine typhus infection, they are nevertheless very important in the ecology of this infection. This view has been supported by the serological evidence and frequent isolations of Rickettsia typhi from naturally infected rats from various countries. The commensal rats serve not only as hosts to blood-sucking ectoparasites, but also are regarded as amplifying hosts which make rickettsiae available in the blood to the vector. Infection with R. typhi in rats is nonfatal, and the rickettsaie have been reported to survive in their brains for months after the infection. However, the persistence of rickettsiae in the circulating blood of infected rats is limited to 1 to 2 weeks (Azad et al., 1988). Although murine typhus is endemic in southern California, the number of reported cases has steadily decreased from its peak occurrence in the 1940s. However, from May 1984 through January 1988, 33 confirmed cases of locally acquired murine typhus were reported in Los Angeles County residents. These reports exceeded the total number (eight) of confirmed and presumptive cases in Los Angeles County during the previous 20-year period. The results of an investigation of these cases, including serologic testing of suspected reservoir animals. Sera from 212 animals were tested for antibodies to R. typhi. These included 36 resident roof rats (Rattus rattus), of these 2% were positive (Sorvillo et al., 1993).
         2. Domestic cat (NCBI Taxonomy Browser):
            • GenBank Taxonomy No.: 9685
            • Scientific Name: Felis catus (NCBI Taxonomy Browser)
            • Description: Although murine typhus is endemic in southern California, the number of reported cases has steadily decreased from its peak occurrence in the 1940s. However, from May 1984 through January 1988, 33 confirmed cases of locally acquired murine typhus were reported in Los Angeles County residents. These reports exceeded the total number (eight) of confirmed and presumptive cases in Los Angeles County during the previous 20-year period. The results of an investigation of these cases, including serologic testing of suspected reservoir animals. Sera from 212 animals were tested for antibodies to R. typhi. These included 10 resident cats (Felis catus) and 26 nonresident cats (Felis catus), of these 9% and 3% were positive. Domestic casts in close proximity to human cases had a high prevalence of seropositivity (Sorvillo et al., 1993).
         3. House mouse (NCBI Taxonomy Browser):
            • GenBank Taxonomy No.: 10090
            • Scientific Name: Mus musculus (NCBI Taxonomy Browser)
            • Description: Occasionally, other vertebrate hosts, such as house mice, shrews, opossums, skunks, and cats, that live in or enter rat-infested buildings and human habitations, are involved in murine typhus infection (Azad et al., 1988). House mice have been suggested as being of major importance in instances when commensal Rattus were scarce. In other examples they appear to have become involved only as a result of close contact with commensal rattus (Traub et al., 1978).
         4. Norway rat (NCBI Taxonomy Browser):
            • GenBank Taxonomy No.: 10116
            • Scientific Name: Rattus norvegicus (NCBI Taxonomy Browser)
            • Description: Nearly all reported human cases of murine typhus have been associated with sites with large rat populations, mainly Rattus norvegicus and R. rattus. Although the distribution of these two species of rats extends far beyond the known range of murine typhus infection, they are nevertheless very important in the ecology of this infection. This view has been supported by the serological evidence and frequent isolations of Rickettsia typhi from naturally infected rats from various countries. The commensal rats serve not only as hosts to blood-sucking ectoparasites, but also are regarded as amplifying hosts which make rickettsiae available in the blood to the vector (Azad et al., 1988).
         5. Southern opossum (NCBI Taxonomy Browser):
            • GenBank Taxonomy No.: 9268
            • Scientific Name: Didelphis marsupialis (NCBI Taxonomy Browser)
            • Description: Although murine typhus is endemic in southern California, the number of reported cases has steadily decreased from its peak occurrence in the 1940s. However, from May 1984 through January 1988, 33 confirmed cases of locally acquired murine typhus were reported in Los Angeles County residents. These reports exceeded the total number (eight) of confirmed and presumptive cases in Los Angeles County during the previous 20-year period. The results of an investigation of these cases, including serologic testing of suspected reservoir animals. Sera from 212 animals were tested for antibodies to R. typhi. These included 38 opossums (Didelphis marsupialis), of these 16% were positive. Opossums in close proximity to human cases had a high prevalence of seropositivity (Sorvillo et al., 1993). During the past two decades, the persistence of murine typhus foci in suburban area of Orange and Los Angeles counties in California and the association of these foci with human cases has not been attributed to the classical rat-flea cycle because of the absence of rats or X. cheopis fleas in the affected area. In this study, 443 serum samples from animals (14 species) were examined for the presence of complement fixing serum antibody. Serum samples from 8 of 75 (11%) opossums were positive for antibodies to R. typhi (Williams et al., 1992).
         6. Polynesian rat (NCBI Taxonomy Browser):
            • GenBank Taxonomy No.: 34854
            • Scientific Name: Rattus exulans (NCBI Taxonomy Browser)
            • Description: R. typhi antibody titer ranged from 40-1280 and was found in Rattus norvegicus (4.2%), Rattus rattus (0.4%), Rattus exulans (0.2%), and Mus musculus (0.2%) trapped in 8 of 47 markets in the Bangkok Metropolitan Area (Siritantikorn et al., 2003).
         7. Rice-field rat (NCBI Taxonomy Browser):
            • GenBank Taxonomy No.: 83752
            • Scientific Name: Rattus argentiventer (NCBI Taxonomy Browser)
            • Description: Two out of two R. argentiventer animals tested were sero positive for R. typhi from communities in Malang, Indonesia (Richards et al., 1997).
         8. Striped skunk (NCBI Taxonomy Browser):
            • GenBank Taxonomy No.: 30548
            • Scientific Name: Mephitis mephitis (NCBI Taxonomy Browser)
            • Description: During the past two decades, the persistence of murine typhus foci in suburban area of Orange and Los Angeles counties in California and the association of these foci with human cases has not been attributed to the classical rat-flea cycle because of the absence of rats or X. cheopis fleas in the affected area. In this study, 443 serum samples from animals (14 species) were examined for the presence of complement fixing serum antibody. Serum samples from 1 to 7 (14%) skunks examined were positive for antibodies to R. typhi (Williams et al., 1992). Although murine typhus is endemic in southern California, the number of reported cases has steadily decreased from its peak occurrence in the 1940s. However, from May 1984 through January 1988, 33 confirmed cases of locally acquired murine typhus were reported in Los Angeles County residents. These reports exceeded the total number (eight) of confirmed and presumptive cases in Los Angeles County during the previous 20-year period. The results of an investigation of these cases, including serologic testing of suspected reservoir animals. Sera from 212 animals were tested for antibodies to R. typhi. These included 10 skunks (Mephitis mephitis), of these 2% were positive (Sorvillo et al., 1993).
      
