Burkholderia pseudomallei

I. Organism Information

A. Taxonomy Information
  1. Species:
    1. Burkholderia pseudomallei :
      1. GenBank Taxonomy No.: 28450
      2. Description: The genus Burkholderia was created by Yabuuchi et al. to accommodate the former rRNA group II pseudomonads, excluding Pseudomonas pickettii and Pseudomonas solanacearum, which were transferred to the genus Ralstonia. Traditionally, Burkholderia species are known as plant pathogens and soil bacteria with two important exceptions, B. mallei and B. pseudomallei, which are primary pathogens for humans and animals (Coenye and Vandamme, 2003). The bacterium is a motile, aerobic, non-spore-forming, gram-negative bacillus (White, 2003). Melioidosis is an infectious disease of humans and animals caused by Burkholderia pseudomallei. It was first described under the name Bacillus pseudomallei by Whitmore and Krishnaswami (1912) following its isolation in Rangoon, Myanmar (Burma) more than 90 years ago. Subsequent reports described the causative agent under a variety of names, including Bacillus whitmori, Pfeifferella whitmori, Pfeifferella pseudomallei, Actinobacillus pseudomallei, Loefferella whitmori, Malleomyces pseudomallei and Pseudomonas pseudomallei. Melioidosis has to be considered an emerging disease with high impact on animal and man. In the past century, it has spread from East Asia to many parts of the world previously not affected (Sprague and Neubauer, 2004).
      3. Variant(s):
        • Burkholderia pseudomallei (Ara+ biotype) :
          • GenBank Taxonomy No.: 95163
          • Parent: Burkholderia pseudomallei
          • Description: Two distinct biotypes of B. pseudomallei strains have been defined recently by their differential ability to assimilate L-arabinose, their virulence in animal models and nucleotide variations in the 16S rRNA gene. The arabinose-positive biotype (ara+) is avirulent and has been found almost exclusively in environmental samples. In contrast, isolates from clinical disease fail to utilise arabinose (ara-), are highly virulent and are also found in the environment. Recently it has been proposed that ara+ isolates should be grouped together to form a new species, Burkholderia thailandensis, on the basis of differences in 16S rRNA sequence (Liu et al., 2002). We have recently identified an organism closely resembling the pathogen B. pseudomallei in soil samples from northeast Thailand. Although the morphology, antigenicity, and antimicrobial susceptibility of this organism are similar to those of the bacteria isolated from patients with melioidosis, this organism has a number of biochemical differences, exemplified by the ability to utilize L-arabinose (Ara +) (Smith et al., 1997).
        • Burkholderia pseudomallei (Ara- biotype) (Smith et al., 1997):
          • Parent: Burkholderia pseudomallei
          • Description: In northeast Thailand, where melioidosis is common, 75% of soil isolates cannot utilize L-arabinose (Ara-), whereas in the central region, where melioidosis is uncommon, nearly all soil isolates have the Ara+ phenotype. Since 1986, we have studied more than 1,200 patients with melioidosis, and in every case the organism isolated had the Ara- biotype. Furthermore, in routine culture and subculture of these isolates, conversion to the Ara+ biotype was never observed, suggesting that the Ara- biotype is stably linked to the virulence of B. pseudomallei. The results of our study of experimental melioidosis show a striking difference between the virulence of the Ara+ and Ara- strains of B. pseudomallei for mice. Ara- strains are highly virulent, whereas Ara+ strains are essentially nonvirulent. Both biochemical types have antigenic similarities; both give positive reactions in the latex agglutination test, in which a polyclonal antibody raised to an Ara- clinical strain of B. pseudomallei is used, and both give similar result in indirect hemagglutination assays for melioidosis. Thus, despite the similarity of their morphologies, culture characteristics, antibiotic susceptibility profiles, and antigenicities, one biotype causes melioidosis and the other does not (Smith et al., 1997).
B. Lifecycle Information :
  1. Burkholderia pseudomallei cells :
    1. Size: The bacteria are small (0.8 x 1.5 um) (Sprague and Neubauer, 2004).
    2. Shape: B. pseudomallei is visualized as a gram-negative bacillus with bipolar staining and is vacuolated and slender and has rounded ends; it is often described as having a "safety pin" appearance. It is oxidase positive and can be distinguished from the closely related but less pathogenic B. thailandensis by its ability to assimilate arabinose (Cheng and Currie, 2005).
    3. Description: The cells of the species of genus Burkholderia are Gram-negative, non-fermentitive straight rods, that have either a single polar flagellum or a tuft of polar flagella (Yabuuchi et al., 1994).

  2. Description: Burkholderia pseudomallei is a saprophytic organism that routinely can be isolated from environmental niches like water, moist soil and rice paddies (Coenye and Vandamme, 2003). Burkholderia pseudomallei is a natural saprophyte that can be isolated from soil and muddy water in endemic areas. It lives in the rhizosphere and is believed to play an important role in denitrification. The agent can be found in soil and clay layers from the surface but more often and regularly in deeper layers from 25 to 120 cm. B. pseudomallei can multiply in soil at a pH from 4 to 8, at a minimal humidity of 10-15% and at temperatures from 4 to 42C but not in estuarine or salt water. It has been noted that the isolation rate was high in places used by animals to rest in the shade. Aerotaxis may account for the bacteria moving actively from deeper layers to the surface soil if it is moistened, e.g. by rain or agricultural practices. The type of soil seems not to be a major factor. The minimum isotherm for a steady establishment in a new geographic area seems to be 11C (Sprague and Neubauer, 2004). Humans and animals are infected by exposure to B. pseudomallei present in soil and surface water in endemic locations (Currie, 2003).
C. Genome Summary:
  1. Genome of Burkholderia pseudomallei (Website 42):
    1. Description: The complete genome of B. pseudomallei strain K96243 consists of two circular replicons (European Molecular Biology Laboratory accession nos. BX571965 [GenBank] and BX571966 [GenBank] ) of 4.07 Mb and 3.17 Mb each that have been designated chromosome 1 and chromosome 2 and encode 3,460 and 2,395 coding sequences (CDS), respectively (Holden et al., 2004).
    2. Burkholderia pseudomallei K96243 chromosome 1:
      1. GenBank Accession Number: NC_006350
      2. Size: 4074542 bp
      3. Gene Count: 3529 genes, 3399 proteins
      4. Description: This strain was a clinical isolate from Thailand. The genome of this organism carries many genomic islands as compared to the related organism B. mallei, suggesting extensive horizontal transfer. Three different type III secretion systems (TTSS) are encoded on the chromosomes of this organism, two of which are similar to plant pathogenic TTSSs, while the third is similar to the Salmonella pathogenicity island, all of which may contribute to pathogenicity. Other virulence determinants include multidrug efflux pumps, secreted toxins and proteases, and various adhesins. Capsular polysaccharide may protect the organism from host defense mechanisms. This organism also carries a number of small sequence repeats which may promote antigenic variation, similar to what was found with the B. mallei genome (NCBI K96243 Sequencing Project). Chromosome 1 contains a higher proportion of CDSs involved in core functions, such as macromolecule biosynthesis, amino acid metabolism, cofactor and carrier synthesis, nucleotide and protein biosynthesis, chemotaxis, and mobility (Holden et al., 2004).
    3. Burkholderia pseudomallei K96243 chromosome 2:
      1. GenBank Accession Number: NC_006351
      2. Size: 3173005 bp
      3. Gene Count: 2406 genes, 2329 proteins
      4. Description: Chromosome 2 has a weaker G+C deviation pattern, and the predicted origin of replication contains features similar to those associated with plasmid replication, such as parA and parB homologues. Identification of CDSs on chromosome 2 that are involved in central metabolism and essential functions has led us to designate this component of the genome as a chromosome rather than a megaplasmid (Holden et al., 2004). Chromosome 2 contains a greater proportion of CDS encoding accessory functions: adaptation to atypical conditions, osmotic protection and iron acquisition, secondary metabolism, regulation, and laterally acquired DNA. In addition, chromosome 2 contains a greater proportion of CDSs with matches to hypothetical proteins or proteins that have no database matches at all. Comparison of the two chromosomes reveals that there is very little similarity, except in the regions of the rRNA clusters. This partitioning of core and accessory functions is reminiscent of the arrangement in the actinomycete soil-dwelling bacterium, Streptomyces coelicolor strain A3 (Holden et al., 2004).