      
   2. Infection Process:
      
      No infection process information is currently available here.
      
      
   3. Disease Information:
      
      No disease information is currently available here.
      
      
   4. Prevention:
      
      No prevention information is currently available here.
      
      
   5. Model System:
      
      No model system information is currently available here.
      
      

IV. Labwork Information

A. Biosafety Information:

1. General biosafety information :
   • Biosafety Level: Biosafety Level 2 practices and facilities are recommended for nonpropagative laboratory procedures, including serological and fluorescent antibody procedures, and for the staining of impression smears. Biosafety Level 3 practices and facilities are recommended for all other manipulations of known or potentially infectious materials, including necropsy of experimentally infected animals and trituration of their tissues, and inoculation, incubation, and harvesting of embryonate eggs or cell cultures. Animal Biosafety Level 2 practices and facilities are recommended for the holding of experimentally infected mammals other than arthropods. Level 3 practices and facilities are recommended for animal studies with arthropods naturally or experimentally infected with rickettsial agents of human disease. Because of the proven value of antibiotic therapy in the early stages of infection, it is essential that laboratories working with rickettsiae have an effective system for reporting febrile illnesses in laboratory personnel, medical evaluation of potential cases and, when indicated, institution of appropriate antibiotic therapy. Vaccines are not currently available for use in humans (CDC: Rickettsial agents).
   • Precautions:
     • The problem of biohazard containment is both technical and architectural. Because rickettsiae are transmissible by parenteral and aerosol routes, these organisms must be handled in a closed room under relative negative pressure with an antechamber. Work should be performed in an appropriate biohazard containment hood, and the laboratory worker should wear mask, gloves, and protective clothing (Walker et al., 1988). Accidental parenteral inoculation and exposure to infectious aerosols are the most likely sources of laboratory-associated infections. Biosafety Level 2 practices and facilities are recommended for nonpropagative laboratory procedures, including serological and fluorescent antibody procedures, and for the staining of impression smears. Biosafety Level 3 practices and facilities are recommended for all other manipulations of known or potentially infectious materials, including necropsy of experimentally infected animals and trituration of their tissues, and inoculation, incubation, and harvesting of embryonate eggs or cell cultures. Animal Biosafety Level 2 practices and facilities are recommended for the holding of experimentally infected mammals other than arthropods. Level 3 practices and facilities are recommended for animal studies with arthropods naturally or experimentally infected with rickettsial agents of human disease. Because of the proven value of antibiotic therapy in the early stages of infection, it is essential that laboratories working with rickettsiae have an effective system for reporting febrile illnesses in laboratory personnel, medical evaluation of potential cases and, when indicated, institution of appropriate antibiotic therapy. Vaccines are not currently available for use in humans. Rickettsial agents can be handled in the laboratory with minimal danger to life when an adequate surveillance system complements a staff which is knowledgeable about the hazards of rickettsial infections and uses the safeguards recommended (CDC: Rickettsial agents). Since X. cheopis fleas are the key factor in the transmission cycle of murine typhus to humans in many endemic area, field surveys to evaluate the prevalence of R. typhi infection in these fleas should be conducted from time to time. Such evaluation would generated important epidemiological information and provide a baseline for effective control programs (Webb et al., 1990).

B. Culturing Information:

1. Plaque Assay in Vero76 Cells (Policastro et al., 1996):
   1. Description: Typhus group rickettsiae, including Rickettsia prowazekii and R. typhi, produce visible plaques on primary chick embryo fibroblasts and low-passage mouse embryo fibroblasts but do not form reproducible plaques on continuous cell culture lines. We tested medium overlay modifications for plaque formation of typhus group rickettsiae on the continuous fibroblast cell line Vero76. A procedure involving primary overlay with medium at pH 6.8, which was followed 2 to 3 days later with secondary overlay at neutral pH containing 1 microgram of emetine per ml and 20 micrograms of NaF per ml, resulted in visible plaques at 7 to 10 days post infection. A single-step procedure involving overlay with medium containing 50 ng of dextran sulfate per ml also resulted in plaque formation within 8 days post infection. These assays represent reproducible and inexpensive methods for evaluating the infectious titers of typhus group rickettsiae, cloning single plaque isolates, and testing the susceptibilities of rickettsiae to antibiotics (Policastro et al., 1996).
      
      
2. Shell Vial Assay (Vestris et al., 2003):
   1. Description: This laboratory has adapted a centrifugation cell culture system, the shell vial assay for isolation of bacteria. This technique is routinely in a biosafety level equipped laboratory for the isolation of rickettsiae and other strictly or facultative intracellular bacteria from tissue biopsies especially tick-bite eschars and blood samples. This study reports the isolation of rickettsiae in clinical specimens using the shell vial culture system. Culture was performed as follows: heparinized blood was sedimented for 1 hour, and 1 ml of the supernatant was collected for inoculation in shell vials; skin biopsy specimens were homogenized in 1 ml of sterile brain heart infusion broth, and the homogenate was aspirated into a 1 ml syringe through a 27 gauge needle to filter out coarse material. Samples were inoculated into shell vials containing a monolayer of human embryonic lung (HEL) fibroblasts grown on a 1 cm(2) coverslip. Three shell vials were inoculated and then centrifuged for 1 hours at 700 x g and 22(degree)C. The brain heart infusion was discarded and replaced with culture medium (Eagle's minimal essential medium with 4% fetal calf serum and 2 mM L- glutamine) and shell vials were incubated at 32(degree)C. Detection of rickettsial organisms on the coverslip was carried out, while it remained inside the shell vial by Gimenez staining and indirect immunofluorescence assay after 3, 6 and 14 days. Immunofluorescence was positive, the culture was reported as positive and culture supernatants were sampled in order to identify the isolate by a specific PCR assay. The remaining supernatants of positive shell vials as well as the third shell vial were inoculated on confluent layers of HEL cells in 25 cm(2) culture flasks in order to propagate isolates. Strains were also adapted to Vero cells and/or L929 cells, which are more conventional for the cultivation of rickettsiae (Vestris et al., 2003).
      
      
   2. Medium:
      1. Brain heart infusion broth and Eagle's minimal essential medium (Vestris et al., 2003)
   3. Optimal Temperature: shell vials were incubated at 32 (degree) C (Vestris et al., 2003)

C. Diagnostic Tests :

1. Organism Detection Tests:
   1. Microimmunofluorescence:
      1. Time to Perform: 1-hour-to-1-day
      2. Description: A microimmunofluorescence test was used to study antibody responses to various spotted fever group and typhus group rickettsiae during Rocky Mountain Spotted Fever (RMSF) and epidemic Typhus (ET). This test is sensitive and measures antibodies to species-specific antigens of infecting strains. Standard antigens were rickettsiae that were cultivated in chicken embryo sacs, inactivated with 0.2% formalin and purified. Rickettsial antigens were applied by dip pen point to microscopic slides. After drying antigen sets were overlaid with loopfuls of fluorescein isothiocyanate-labeled goat anti-human globulin or conjugated rabbit anti-human immunoglobulin M (IgM). The anti-Ig conjugate detected antibodies in both IgM and IgG classes. This was determined after adsorption of the conjugate with purified IgG or IgM in tests of typhus antisera with and without IgM antibodies. Cross reactions of varying degree sometimes occurred to antigens both within and between the spotted fever and typhus groups. The degree of cross-reaction to other rickettsial strains varied from patient to patient, but a particular pattern of cross-reaction was consistently observed in serial sera from the same patient (Philip et al., 1976).
      3. False Positive: Cross-reactions of varying degree sometimes occurred to antigens both within and between the spotted fever and typhus group (Philip et al., 1976).
   2. Immunofluorescence microscopy:
      1. Time to Perform: unknown
      2. Description: A micro-immunofluorescence assay (MIF) was designed using species specific monoclonal antibodies (Mabs) applied to flea cryosections. A species specific monoclonal antibody to R. typhi T[7]A[5] was derived from mice inoculated with cell-cultivated, purified and formalin-inactivated R. typhi strain Wilmington were developed. R. typhi was grown in L929 cell monolayers. The T[7]A[5] MAb reacted with a 120 kDa protein antigen from R. typhi by immunoblotting. This MAb did not have cross-reactivity with R. rickettsii, R. conorii, R. sibirica, R. slovaca, R. honei, R. montanensis, R. japonica, R. australis, R. akari, R. parkeri, R. africae, R. massiliae, R. prowazekii and R. canadensis. This tool may greatly facilitate the study of fleas and flea-borne diseases as it can be used to survey fleas for these organisms, estimate risk of outbreaks developing, follow the progress of endemic organisms, and justify the implementation of controls to prevent the spread of infections. The sensitivity of the described method did not exceed 47% (7/15) for R. typhi (Fang et al., 2003).
   3. Gimenez or Giemsa stain for light microscopy:
      1. Time to Perform: unknown
      2. Description: The organisms are small (0.3-1.0 um) coccobacilli that have a typical gram-negative cell envelope in ultrastructural studies and also contain peptidoglycan and lipopolysaccharides. They are poorly stained by the Gram method and are better visualized using the Gimenez or Geimsa stains (Raoult et al., 2004). Giemsa or Gemenez staining is useful for identifying the organism in the cytoplasm of cells (Baxter et al., 1996).
   