  2. Genome of Burkholderia pseudomallei 1106a
    1. Genome:
      1. GenBank Accession Number: NZ_AAMA00000000
      2. Size: 7211125 bp
      3. Gene Count: 5451 genes, 5451 proteins
      4. Description: Burkholderia pseudomallei 1106a, unfinished sequence, whole genome shotgun sequence (NCBI Genome Sequence). NIH-NIAID has funded this genome project to sequence nine phenotypically characterized strains of B. pseudomallei, as well as 25 B. pseudomallei bacteriophage genomes isolated from 48 different B. pseudomallei strains from various geographic and clinical sources. Variable horizontal gene acquisition by B. pseudomallei is an important feature of recent genetic evolution, and has resulted in a genetically diverse bacterial species. The goal of this project is to identify the specific nucleotide sequences and/or single nucleotide polymorphisms that are correlated with expression of virulence and disease via comparative genomic analysis between B. pseudomallei strains as well as between various bacteriophages harbored within B. pseudomallei (TIGR Sequencing Project).

  3. Genome of Burkholderia pseudomallei 1106b
    1. Genome:
      1. GenBank Accession Number: NZ_AAMB00000000
      2. Size: 7187243 bp
      3. Gene Count: 5461 genes, 5461 proteins
      4. Description: Burkholderia pseudomallei 1106b, unfinished sequence, whole genome shotgun sequence (NCBI Genome Sequence).

  4. Genome of Burkholderia pseudomallei 1655
    1. Genome:
      1. GenBank Accession Number: NZ_AAHR00000000
      2. Size: 7029452 bp
      3. Gene Count: 5410 genes, 5410 proteins
      4. Description: Burkholderia pseudomallei 1655, unfinished sequence, whole genome shotgun sequence (NCBI Genome Sequence).

  5. Genome of Burkholderia pseudomallei 1710a
    1. Genome:
      1. GenBank Accession Number: NZ_AAHS00000000
      2. Size: 7319487 bp
      3. Gene Count: 5502 genes, 5502 proteins
      4. Description: Burkholderia pseudomallei 1710a, unfinished sequence, whole genome shotgun sequence (NCBI Genome Sequence)

  6. Genome of Burkholderia pseudomallei 1710b
    1. Chromosome 1:
      1. GenBank Accession Number: NC_007434
      2. Size: 4126292 bp
      3. Gene Count: 3799 genes, 3736 proteins
      4. Description: Burkholderia pseudomallei 1710b chromosome I, complete sequence (NCBI Genome Sequence).
    2. Chromosome 2:
      1. GenBank Accession Number: NC_007435
      2. Size: 3181762 bp
      3. Gene Count: 2621 genes, 2611 proteins
      4. Description: Burkholderia pseudomallei 1710b chromosome II, complete sequence (NCBI Genome Sequence)

  7. Genome of Burkholderia pseudomallei 668
    1. Genome:
      1. GenBank Accession Number: NZ_AAHU00000000
      2. Size: 7071938 bp
      3. Gene Count: 5433 genes, 5433 proteins
      4. Description: Burkholderia pseudomallei 668, unfinished sequence, whole genome shotgun sequencing project (NCBI Genome Sequence)

  8. Genome of Burkholderia pseudomallei Pasteur
    1. Genome:
      1. GenBank Accession Number: NZ_AAHV00000000
      2. Size: 7346573 bp
      3. Gene Count: 5595 genes, 5595 proteins
      4. Description: Burkholderia pseudomallei Pasteur, unfinished sequence, whole genome shotgun sequencing project (NCBI Genome Sequence)

  9. Genome of Burkholderia pseudomallei S13
    1. Genome:
      1. GenBank Accession Number: NZ_AAHW00000000
      2. Size: 7388320 bp
      3. Gene Count: 5715 genes, 5715 proteins
      4. Description: Burkholderia pseudomallei S13, unfinished sequence, whole genome shotgun sequence (NCBI Genome Sequence)

II. Epidemiology Information

The two locations where melioidosis is arguably the most important single bacterial pathogen for humans are some northeast provinces in Thailand and the Top End of the Northern Territory of Australia. In northeast Thailand, 20% of community-acquired septicemic cases are caused by melioidosis, which accounts for 39% of fatal septicemias and 36% of fatal community-acquired pneumonias. In the Top End of the Northern Territory, melioidosis has been the commonest cause of fatal community-acquired bacteremic pneumonia (Currie, 2005). Melioidosis is endemic in south-east Asia and tropical Australia, and has been reported sporadically elsewhere. However, it is difficult to diagnose without relatively sophisticated laboratory facilities, and the true incidence of the disease in most countries remains unknown. Recent reviews have summarized the clinical experience with melioidosis in China, where cases have been acquired in Hainan Island, Guangdong and Guangxi provinces, and in Taiwan, where 11 indigenous cases have been diagnosed since 1982. A report of two cases in Laos, which is adjacent to the highly endemic areas of Thailand, comes as no surprise, although the authors pointed out the dilemma posed by diagnosing melioidosis in countries that cannot afford to treat it (Dance, 2002). Three human cases of melioidosis, each confirmed by independent Reference Laboratories, have been reported in the past 4 years. These originated from Martinique, Guadeloupe and Puerto Rico. The Caribbean must thus be regarded as endemic for melioidosis, although further work is needed to determine just how common the disease is there and how widely it is distributed (Dance, 2000B).