   
2. Immunoassay Tests:
   1. Complement-fixation:
      1. Time to Perform: 1-hour-to-1-day
      2. Description: Sera from patients suspected of having rickettsial infections were tested in the complement fixation test with antigens prepared from the rickettsiae of Rocky Mountain spotted fever (SF), rickettsial pox (RP), murine typhus, epidemic typhus, and from Rickettsia canada (RC). Eight units of antigen were used in all cases and two units in man. Only those patients with antibody titers of 1:16 or higher were included in the study. Largely on the basis of comparative titers, the patients were divided into two groups: 102 with SF and 35 with infections by one of the members of the typhus group. The antibody titers were higher with SF antigen than RP antigen in 72% of the SF patients, and in only two SF patients was the RP titer higher, and then by only one tube (twofold dilution). There seemed little advantage in including the RP antigen in the battery of rickettsial antigens. Cross-reaction with at least one of the typhus antigens was observed in the sera from 64% of the SF patients. It was extensive enough to be confusing (within one tube) in 17% with eight units of antigen, but the differentiation was more distinct with two units of antigen. The cross-reaction with typhus antigens was as frequent in children with SF as it was in adults; thus, it is unlikely that these cross-reactions resulted from previous typhus vaccination. The serological differentiation between murine typhus and epidemic typhus was frequently difficult, but the epidemiological background was distinct. Five patients had higher titers to RC antigen, and four of these may possibly have had RC infections (Shephard et al., 1976). Antibody titers obtained by the CF test correlate better with IgG titers than with IgM titers obtained by immunofluorescence assay. Results vary according to the method of antigen production and the amount of antigen used in the assay. The use of 8U of antigen increases the sensitivity of detection of the early IgM response but also increases the numbers of cross-reactions between antibodies to typhus and SFG rickettsiae (La Scola et al., 2002).
   2. Enzyme-linked immunosorbent assay:
      1. Time to Perform: 1-hour-to-1-day
      2. Description: Enzyme-linked immunosorbent assay (ELISA) was first introduced for detection of antibodies against Rickettsia typhi and Rickettsia prowazekii. The use of this technique is highly sensitive and reproducible, allowing the differentiation of IgG and IgM antibodies (La Scola et al., 2002)
   3. Western blotting:
      1. Time to Perform: 1-hour-to-1-day
      2. Description: Differentiation of murine typhus due to Rickettsia typhi and epidemic typhus due to Rickettsia prowazekii is critical epidemiologically but difficult serologically. Using serological, epidemiological, and clinical criteria, we selected sera from 264 patients with epidemic typhus and from 44 patients with murine typhus among the 29,188 tested sera in our bank. These sera cross-reacted extensively in indirect fluorescent antibody assays (IFAs) against R. typhi and R. prowazekii, as 42% of the sera from patients with epidemic typhus and 34% of the sera from patients with murine typhus exhibited immunoglobulin M (IgM) and/or IgG titers against the homologous antigen (R. prowazekii and R. typhi, respectively) that were more than one dilution higher than those against the heterologous antigen. Serum cross-adsorption studies and Western blotting were performed on sera from 12 selected patients, 5 with murine typhus, 5 with epidemic typhus, and 2 suffering from typhus of undetermined etiology. Differences in IFA titers against R. typhi and R. prowazekii allowed the identification of the etiological agent in 8 of 12 patients. Western blot studies enabled the identification of the etiological agent in six patients. When the results of IFA and Western blot studies were considered in combination, identification of the etiological agent was possible for 10 of 12 patients. Serum cross-adsorption studies enabled the differentiation of the etiological agent in all patients. Our study indicates that when used together, Western blotting and IFA are useful serological tools to differentiate between R. prowazekii and R. typhi exposures. While a cross-adsorption study is the definitive technique to differentiate between infections with these agents, it was necessary in only 2 of 12 cases (16.7%), and the high costs of such a study limit its use (La Scola et al., 2000).
      3. False Positive: When both IFA and Western blot results were considered, exposure to R. prowazekii or R. typhi was reliably determined for 10 of the 12 patients (La Scola et al., 2000).
   4. Lipolysaccharide test:
      1. Time to Perform: 1-hour-to-1-day
      2. Description: A monoclonal antibody directed against an epitope on the polysaccharide of typhus-group rickettsiae was developed for the purpose of detecting this heat stable proteinase resistant antigen in formalin-fixed, paraffin-embedded tissues. R. typhi organisms were identified in endothelial cells from a fatal case of murine typhus and in experimentally infected mice. This approach is applicable not only to the study of archival tissues and experimental animal models but also could be used to establish a timely diagnosis of typhus group rickettsiosis by immunohistochemical examination of cutaneous biopsies of rash lesions during the acute stage of illness. The cell wall of organisms of the genus Rickettsia contains abundant lipopolysaccharides (LPS). Antigenic characteristics separate rickettsiae into the typhus group and the spotted fever group. Human diseases caused by typhus-group rickettsiae include murine typhus; epidemic louse-borne typhus, recrudescent typhus, and flying squirrel-associated typhus (R. prowazekii); and cat flea-associated infection with R. felis. The immunohistochemical slides were incubated with 1:6000 dilution of a biotinylated mouse anti-typhi LPS monoclonal antibody developed in the Rickettsial and Ehrlichial Diseases Research laboratory, University of Texas Medical Branch, Galveston, Texas. The specificity of this monoclonal antibody for typhus group LPS was demonstrated by Western immunoblotting (Walker et al., 1997).
   5. Cross-adsorption test:
      1. Time to Perform: 1-hour-to-1-day
      2. Description: Epidemic typhus and murine typhus are arthropod-transmitted diseases caused by, respectively, Rickettsia prowazekii and R. typhi. The laboratory diagnoses of both diseases are based on serological reactions. Reactive antibodies in human sera cross-react extensively with species from the typhus group. The serological reference method is immunofluorescence analysis, but the Weil-Felix test, enzyme-linked immunosorbent assay, immunoperoxidase assay, latex agglutination test, dot blot assay, and Western immunoblotting have also been used. Differentiation of etiological agents in the typhus group is difficult because differences in titer of less than one dilution are found in two-thirds of patients. In these patients, epidemiologic data may indicate the most likely etiological agent from a given biogroup. In areas where the etiological agents coexist, however, it may be impossible to make a definitive diagnosis by routine serological testing. The reference test used to avoid such cross-reactions is the cross-adsorption procedure. A cross-adsorption study is performed by incubating serum from a patient with the bacterium known to cross-react in serological tests. Cross-adsorption results in the disappearance of homologous and heterologous antibodies when adsorption is performed with the bacterium causing the disease. When it is performed with the bacterium not causing the disease (but responsible for the cross-reaction), antibodies reactive to this bacterium disappear whereas antibodies reactive to the bacterium causing the disease remain detectable. Antigenic cross-reactivity is confirmed by Western immunoblotting after adsorption of sera with the cross-reacting antigens (La Scola et al., 2000).
   6. Weil-Felix Test:
      1. Time to Perform: 1-hour-to-1-day
      2. Description: The Weil-Felix test is based on the detection of antibodies to various Proteus species which contain antigens with cross-reacting epitopes to antigens from members of the genus Rickettsia. Whole cells of Proteus vulgaris OX-19 react with sera from persons infected with typhus group rickettsiae. By the Weil-Felix test, agglutinating antibodies are detectable after 5 to 10 days following the onset of symptoms with the antibodies detected being mainly of the immunoglobulin M (IgM) type. The poor sensitivity and specificity of the Weil-Felix test are now well demonstrated for the diagnosis of Rocky mountain spotted fever, murine typhus, epidemic typhus and scrub typhus. Although a good correlation between the results of the Weil-felix test and detection of IgM antibodies by an immunofluorescence assay (IFA) is often observed, with the development of techniques that are used to grow rickettsiae, this test should be used only as a first line of testing in rudimentary hospital laboratories (La Scola et al., 2002).
   7. Commercial Enzyme Immunoassay for the Detection of Human Antibody to Rickettsia typhi Dip-S-Ticks (DS):
      1. Time to Perform: 1-hour-to-1-day
      2. Description: A commercial enzyme immunoassay for the R. typhi specific antibody called the Dip-S-Ticks (DS) for in vitro diagnostic use for the detection of total IgG and IgM antibodies was recently introduced as an aid in the presumptive diagnosis of typhus. Kits were provided by Integrated Diagnostics. The kits require refrigeration. For each sample assay, the kit contained an antigen strip, four liquid reagents and reaction cuvettes. The manufactured stick contained a series of six windows. The first window or dot of the assay strip was the positive reagent control consisting of PBS. Windows three to six contained fourfold serial dilutions of formalin-treated whole-cell R. typhi antigen (Kelly et al., 2002).
   8. Haemagglutination assay for endemic and epidemic typhus:
      1. Time to Perform: unknown
      2. Description: A latex test for assay of antibodies to endemic and epidemic typhus rickettsiae is simple, group-specific, sensitive and reproducible. Cross-reactivity within the typhus group is extensive. Endemic typhus infection cannot be serologically differentiated from epidemic typhus by latex. Results suggest that this test is useful for routine diagnosis of typhus group infection (Hechemy et al., 1981).
   