A. Outbreak Locations:
  1. Northern Territory, Australia. Nine cases of melioidosis with four deaths occurred over a 28-month period in members of a small remote Aboriginal community in the top end of the Northern Territory of Australia. Typing by pulsed-field gel electrophoresis showed isolates of Burkholderia pseudomallei from six of the cases to be clonal and also identical to an isolate from the community water supply, but not to soil isolates. The clonality of the isolates found in this cluster contrasts with the marked genetic diversity of human and environmental isolates found in this region which is hyperendemic for B. pseudomallei. It is possible that the clonal bacteria persisted and were propagated in biofilm in the water supply system. While the exact mode of transmission to humans and the reasons for cessation of the outbreak remain uncertain, contamination of the unchlorinated community water supply is a likely explanation (Currie et al., 2001).
  2. Western Australia. An unusual clustering of culture-confirmed cases of acute melioidosis in a remote coastal community during the dry season prompted an urgent outbreak investigation (Inglis et al., 1999). The population of the affected community fluctuates between about 200 and 300 persons. No record has been found of any cases of melioidosis in the community before 1997. In a typical year there would be around 3-5 cases of melioidosis confirmed in Western Australia (Inglis et al., 1999). The seven patients had an age range of 34-57 years, four were female and three were male. All had at least one of the following chronic disease or co-morbidity risk factors: diabetes, high-risk alcohol consumption, chronic renal failure or rheumatic heart disease. The seventh case presented in August 1998 and gave a history of a brief febrile illness in December 1997, followed by multiple soft tissue lesions and finally culture-positive septicaemic melioidosis in August 1998 (Inglis et al., 1999). B. pseudomallei was isolated from all seven patients. B. pseudomallei was also isolated from water dripping from a back yard tap and from the 51 pre-chlorination bore water sample. No other environmental specimens (including 14 soil specimens from sites around homes of cases, 16 other soils, 4 water specimens from sites around homes of cases, 9 other surface water samples, 10x5L water specimens [4 from capped bores], 2 samples of rammed earth block and 1 water pipe) contained detectable B. pseudomallei (Inglis et al., 1999).
  3. Brazil. Outbreak 1 comprised 4 previously healthy children from the Municipality of Tejussuoca; the children were admitted to the hospital with clinical features of systemic infection over the course of 10 days (February 28-March 7, 2003). Three of the children died because of multiple organ systems failure. Patient 1 died shortly after admission to a local hospital, before any diagnostic microbiology tests could be arranged. Gram-negative bacilli were isolated by blood culture from 2 children, patient 2 and patient 3. For patient 2, the isolate did not survive preliminary laboratory analysis, but findings at autopsy were consistent with melioidosis. In patient 3, the isolate was presumptively identified as B. pseudomallei. Bacterial identification and susceptibility results came too late to guide the treatment of patient 3, who also died, but did lead to changes in antimicrobial drug therapy of patient 4, who was admitted to the hospital later than the other 3 patients, survived, and remains healthy. In her case, melioidosis was demonstrated by laboratory evidence of late seroconversion, detected by indirect hemagglutination assay. Preliminary epidemiologic investigations indicated that the children were probably infected when diving into an irrigation reservoir that filled shortly after the onset of the summer rains (Rolim, 2005). Just over 1 year later, in 2004, several suspected cases of septicemic melioidosis occurred in another location in the State of Ceara (outbreak 2). The B. pseudomallei isolate from 1 such patient and 2 B. pseudomallei isolates from soil and water samples in the corresponding environmental study were sent for confirmation and molecular typing, as before. The patient was from the Municipality of Banabuiu, approximately 400 km from the location of outbreak 1. She used to wash clothing while sitting in a nearby river. She first complained of a perineal abscess, which persisted for 2 weeks before she was admitted to the hospital with septicemia. B. pseudomallei was isolated by blood culture after she died. The B. pseudomallei environmental isolates were from river water taken near where she washed clothes and from soil from the compacted earth floor under the tub she bathed in at home (Rolim, 2005).
  4. France. In France, in the 1970s, cases of melioidosis occurred in animals in a Paris zoo and then spread to other zoos and equestrian clubs in France. As well as fatal animal and human cases, there was extensive soil contamination persisting for some years. B. pseudomallei was considered likely to have been introduced by importation of infected animals, possibly a panda donated to France by Mao-Tse-Tung or horses from Iran (Currie, 2003). All recent isolates from other non-endemic areas appear to have been imported from known endemic areas. There has been no repeat of the outbreak described in France in the mid-1970s and known as Laffaire du Jardin des Plantes. Isolates from this latter outbreak have been examined, however, and appear phenotypically indistinguishable from clinical isolates of B. pseudomallei from elsewhere in the world, although belonging to distinct genotypes (Dance, 2000B).
  5. India. During the month of October, 1994, there was a small outbreak of acute lymphadenitis in and around Pune (Maharashtra). 64 patients with acute lymphadenitis were admitted to Sassoon General Hospital, 32 of whom were children. Lymph-node aspirates from 40 patients were cultured. 12 of these (30%) samples yielded Pseudomonas pseudomallei (Bharadwaj et al., 1994). The clinical presentation of our patients resembled that in patients reported during the outbreak of plague-like illness in Beed (Bharadwaj et al., 1994).
  6. Singapore. In March 2004, a high incidence of melioidosis in Singapore, with a high rate of mortality, was identified by the Ministry of Health. This outbreak raises the possibility, although unlikely, of an intentional release of B. pseudomallei, similar to the intentional release of anthrax spores in the United States following the events of 11 September 2001. We report here a rapid approach to strain typing of the B. pseudomallei isolates obtained during the first half of 2004, in order to exclude the possibility of a point source and hence an intentional release of this pathogen (Liu et al., 2005). Our investigation indicated that a total of 30 different VNTR types could be distinguished in the 32 clinical isolates of B. pseudomallei obtained during this period, thus indicating that infection was unlikely to have occurred from a single source (Liu et al., 2005).
  7. Military cases. Melioidosis was an important cause of morbidity and mortality in foreign troops fighting in South East Asia. Dance noted that about 100 cases occurred among French forces in Indochina between 1948-1954, and by 1973, 343 cases had been reported in American troops fighting in Vietnam (Currie, 2003).
B. Transmission Information:
  1. From: Environment To: Human
    Mechanism: It is now clear that humans and animals are infected by exposure to B. pseudomallei present in soil and surface water in endemic locations (Currie, 2003). Three modes of acquisition, i.e., inhalation, ingestion, and inoculation, are recognized for B. pseudomallei, but the relative contributions of each are yet to be determined. As with other infectious diseases, it is likely that these factors as well as the size of the inoculum are responsible for the pattern and severity of disease. Situations likely to be associated with a high inoculum, such as near drownings, are associated with a short incubation period, even less than 24 h (Cheng and Currie, 2005). The finding that periods of heavy rainfall are associated not only with higher numbers of cases but also pneumonic presentations and cases of increased severity may suggest a shift to inhalation during extreme weather events. This is supported by the recent observation that a number of patients in Singapore who presented during a period of heavy rainfall were elderly, nonambulant patients with no history of exposure to soil or surface water (Cheng and Currie, 2005). It is now believed that inoculation is the major mode of acquisition. Minor wounds to the feet of rice farmers are common during the planting and harvesting seasons, when farmers spend most of the working day wading in mud and surface water; inoculation at the time of a snake bite has also been described. In the Darwin series, 25% of patients gave a history of an inoculation injury prior to presentation; in this subgroup of patients, an incubation period of 1 to 21 days has been defined (Cheng and Currie, 2005).