   
3. Nucleic Acid Detection Tests: :
   1. Reverse transcriptase PCR amplification:
      1. Time to Perform: 1-hour-to-1-day
      2. Description: A reverse transcriptase PCR assay to detect expression of 120- and 17-kDa antigen genes in Rickettsia typhi. Infected Vero cell and flea RNAs were reverse transcribed by using random hexamers. The 120-kDa surface protein antigen (SPA) (recombinant Omp B) is thought to mediate entry into the host cell, and the 17-kDa surface protein, which is recognized by convalescent-phase sera and can mediate, along with surface protein antigen, protective immunity in animal models. Primers for genomic DNA amplification of a 434 bp segment for the R. typhi 17-kDa antigen gene. For the 120-kDa surface protein antigen, the published sequence of the gene encoding this antigen was used. The cDNA was amplified by using high concentrations of primer and template in an inexpensive, nonradioactive assay (Higgins et al., 1998).
      3. Primers:
         • 17-kDa antigen
           • Forward: GCTCTTGCAACTTCTATGTT (Webb et al., 1990)
           • Reverse: CATTGTTCGTCAGGTTGGCG (Webb et al., 1990)
           • Product
             • Name: 17-kDa antigen
             • Size: 434
             • Product source: Rickettsia typhi
             • Product GenBank Accession Number: DQ317533
   
   
4. Other Types of Diagnostic Tests:
   
   No other tests available here.
   
   

V. References

A. Journal References:

Arango-Jaramillo et al., 1984: Arango-Jaramillo S, Farhang-Azad A, Wisseman CL Jr. Experimental infection with Rickettsia mooseri and antibody response of adult and newborn laboratory rats. Am J Trop Med Hyg. 1984; 33(5): 1017 - 1025. [PubMed: 6486291].

Azad et al., 1990: Azad AF. Epidemiology of murine typhus. Annual review of entomology. 1990; 35: 553 - 569. [PubMed: 2105686].

Azad et al., 1997: Azad AF, Radulovic S, Higgins JA, Noden BH and Troyer JM. Flea-borne rickettsioses: ecologic considerations. Emerging Infectious diseases. 1997; 3(3): 319 - 327. [PubMed: 9284376].

Azad et al., 1998: Azad AF, Beard CB. Rickettsial pathogens and their arthropod vectors. Emerging Infectious Diseases. 1998; 4(2): 179 - 186. [PubMed: 9621188 ].

Azad et al., 2003: Azad AF, Radulovic S. Pathogenic rickettsiae as bioterrorism agents. Ann N Y Acad Sci. 2003; 990(June): 734 - 738. [PubMed: 12860715].

Azad et al., 2003: Azad Abdu F, Radulovic S. Pathogenic Rickettsiae as Bioterrorism Agents. Ann.N.Y.Acad.Sci . 2003; 990: 734 - 738. [PubMed: 12860715].

Baxter et al., 1996: Baxter JD The typhus group. Clin Dermatol. 1996; 14(3): 271 - 278. [PubMed: 8727129].

Bitsori et al., 2002: Bitsori M, Galanakis E, Gikas A, Scoulica E, Sbyrakis S. Rickettsia typhi infection in childhood. Acta Paediatr. 2002; 91(1): 59 - 61. [PubMed: 11883820].

Brown et al., 2002: Brown AE, Meek SR, Maneechai N, Lewis GE. Murine typhus among Khmers living at an evacuation site on the Thai-Kampuchean border. Am J Trop Med Hyg. 1988; 38(1): 168 - 171. [PubMed: 3124646].

CDC, 2003: Hoskinson S, M Lipetz, C Sherer, S Fraser, E Taniguchi, A Tice, D Behling, B Tanabe, D Kwock, P Effler, L Pang, E Brown, L Granville, K Mills, D Sasaki, M Ching Lee, H Matsubayashi, W Warashina, A Ueno, C Takekuma, J Haruno, S Oshiro, P Kitsutani, J McQuiston, C Paddock, J Sumner, J Krebs. Murine typhus--Hawaii, 2002. MMWR Morb Mortal Wkly Rep. 2003; 52(50): 1224 - 1226. [PubMed: 14681594].

Cory et al., 2002: Cory J, Yunker CE, Ormsbee RA, Peacock M, Meibos H, Tallent G. Plaque assay of rickettsiae in a mammalian cell line. Applied Microbiology. 1974; 27(6): 1157 - 1161. [PubMed: 4208640].

Fang et al., 2003: Fang R, Fournier PE, Houhamdi L, Azad AF, Raoult D. Detection of R. felis and R. typhi in fleas using monoclonal antibodies. Ann N Y Acad Sci. 2003; 990(June): 213 - 220. [PubMed: 12860628].

Fergie et al., 2000: Fergie JE, Purcell K, Wanat D. Murine typhus in South Texas children. The Pediatric Infectious Disease Journal. 2000; 19(6): 535 - 538. [PubMed: 10877169].

Galanakis et al., 2002: Galanakis E, Gikas A, Bitsori M, Sbyrakis S. Rickettsia typhi infection presenting as subacute meningitis. Journal of Child Neurology. 2002; 17(2): 156 - 157. [PubMed: 11952082].

Gikas et al., 2004: Gikas A, Doukakis S, Pediaditis J, Kastanakis S, Manios A, Tselentis Y. Comparison of the effectiveness of five different antibiotic regimens on infection with Rickettsia typhi: therapeutic data from 87 cases. Am J Trop Med Hyg. 2004; 70(5): 576 - 579. [PubMed: 15155995].

Hackstadt et al., 1996: Hackstadt T The biology of rickettsiae. Infectious Agents and Disease. 1996; 5(3): 127 - 143. [PubMed: 8805076].

Hechemy et al., 1981: Hechemy Karim E., Osterman JV, Eisemann CS, Elliott LB and Sasowski SJ. Detection of typhus antibodies by latex agglutination. Journal of clinical microbiology. 1981; 13(1): 214 - 216. [PubMed: 6780601].

Hechemy et al., 1991: Hechemy K.E., Fox JA, Groschel DHM, Hayden FG and Wenzel RP. Immunoblot studies to analyze antibody to the Rickettsia typhi group antigen in sera from patients with acute febrile cerebrovasculitis. Journal of clinical micorbiology. 1991; 29(11): 2559 - 2565. [PubMed: 1723073].

Higgins et al., 1998: Higgins JA, Radulovic S, Noden BH, Troyer JM, Azad AF. Reverse transcriptase PCR amplification of Rickettsia typhi from infected mammalian cells and insect vectors. J Clin Microbiol. 1998; 36(6): 1793 - 1794. [PubMed: 9620425].

Houhamdi et al., 2002: Houhamdi L, Fournier PE, Fang R, Raoult D. An experimental model of human body louse infection with Rickettsia typhi. Ann N Y Acad Sci. 2003; 990(June): 617 - 627. [PubMed: 12860699].

Hudson et al., 1997: Hudson HL, Thach AB, Lopez PF. Retinal manifestations of acute murine typhus. Int. Opthalmol. 1997; 21(3): 121 - 126. [PubMed: 9587827].

Jensenius et al., 2004: Jensenius M, Fournier PE, Raoult D. Rickettsioses and the international traveler. Clinical Infectious Diseases. 2004; 39: 1493 - 1499. [PubMed: 15546086].

Kelly et al., 2002: Kelly DJ, Richards AL, Temenak J, Strickman D, Dasch GA. The past and present threat of rickettsial diseases to military medicine and international public health. Clinical Infectious Diseases. 2002; 34(Supplement 4): S145 - S169. [PubMed: 12016590].

Kelly et al., 2005: Kelly PJ, Meads N, Theobald A, Fournier PE, Raoult D. A review of emerging flea-borne bacterial pathogens in New Zealand. The New Zealand Medical Journal. 2005; 118(1208): 1 - 9. [PubMed: 15682209].

La Scola et al., 2000: La Scola B, Rydkina L, Ndihokubwayo JB, Vene S, Raoult D. Serological differentiation of murine typhus and epidemic typhus using cross-adsorption and Western blotting. Clin Diagn Lab Immunol. 2000; 7(4): 612 - 616. [PubMed: 10882661].

La Scola et al., 2000: LaScola Bernard, Rydkina L, Ndihokubwayo JB, Vene S and Raoult D. Serological differentiation of murine typhus and epidemic typhus using cross-adsorption and western blotting. Clinical and diagnostic laboratory immunology. 2000; 7(4): 612 - 616. [PubMed: 95923].

La Scola et al., 2002: La Scola B, Raoult D. Laboratory diagnosis of rickettsioses: current approaches to diagnosis of old and new rickettsial diseases. J Clin Microbiol. 1997; 35(11): 2715 - 2727. [PubMed: 9350721].

Letaief et al., 2005: Letaief AO, Kaabia N, Chakroun M, Khalifa M, Bouzouaia N, Jemni L. Clinical and laboratory features of murine typhus in central Tunisia: a report of seven cases. International Journal of Infectious Diseases. 2005; 9(6): 331 - 334. [PubMed: 16054415].

Manea et al., 2001: Manea SJ, Sasaki DM, Ikeda JK, Bruno PP. Clinical and epidemiological observations regarding the 1998 Kauai murine typhus outbreak. Hawaii Med J. 2001; 60(1): 7 - 11. [PubMed: 11272443].