  2. From: Human To: Human
    Mechanism: Person-to-person transmission of B. pseudomallei is very unusual (Currie, 2003). Venereal transmission was the first report of person-to-person spread of B. pseudomallei infection (McCormick et al., 1975). Person-to-person transmission between 2 siblings may have occurred (Holland et al., 2002). Two cases of maternal to child transmission of melioidosis are reported from Australia's tropical north. One infant died of overwhelming sepsis. Both lactating mothers had mastitis. In 1 case, Burkholderia pseudomallei isolated from breast milk was identical on pulsed-field gel electrophoresis with that in blood and cerebrospinal fluid isolates from the infant (Holland et al., 2002). Mother-to-child transmission of B. pseudomallei probably occurred as a result of placental infection. The use of prednisone and the pregnancy may have increased the susceptibility to infection (Abbink et al., 2001).

  3. From: Animals To: Human
    Mechanism: Zoonotic transmission to humans is extremely unusual, but there are many similar epidemiological and clinical features of melioidosis in animals and humans (Choy et al., 2000). Possible epizoonotic human infections have been implicated in at least three cases in humans in Australia (Cheng and Currie, 2005).

C. Environmental Reservoir:
  1. Burkholderia pseudomallei Environmental Reservoir :
    1. Description: The environmental reservoirs for B. pseudomallei are surface water and soil (CDC Report, 2004).
    2. Survival Information: Burkholderia pseudomallei can survive in water at room temperature for up to 8 weeks, in muddy water for up to 7 months and in soil in the laboratory for up to 30 months. The bacterium is not particularly resistant to UV-irradiation or sunlight. Chlorine has only a bacteriostatic effect on the agent as bacteria were recovered from water containing up to 1000 p.p.m. free chlorine. Lower pH additionally reduces the effect of the disinfectant. However, it can effectively reduce the number of viable bacteria (Sprague and Neubauer, 2004). We still know very little about the climatic, physical, chemical and biological factors which control the proliferation and survival of Burkholderia spp. in the environment (Dance, 2000A).
D. Intentional Releases:
  1. Intentional Release information :
    1. Description: More recently, B. pseudomallei has been considered an important potential bioweapon, with increasing funding overseas for research into virulence factors and vaccine development. It is believed that biological weapons research using B. pseudomallei occurred in the former USSR, although the extent of this effort and the possibility of engineered antibiotic resistant strains remain unknown. Other countries with a military interest in B. pseudomallei included the United States and possibly Egypt (Cheng and Currie, 2005). The potential risk posed by B. pseudomallei as a bioweapon is uncertain. Melioidosis carries a potentially high mortality rate, and its causative agent has intrinsic antibiotic resistance and a wide host range. However, weaponization has not been known to have been performed, the disease does not spread from person to person, and the susceptibility of immunocompetent individuals after inhalation is not clear (Cheng and Currie, 2005).
    2. Emergency contact: CDC requests that incidents involving unsafe laboratory exposure to B. pseudomallei be reported to the Meningitis and Special Pathogens Branch, National Center for Infectious Diseases, telephone 404-639-3158 (CDC Report, 2004).
    3. Delivery mechanism: Burkholderia pseudomallei would most likely be delivered as an aerosol. The lack of a vaccine and its high mortality despite treatment could make it a plausible BW agent (McGovern et al., 1999).
    4. Containment: Animal Biosafety Level 2 practices, containment equipment, and facilities are recommended for studies utilizing experimentally infected laboratory rodents. Biosafety Level 3 practices, containment equipment, and facilities are recommended for work involving production quantities or concentrations of cultures, and for activities with a high potential for aerosol production (CDC: BMBL Section VII).

III. Infected Hosts

  1. Homo sapiens:
    1. Taxonomy Information:
      1. Species:
        1. Human :
          • GenBank Taxonomy No.: 9606
          • Scientific Name: Homo sapiens (NCBI Taxonomy)
          • Description: Melioidosis is a disease of the rainy season in endemic areas. It mainly affects people who have direct contact with wet soils and have an underlying predisposition to infection. These are patients with diabetes mellitus, renal disease, cirrhosis, thalassaemia, alcoholism, or those who are immunosuppressed as the result of either disease or drug treatment. However, melioidosis does not seem to be associated with HIV infection. In Australia, melioidosis has also been linked with chronic lung disease and excessive consumption of kava. B pseudomallei has been recognized as a possible cause of chronic infection in patients with cystic fibrosis. Of the predisposing conditions, diabetes mellitus is the most frequent. Up to 50% of patients with melioidosis have diabetes mellitus, usually maturity onset diabetics, often with evidence of poor control of blood glucose before infection. Melioidosis may present at any age; peak incidence is in the fourth and fifth decades of life, coinciding with development of underlying predisposing illness (White, 2003).

    2. Infection Process:
      1. Description: Infection in humans and animals is thought to occur by inoculation, ingestion or inhalation of environmental organisms. Watering of soil in the dry season, e.g. in the surroundings of water pumps or in fields leads to a higher isolation rate and presumably to a higher risk of infection. The number of registered cases of infection increases with rainfall, e.g. during the rainy season in the tropics when it is more likely that animals and humans can come into contact with muddy water and soil particles carrying bacteria from deeper layers to the surface. Animal-to-human transmission has rarely been documented but can result in fatalities as B. pseudomallei has an extremely broad host range (Sprague and Neubauer, 2004). Disease occurs after bacterial contamination of breaks in the skin or by inhalation after contact with water or soil. A pneumonic form of the disease can also result from the inhalation of contaminated dusts and was reported in U.S. helicopter pilots during the Vietnam War (Holden et al., 2004).