McLeod et al., 2004: McLeod MP, Qin X, Karpathy SE, Gioia J, Highlander SK, Fox GE, McNeill TZ, Jiang H, Muzny D, Jacob LS, Hawes AC, Sodergren E, Gill R, Hume J, Morgan M, Fan G, Amin AG, Gibbs RA, Hong C, Yu XJ, Walker DH, Weinstock GM. Complete genome sequence of Rickettsia typhi and comparison with sequences of other rickettsiae. Journal of Bacteriology. 2004; 186(17): 5842 - 5855. [PubMed: 15317790].

Murphy et al., 1978: Murphy JR, Wisseman CL Jr, Fiset P. Mechanisms of immunity in typhus infection: some characteristics of intradermal Rickettsia mooseri infection in normal and immune guinea pigs. Infection and Immunity. 1978; 21(2): 810 - 820. [PubMed: 581585].

O'Connor et al., 1996: O'Connor LF, Kelly HA, Lubich JM, Lindsey RJ, McComish MJ. A cluster of murine typhus cases in Western Australia. Med J Aust. 1996; 165(1): 24 - 26. [PubMed: 8676774].

Philip et al., 1976: Philip R.N., Casper EA, Ormsbee A, Peacock MG and Burgdorfer W. Microimmunofluorescence test for the serological study of rocky mountain spotted fever and typhus. Journal of clinical microbiology. 1976; 3(1): 51 - 61. [PubMed: 403761].

Policastro et al., 1996: Policastro PF, Peacock MG, Hackstadt T. Improved plaque assays for Rickettsia prowazekii in Vero 76 cells. J Clin Microbiol. 1996; 34(8): 1944 - 1948. [PubMed: 8818887].

Raoult et al., 2004: Raoult. D, Woodward T, Dumler JS. The history of epidemic typhus. Infect Dis Clin North Am. 2004; 18(1): 127 - 140. [PubMed: 15081509].

Reporter et al., 1996: Reporter R, Dassey DE, Mascola L. Murine typhus still exists in the United States. Clinical Infectious Diseases. 1996; 23(1): 205 - 206. [PubMed: 8816170].

Richards et al., 1997: Richards AL, Soeatmadji DW, Widodo MA, Sardjono TW, Yanuwiadi B, Hernowati TE, Baskoro AD, Roebiyoso, Hakim L, Soendoro M, Rahardjo E, Putri MP, Saragih JM, Strickman D, Kelly DJ, Dasch GA, Olson JG, Church CJ, Corwin AL. Seroepidemiologic evidence for murine and scrub typhus in Malang, Indonesia. Am J Trop Med Hyg. 1997; 57(1): 91 - 95. [PubMed: 9242326].

Roux et al., 1997: Roux V, Rydkina E, Eremeeva M, Raoult D. Citrate synthase gene comparison, a new tool for phylogenetic analysis, and its application for the rickettsiae. International Journal of Systematic Bacteriology. 1997; 47(2): 252 - 260. [PubMed: 9103608].

Shephard et al., 1976: Shephard CC, Redus MA, Tzianabos T, Warfield DT. Recent experience with the complement fixation test in the laboratory diagnosis of rickettsial diseases in the United States. J Clin Microbiol. 1976; 4(3): 277 - 283. [PubMed: 972194].

Siritantikorn et al., 2003: Siritantikorn S, Sangkasuwan V, Eamsila C, Singchai C, Kantakamalakul W, Puthavathana P. Seroprevalence of rickettsial infection in commensal rodents and shrews trapped in the Bangkok Metropolitan Area. J Med Assoc Thai. 2003; 86(6): 516 - 521. [PubMed: 12924799].

Sorvillo et al., 1993: Sorvillo FJ, Gondo B, Emmons R, Ryan P, Waterman SH, Tilzer A, Andersen EM, Murray RA, Barr R. A suburban focus of endemic typhus in Los Angeles County: association with seropositive domestic cats and opossums. Am J Trop Med Hyg. 1993; 48(2): 269 - 273. [PubMed: 8447530].

Takhar et al., 2004: Takhar. Sukhjit Update on emerging infections: news from the centers for disease control and prevention. Annals of Emergency Medicine. 2004; 44(1): 43 - 45. [PubMed: 15226707].

Traub et al., 1978: Traub Robert, Charles Wisseman, Abdul Rahman Farhang-Azad. The ecology of murine typhus-a critical review. Tropical Diseases Bulletin. 1978; 75(4): 237 - 317. [PubMed: 705902].

Vestris et al., 2003: Vestris G, Rolain JM, Fournier PE, Birg ML, Enea M, Patrice JY, Raoult D. Seven years' experience of isolation of Rickettsia spp. from clinical specimens using the shell vial cell culture assay. Annals Of The New York Academy Of Sciences. 2003; 990(June): 371 - 374. [PubMed: 12860657 ].

Walker et al., 1991: Walker DH, Fishbein DB. Epidemiology of rickettsial diseases. European Journal Of Epidemiology. 1991; 7(3): 237 - 245. [PubMed: 1884775].

Walker et al., 1997: Walker David H., Feng HM, Ladner S, Billings AN, Zaki SR, Wear DJ, Hightower B. Immunohistochemical diagnosis of Typhus Rickettsioses using an anti-polysaccharde monoclonal antibody. Modern Pathology. 1997; 10(10): 1038 - 1042. [PubMed: 9346184 ].

Webb et al., 1983: Webb CR Outbreak of Murine Typhus. Morb Mortal Wkly Rep. 1983; 32(9): 131 - 132. [PubMed: 6405195].

Webb et al., 1990: Webb Laura, Carl M, Malloy DC, Dasch GA and Azad AF. Detection of murine typhus infection in fleas by using the polymerase chain reaction. Journal of clinical microbiology. 1990; 28(3): 530 - 534. [PubMed: PMCID: 2108995].