    3. Disease Information:
      1. Melioidosis (i.e., Melioidosis) :
        1. Pathogenesis Mechanism: B. pseudomallei survives inside several eukaryotic cell lines and is seen within phagocytic cells in pathological specimens. After internalisation, it escapes from endocytic vacuoles into the infected cell cytoplasm and then forms membrane protrusions by inducing actin polymerisation at one pole. The actin protrusions from the infected cell membrane mediate spread of the organism from cell to cell. The role of exotoxins in the pathogenesis of melioidosis is unresolved. The high mortality of B. pseudomallei infections is related to an increased propensity to develop high bacteraemias (more than 1 cfu/mL), but the relation between bacterial counts in blood and mortality is similar to that of other gram-negative pathogens. This finding suggests that exotoxins do not contribute directly to outcome. The cell wall lipopolysaccharide (LPS), which is the immunodominant antigen, is highly conserved. High concentrations of antibodies to LPS 2 are associated with improved survival in severe melioidosis. B. pseudomallei produces a highly hydrated glycocalyx polysaccharide capsule, an important virulence determinant that helps to form a slime. This capsule facilitates formation of microcolonies in which the organism is both protected from antibiotic penetration and phenotypically altered, resulting in reduced susceptibility to antibiotics (small colony variants). Passive immunisation with antibody to this exopolysaccharide reduces the lethality of infection in mice. To date, the organisms which cause invasive disease are indistinguishable from those found in the environment (White, 2003).


        2. Incubation Period: In endemic areas, seroepidemiological surveys showed that infection, mostly latent, occurred fairly commonly since childhood as 80% of children had antibodies by the age of four years. However, clinical melioidosis is more common in the elderly which in some cases are due to reactivation of primary latent infection. Since the incubation period of the reactivation can vary from weeks to many years, a vaccine or short-course secondary chemoprophylaxis may be possible interventions for the high risk group to get rid of the "time-bomb" reactivation (Leelarasamee, 1998). Incubation period from defined inoculating events was previously ascertained as 1-21 (mean 9) days (Currie et al., 2000 (a)). The incubation period (time between exposure and appearance of clinical symptoms) is not clearly defined, but may range from 2 days to many years (CDC: Melioidosis). In addition, incubation periods of as long as 24 to 29 years in ex-servicemen who were in Papua New Guinea and Vietnam have been described (Cheng and Currie, 2005).


        3. Prognosis: Prognosis is poor. Detection of the bacterium in blood culture in severe disease is associated with higher mortality. In one study 74% of people with a positive blood culture died within 24 hours. Mortality is high in severe disease (septicaemic form of melioidosis) in which the clinical course often deteriorates rapidly even with the currently available treatments, with disseminated infection associated with 40% to 90% of people dying. In people with septicaemia with only one organ involved, death rates are in the region of 20%. Treatment with the antibiotics ceftazidime and imipenem seems to reduce the number of deaths, although the numbers remain high (Samuel and Ty, 2002). While 20-36% of melioidosis cases have no evident predisposing risk factor, the vast majority of fatal cases have an identified risk factor, the most important of which are diabetes, alcoholism and chronic renal disease. 46% of cases were bacteraemic and overall mortality was 19%, compared with 60% bacteraemia and 44% mortality in Thailand, and 52% bacteraemia and 46% mortality in Singapore (Currie, 2003). The mortality rate is below 10% for illness severity that lies between asymptomatic and localized melioidosis. The mortality rate rises sharply from 10% in septicemic melioidosis to 90% in melioidosis with septic shock (Leelarasamee, 2004).


        4. Diagnosis Overview: Melioidosis should be suspected in any severely ill febrile patient with an underlying predisposing condition who lives in, or has traveled from, an endemic area. In northeast Thailand, B. pseudomallei is the most common cause of septicaemic illness during the rainy season in adult diabetics. Evidence of abscess formation is often noted either in the lungs on the chest radiograph, or in the liver and spleen on ultrasound examination. Whereas liver abscess can be caused by Entamoeba histolytica or by enteric bacteria, splenic abscess is much less common, and is more likely than liver abscess to suggest melioidosis in endemic areas; in northeast Thailand 95% of splenic abscesses are caused by B pseudomallei. Up to 13% of patients with septicaemia have subcutaneous abscesses in which gram-negative rods can be detected. Haematological and biochemical findings are similar to those in patients with other causes of bacterial sepsis, although evidence of the underlying predisposing condition (hyperglycaemia or renal impairment) is often noted (White, 2003). The laboratory diagnosis of melioidosis is best made with a culture of the appropriate clinical material. Serology has a role in the diagnosis of this condition, particularly in patients from areas where it is not endemic who travel to an area where it is endemic and develop a suggestive clinical condition. Serum samples from patients resident in areas where it is endemic can be positive in the absence of clinical disease. This would represent previous exposure and does not necessarily imply current disease. Other diagnostic methods that have been used include latex agglutination for detection of antigen in urine and molecular detection (Lowe et al., 2002).


        5. Symptom Information :
          • General Description: Melioidosis affects virtually every organ except the hair and nails, and resembles acute and chronic infections. Rare and unusual infected sites are continually being reported. Small and large abscesses have been found in the brain, prostate gland, parotid gland, intra-abdominal mesenteric root, upper-extremity joints, masticator space, and skin and soft tissues. Mycotic aneurysm of the iliac, subclavian arteries, and elsewhere is not rare. In difficult-to-treat cases, the anatomic localization of suspected abscesses in internal organs using ultrasonography or white cell scanning is an effective way of assessing the involvement of musculoskeletal, visceral and soft tissue melioidosis. The latter technique may be performed in cases who have septicemic melioidosis and are infected with susceptible micro-organisms but respond slowly, or in those who have experienced relapse soon after the cessation of therapy. Acute or subacute pneumonia was encountered in nearly half of all acute infections. Bloodstream pneumonia manifested with bilateral multi-nodular pulmonary infiltrations is most commonly associated with high mortality, followed by lobar pneumonia, lung abscess and lung mass. Empyema and pyopericardium are less common. Thoracic wall involvement, such as sternoclavicular septic arthritis, supraclavicular lymphadenopathy, is sometimes seen (Leelarasamee, 2004). The earliest descriptions of melioidosis documented the fulminant end of the clinical spectrum, with abscesses throughout both lungs and in many organs. At the other end of the spectrum are asymptomatic infections and localized skin ulcers or abscesses without systemic illness. Howe and colleagues classified melioidosis as acute, subacute, and chronic. The Infectious Disease Association of Thailand summarized 345 cases in these categories: 1. Disseminated septicemia (45% of cases, 87% mortality); 2. Nondisseminated septicemia (12% of cases, 17% mortality); 3. Localized septicemia (42% of cases, 9% mortality); 4. Transient bacteremia (0.3%) (Currie, 2005).
          • Syndrome -- Melioidosis with septic shock:
            • Description: All patients with septic shock had fever of 1 weeks' duration or less. One of the patients developed renal impairment and another patient had an abnormal coagulation profile on admission. All patients had pneumonia and 2 had involvement of multiple organs (How et al., 2005). 80-90% mortality in cases treated with ceftazidime (Leelarasamee, 2004).
            • Observed: In our study, 38.4% of cases presented with septic shock, which had an associated mortality rate of 80% (How et al., 2005). 20% of cases in the Darwin series, 16% of cases in the Kuala Lampur series, and 30% in the Sapprasithiprasong Hospital series (Cheng and Currie, 2005).


            • Symptoms Shown in the Syndrome:

            • Pneumonia:
              • Description: Pneumonia is the commonest clinical presentation of patients with melioidosis in all studies, accounting for around half the cases (Currie, 2005). Acute melioidosis pneumonia has a spectrum from fulminant septic shock (mortality 84% in the Darwin study to mild undifferentiated pneumonia, which can be acute or subacute in nature, both with little mortality (Currie, 2003).
          • Syndrome -- Disseminated septicemia:
            • Description: Disseminated septicemic melioidosis clinically involves more than one organ. For example, bloodstream pneumonia (multinodular bilateral pulmonary infiltration) or septic arthritis develops subsequently to pre-existing liver abscess or splenic abscess (Leelarasamee, 2004). 40-50% mortality in cases treated with ceftazidime (Leelarasamee, 2004).
            • Observed: 45% of cases, 87% mortality (Currie, 2005)


            • Symptoms Shown in the Syndrome:

            • Pneumonia:
          • Syndrome -- Nondisseminated septicemia:
            • Description: Septicemic melioidosis clinically involves a single organ such as the lung, prostate gland, spleen, parotid gland, and has a positive blood culture (Leelarasamee, 2004). 10-40% mortality in cases treated with ceftazidime (Leelarasamee, 2004).
            • Observed: 12% of cases, 17% mortality (Currie, 2005)


            • Symptoms Shown in the Syndrome:

            • Pneumonia:
              • Description: Pneumonia is the commonest clinical presentation of patients with melioidosis in all studies, accounting for around half the cases (Currie, 2005). Acute melioidosis pneumonia has a spectrum from fulminant septic shock (mortality 84% in the Darwin study to mild undifferentiated pneumonia, which can be acute or subacute in nature, both with little mortality (Currie, 2003).
          • Syndrome -- Localized septicemia:
            • Description: Liver abscess or cutaneous granuloma and negative blood culture is an example of localized melioidosis (Leelarasamee, 2004). Among patients with localized melioidosis in Thailand, head and neck involvement was the most common presentation. Dance et al reported that 38% of patients with localized melioidosis had involvement of the parotid gland. They also found an association of acute suppurative parotitis with mumps. In contrast, none of the cases in studies from Australia had parotitis (How et al., 2005). 0-10% mortality in cases treated with ceftazidime (Leelarasamee, 2004).
            • Observed: Localized melioidosis is a more common presentation in the pediatric age group. In our study, 46.2% of the patients had localized disease, compared to approximately 65% in a study from Thailand (How et al., 2005). 42% of cases, 9% mortality (Currie, 2005)


            • Symptoms Shown in the Syndrome:

            • Neurological melioidosis or brain abscess:
              • Description: Encephalomyelitis, characterized by brain stem encephalitis and flaccid paralysis, is seen in 4% of melioidosis presentations in northern Australia and is associated with considerable morbidity and mortality. Small numbers of children with a similar syndrome have been recognized in Thailand. Cultures of cerebrospinal fluid were positive in only one of seven cases, with monocytic pleocytosis the most common finding. This should be distinguished from more focal suppurative infections involving the central nervous system, which have been well described. Some of these may represent direct spread from contiguous sites, such as facial sinuses or orbital cellulitis. Primary meningitis has been observed in Thailand but more often results from ruptured cerebral abscesses . Neurological involvement has also been observed in animals (Cheng and Currie, 2005)
              • Observed: 4% of cases in the Darwin series, 6% of cases in the Kuala Lampur series, and 3% of cases in the Infectious Diseases Association of Thailand series (Cheng and Currie, 2005).
            • Bone/Joint Infections:
              • Description: Bone and joint infections are uncommon and may be difficult to differentiate from other causes of infection, except that the systemic features of the illness may be more prominent. Surgical drainage is often required, together with long courses of intravenous antibiotics (Cheng and Currie, 2005).
              • Observed: 4% of cases in the Darwin series, 2% of cases in the Kuala Lampur series, and 3% of cases in the Infectious Diseases Association of Thailand series (Cheng and Currie, 2005).
            • Skin/Soft tissue infections:
              • Description: Skin and soft tissue infections are a common manifestation of melioidosis and may be the source of systemic infection or result from hematogenous spread. Presentations may be rapidly progressive, similar to necrotizing fasciitis from other organisms. Infections involving many other sites have been described, including mycotic aneurysms, mediastinal infection, and thyroid and scrotal abscesses. Corneal ulcers were described for a series of three Thai patients following corneal trauma. Extensive ulcers, subconjunctival abscesses, and hypopyon were managed with topical and intravenous ceftazidime with good outcomes. Other ocular manifestations include orbital cellulitis with contiguous spread to the sinuses (Cheng and Currie, 2005).
              • Observed: 17% of cases in the Darwin series, 24% of cases in the Kuala Lampur series, 13% of cases in the Infectious Diseases Association of Thailand series, and 13% in the Sapprasithiprasong Hospital series (Cheng and Currie, 2005).
            • Genitourinary infection:
              • Observed: 19% of cases in the Darwin series, 10% of cases in the Kuala Lampur series, 7% of cases in the Infectious Diseases Association of Thailand series, and 8% in the Sapprasithiprasong Hospital series (Cheng and Currie, 2005).
            • Splenic abscess:
              • Description: The high proportion of patients with prostatic infection in Australia contrasts with the higher proportions of patients with liver and spleen abscesses seen in Thailand (Cheng and Currie, 2005).
              • Observed: 4% of cases in the Darwin series, 2% of cases in the Kuala Lampur series, and 2% of cases in the Infectious Diseases Association of Thailand series (Cheng and Currie, 2005).
            • Liver abscess:
              • Description: The high proportion of patients with prostatic infection in Australia contrasts with the higher proportions of patients with liver and spleen abscesses seen in Thailand (Cheng and Currie, 2005).
              • Observed: 2% of cases in the Darwin series, 4% of cases in the Kuala Lampur series, and 7% of cases in the Infectious Diseases Association of Thailand series (Cheng and Currie, 2005).
            • Prostatic abscess:
              • Description: The high proportion of patients with prostatic infection in Australia contrasts with the higher proportions of patients with liver and spleen abscesses seen in Thailand. In Australia, the prevalence of prostatic infection (18% of male patients) mandates routine imaging, with drainage commonly required. This contrasts with other internal abscesses, which may respond to medical therapy alone (Cheng and Currie, 2005)
              • Observed: 18% of cases (of males) in the Darwin series, and 0.3% of cases in the Infectious Diseases Association of Thailand series (Cheng and Currie, 2005).
            • Parotid abscess:
              • Description: Acute suppurative parotiditis accounts for up to 40% of pediatric cases but only small numbers of adult cases in Thailand. It seems to arise in patients with no defined risk factors and is generally associated with a good prognosis. It may be bilateral in 10% of patients and may be complicated by rupture or permanent facial nerve palsy. It has been reported only once in Australia (Cheng and Currie, 2005)
              • Observed: 2% of cases in the Infectious Diseases Association of Thailand series (Cheng and Currie, 2005)
          • Syndrome -- Transient bacteremia:
            • Description: Bacteremic melioidosis shows only a positive blood culture with mild or no fever. It may be an early clinical presentation of mycotic aneurysm in some cases (Leelarasamee, 2004).
            • Observed: 0.3% (Currie, 2005). 0% mortality in cases treated with ceftazidime (Leelarasamee, 2004).
          • Syndrome -- Asymptomatic melioidosis:
            • Description: Asymptomatic melioidosis is found in a healthy host with a positive serological test (Leelarasamee, 2004).
            • Observed: 0% mortality in cases treated with ceftazidime (Leelarasamee, 2004).