Williams et al., 1992: Williams SG, Sacci JB Jr, Schriefer ME, Andersen EM, Fujioka KK, Sorvillo FJ, Barr AR, Azad AF. Typhus and typhuslike rickettsiae associated with opossums and their fleas in Los Angeles County, California. J Clin Microbiol. 1992; 30(7): 1758 - 1762. [PubMed: 1629332].

B. Book References:

AHFS 2005: McEvoy Gerald K. Drug Information. 1 - 3746. In: McEvoy Gerald K AHFS Drug Information.2005. Authority of the Board of the American Society of Health-System Pharmacists, Bethesda, Maryland, USA.

Azad et al., 1988: Azad A. Farhang Relationship of vector biology and epidemiology of louse and flea-borne rickettsioses. 51 - 61. In: Walker David Biology of Rickettsial Diseases1988. CRC Press, Inc., Boca raton, Florida, USA.

Dumler et al., 2005: Dumler Stephen J. Rickettsia typhi (Murine Typhus). 2306 - 2309. In: Mandell Gerald Mandell, Douglas, and Bennett's Principles and Practice of Infectious Diseases2005. Elsevier Churchill Livingstone, Philadelphia, Pennsylvania, USA.

MICROMEDEX 2001: MICROMEDEX 1 - 3068. In: Drug Information for the Health Care Professional.2001. MICROMEDEX , Englewood, Colorado, USA.

Sexton et al., 1998: Sexton DJ Epidemic and Murine Typhus. 247 - 257. In: Palmer SR, Simpson DIH. Zoonoses: Biology, Clinical Practice and Public Health Control1998. Oxford University Press, USA.

Walker et al., 1988: Walker David Laboratory Diagnosis of Rickettsial Diseases. 135 - 147. In: Walker David Biology of Rickettsial Diseases1988. CRC Press, Inc, Boca raton, Florida, USA.

C. Website References:

NCBI_genomes: Rickettsia typhi str. Wilmington, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?CMD=search&DB=genome ].

American Society for Microbiology-MicrobeLibrary.org: Rickettsia, Obligately Intracellular Bacteria, Pathogenic for Humans I [ http://www.microbelibrary.org/images/Walker/images/rick2-an.jpg ].

Annotated genome and supplemental data: Rickettsia typhi sequence data [ ftp://ftp.hgsc.bcm.tmc.edu/pub/data/Rtyphi/ ].

CDC: Rickettsial agents: Rickettsial Agents [ http://www.cdc.gov/od/ohs/biosfty/bmbl4/bmbl4s7e.htm ].

NCBI Taxonomy Browser: Homo sapiens [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9606&lvl=3&p=mapview&p=has_linkout&p=blast_url&p=genome_blast&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy Browser: Rickettsia typhi taxonomy [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=785&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy Browser: Xenopsylla cheopis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=163159&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy Browser: Monopsyllus anisus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=360615&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy Browser: Pulex irritans [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=173820&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy Browser: Ctenocephalides felis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=7515&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy Browser: Rattus rattus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=10117&lvl=3&lin=f&keep=1&srchmode=1&unlock%20%3C/URL%3E ].

NCBI genomes: Rickttsia typhi str. Wilmington, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi??db=nucleotide&val=NC_006142 ].

NCBI genome Project: Rickettsia typhi str. Wilmington project at Human Genome Sequencing Center, Baylor College of Medicine [ http://www.hgsc.bcm.tmc.edu/projects/microbial/Rtyphi/ ].

NCBI Taxonomy Browser: Rattus norvegicus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?amp;mode=Info&id=10116&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy Browser: Mus musculus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&name=Mus+musculus&lvl=0&srchmode=1&keep=1&unlock ].

NCBI Taxonomy Browser: Didelphis marsupialis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9268&lvl=3&lin=f&keep=1&srchmode=5&unlock ].

NCBI Taxonomy Browser: Felis catus (domestic cat) [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=9685&lvl=0&srchmode=3&keep=1&unlock ].

NCBI Taxonomy Browser: Otomys [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=109680&lvl=0&srchmode=3&keep=1&unlock ].

NCBI Taxonomy Browser: Pelomys fallax [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=121576 ].

NCBI Taxonomy Browser: Rattus exulans [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=34854 ].

NCBI Taxonomy Browser: Mephitis mephitis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=30548&lvl=3&lin=f&keep=1&srchmode=5&unlock ].

NCBI Taxonomy Browser: Rattus argentiventer [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=83752 ].

NCBI Taxonomy Browser: Xenopsylla [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=163158&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy Browser: Hoplopleura [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=160141&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy Browser: Pediculus humanus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=121225&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy Browser: Hyalomma [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=34625&lvl=3&lin=f&srchmode=1&unlock ].

NCBI Taxonomy Browser: Ixodidae (hardbacked ticks) [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=6939&lvl=3&srchmode=1&unlock ].

NCBI Taxonomy Browser: Boophilus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=6940&lvl=3&lin=f&srchmode=1&unlock ].

NCBI Nucleotide Browser: Rickettsia typhi 17 kDa antigen protein gene [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=83751819 ].

NCBI Nucleotide Browser: Pediculus humanus corporis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=121224&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Nucleotide Browser: Pediculus humanus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=121225&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI taxonomy Browser: Cavia porcellus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=10141 ].

Rickettsia typhi str. Wilmington project at Human Genome Sequencing Center, Baylor College of Medicine: Rickettsia typhi str. Wilmington project at Human Genome Sequencing Center, Baylor College of Medicine [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=10679 ].

D. Thesis References:

No thesis or dissertation references used.

VI. Curation Information

• Curators: Shamira Shallom (pathinfo@vbi.vt.edu)
• Date: 02/28/2006
• Version: O.83
• Contact information:
  • Email: pathinfo@vbi.vt.edu