        6. Treatment Information:
          • Conventional Therapy, pre 1989: Before 1989, "conventional therapy" for melioidosis consisted of a combination of chloramphenicol, sulfamethoxzaole-trimethoprim, doxycycline, and sometimes kanamycin, given for 6 weeks to 6 months (Currie, 2005). Until about 15 years ago, the usual treatment for confirmed cases of acute severe melioidosis in Thailand was a combination of four drugs given intravenously - chloramphenicol (100 mg/kg per day), doxycycline (4 mg/kg per day) and trimethoprim-sulphamethoxazole (TMP-SXT, 60 mg/kg per day). These drugs are all bacteriostatic rather than bactericidal, are potentially toxic and in vitro, demonstrate mutual antagonism. Not surprisingly therefore, this four-drug 'conventional' regimen had a high failure rate, particularly in septicaemic melioidosis. As approximately 60% of patients admitted to hospital with melioidosis have positive blood cultures, the mortality with this regimen was unacceptably high (over 70%) (Chaowagul, 2000).
            • Applicable:
            • Success Rate: Until 1989 the conventional therapy for melioidosis was high doses of chloramphenicol, doxycycline and SMX/TMP, often in combination with kanamycin. The mortality at this time for septicaemic melioidosis was as high as 68-95% (Jenney et al., 2001). Death rates were high in trial arms using the older conventional regimens of chloramphenicol, doxycycline, and co-triamoxazole (trimethoprim-sulphamethoxazole): 74% in White 1989 and 47% in Sookprance 1992 (Samuel and Ty, 2002).
            • Drug Resistance: In addition to emergence of resistance with this regimen, studies from the same group showed that in vitro SMX/TMP antagonised the bacteriostatic activity of doxycycline and chloramphenicol (Jenney et al., 2001)
          • Ceftazidime: Melioidosis is difficult to treat, and response to treatment is often disappointingly slow despite administration of high dose parenteral antibiotics. The antibiotic of choice is ceftazidime (White, 2003). Following initial intensive therapy, using ceftazidime or imipenem or meropenem, possibly in combination with sulfamethoxazole-trimethoprim, subsequent eradication therapy is considered necessary for preventing recrudescence or later relapse of melioidosis. Both duration of eradication therapy and the best antibiotics to use remain uncertain (Currie, 2005). The cost of treatment is high, especially with beta-lactam regimens. The cost of ceftazidime varies from US $70 to $100 per day for participants diagnosed with severe melioidosis, which is approximately six to seven times higher than the cost of conventional regimens (Samuel and Ty, 2002).
            • Applicable: Initial intensive therapy-minimum of 10-14 days. Ceftazidime (50 mg/kg, up to 2 g) every 6 hours (Currie, 2005).
            • Contraindicator: Hypersensitivity to other cephalosporins or related antibiotics, e.g.p, penicillin (Ehrenpreis and Ehrenpreis, 2001)
            • Complication: Serious: hypersensitivity reactions, bone marrow suppression, hemolytic anemia, pseudomembranous colitis, nephrotoxicity (Ehrenpreis and Ehrenpreis, 2001).
            • Success Rate: The most important therapeutic study for melioidosis was an open-label randomized trial in Thailand comparing ceftazidime (120 mg/kg/day) with conventional therapy, which showed that ceftazidime was associated with a 50% lower overall mortality in severe melioidosis. Ceftazidime then became the drug of choice for initial intensive therapy for melioidosis (Currie, 2005).
            • Drug Resistance: One strain, isolated from human infection, appeared resistant to ceftazidime with a minimum inhibitory concentration (MIC) of 64 mg/L (MICs of ceftazidime for the other strains were between 1-4 mg/L). This strain also presented a cross-resistance to ticarcillin/clavulanate, doxycycline and minocycline and was categorized intermediate for co-amoxiclav with an MIC of 16 mg/L (Thibault et al., 2004). In a large series from Thailand nine (7%) of 127 patients had B. pseudomallei isolates that developed choramphenicol resistance while taking antibiotics (six were definitely taking chloramphenicol itself and the other three may well have been). These isolates frequently showed cross-resistance to SMX/TMP, tetracyclines and ciprofloxacin. In the same series a patient on ceftazidime and another on AMOX/CA developed resistance to these respective agents. Resistance to both ceftazidime and AMOX/CA was seen in a patient in our series who moved interstate and this has been published by Toohey et al. Also in Thailand, Chaowagul et al., describe doxycycline resistance emerging in one of the 12 relapse cases who was taking doxycycline alone in their trial comparing eradication therapy with doxycycline, SMX/TMP and chloramphenicol with doxycycline alone (Jenney et al., 2001).
          • Tetracyclines: There are also reports of successful use of sulfamethoxazole-trimethoprim alone and tetracycline or doxycycline alone. These "conventional antibiotics" are bacteriostatic rather than bactericidal, and in vitro studies have shown various combinations to be antagonistic (Currie, 2005).
            • Applicable:
            • Contraindicator: Hypersensitivity to any tetracycline, patients with esophageal obstruction, children less than 8 years (Ehrenpreis and Ehrenpreis, 2001).
            • Complication: Common: nausea, vomiting diarrhea, anorexia. Serious: renal toxicity, hypersensitivity reactions, benign intracranial hypertension (pseudotumor cerebri), pericarditis, diabetes insipidus, pseudomembranous colitis, hepatitis, anaphylaxis (Ehrenpreis and Ehrenpreis, 2001).
            • Drug Resistance: In a large series from Thailand nine (7%) of 127 patients had B. pseudomallei isolates that developed choramphenicol resistance while taking antibiotics (six were definitely taking chloramphenicol itself and the other three may well have been). These isolates frequently showed cross-resistance to SMX/TMP, tetracyclines and ciprofloxacin. In the same series a patient on ceftazidime and another on AMOX/CA developed resistance to these respective agents. Resistance to both ceftazidime and AMOX/CA was seen in a patient in our series who moved interstate and this has been published by Toohey et al. Also in Thailand, Chaowagul et al., describe doxycycline resistance emerging in one of the 12 relapse cases who was taking doxycycline alone in their trial comparing eradication therapy with doxycycline, SMX/TMP and chloramphenicol with doxycycline alone (Jenney et al., 2001).
          • Trimethoprim-sulfamethoxazole (Co-trimoxazole or SMX/TMP): There are also reports of successful use of sulfamethoxazole-trimethoprim alone and tetracycline or doxycycline alone. These "conventional antibiotics" are bacteriostatic rather than bactericidal, and in vitro studies have shown various combinations to be antagonistic (Currie, 2005). It has been suggested that sulfamethoxazole-trimethoprim is the critical component in the "conventional" combination therapy, and prospective studies in Australia using sulfamethoxazole-trimethoprim alone for eradication therapy support this, with relapses being almost exclusively in noncompliant patients (Currie, 2005). Following initial intensive therapy, using ceftazidime or imipenem or meropenem, possibly in combination with sulfamethoxazole-trimethoprim, subsequent eradication therapy is considered necessary for preventing recrudescence or later relapse of melioidosis. Both duration of eradication therapy and the best antibiotics to use remain uncertain (Currie, 2005).
            • Applicable: Initial intensive therapy-minimum of 10-14 days. Sulfamethoxazole/trimethoprim (40/8 mg/kg, up to 1600/320 mg) every 12 hours (Currie, 2005). Eradication therapy-minimum of 3 months. Sulfamethoxazole/trimethoprim (40/8 mg/kg, up to 1600/320 mg) every 12 hours (Currie, 2005).
            • Contraindicator: Hypersensitivity to trimethoprim or sulfonamides, thiazide diuretics, oral hypoglycemics, megaloblastic anemia due to folate deficiency, pregnancy, lactation, treatment of streptococcal pharyngitis (Ehrenpreis and Ehrenpreis, 2001).
            • Complication: Common: anorexia, nausea, vomiting, glossitis, rash. Serious: Stevens-Johnson syndrome (rare), pseudomembranous colitis, agranulocytosis, aplastic anemia, megaloblstic anemia, hyperkalemia, hemolysis (patients with G6PD deficiency) (Ehrenpreis and Ehrenpreis, 2001).
            • Drug Resistance: The MIC50 and MIC90 of co-trimoxazole were 8 and 16 mg/L, respectively, and the majority of the strains were categorized as intermediate or resistant (breakpoints less than or equal to 2/38, greater than 8/152) to this antibiotic. This relative in vitro resistance is not correlated with clinical experience as co-trimoxazole has been traditionally used for the therapy of melioidosis. Such discrepancies between results obtained with co-trimoxazole by different susceptibility testing methods and clinical data have already been documented (Thibault et al., 2004).
          • Ureidopenicillins (Piperacillin, Piperacillin-tazobactam): The resistance profiles appear to be independent of the origin of isolates. Imipenem, ceftazidime, co-amoxiclav, piperacillin, piperacillin/tazobactam and doxycycline appear as the more effective drugs tested on this panel of isolates. These results remain consistent with the current recommendations for the treatment of melioidosis and glanders. However, the emergence of ceftazidime-resistant clinical isolates and the wide distribution of B. pseudomallei in Southeast Asia increase the risk of malicious use of those resistant strains. Piperacillin/tazobactam could be a useful alternative for treatment of both glanders and melioidosis (Thibault et al., 2004).
          • Doxycycline: Treatment with agents to which B. pseudomallei is susceptible requires 2-4 weeks of parenteral therapy (e.g. with ceftazidime) as initial 'intensive' therapy, followed by 3-6 months of oral 'eradication' therapy (e.g. with trimethoprim-sulphamethoxazole (SMX/TMP), doxycycline or combination therapy (Jenney et al., 2001).
            • Applicable:
            • Contraindicator: Hypersensitivity to any tetracycline, patients with esophageal obstruction, children less than 8 years old (Ehrenpreis and Ehrenpreis, 2001).
            • Drug Resistance: SMX/TMP, doxycycline and chloramphenicol have been the most commonly used agents for eradication therapy and it is to these that resistance has emerged in relapsed and persistent cases (Jenney et al., 2001). In a large series from Thailand nine (7%) of 127 patients had B. pseudomallei isolates that developed choramphenicol resistance while taking antibiotics (six were definitely taking chloramphenicol itself and the other three may well have been). These isolates frequently showed cross-resistance to SMX/TMP, tetracyclines and ciprofloxacin. In the same series a patient on ceftazidime and another on AMOX/CA developed resistance to these respective agents. Resistance to both ceftazidime and AMOX/CA was seen in a patient in our series who moved interstate and this has been published by Toohey et al. Also in Thailand, Chaowagul et al., describe doxycycline resistance emerging in one of the 12 relapse cases who was taking doxycycline alone in their trial comparing eradication therapy with doxycycline, SMX/TMP and chloramphenicol with doxycycline alone (Jenney et al., 2001).
          • Carbapenems (Imipenem and Meropenem): The carbapenems imipenem and meropenem have the lowest minimum inhibitory concentrations against B. pseudomallei. Furthermore, in vitro time-kill studies to measure the rate of bacterial killing showed that carbapenems to perform better against B. pseudomallei than ceftazidime. High-dose imipenem has been shown in another comparative trial from Thailand to be at least as effective as ceftazidime for severe melioidosis, with no differences in mortality between the groups and with fewer treatment failures in those given imipenem (Currie, 2005). Following initial intensive therapy, using ceftazidime or imipenem or meropenem, possibly in combination with sulfamethoxazole-trimethoprim, subsequent eradication therapy is considered necessary for preventing recrudescence or later relapse of melioidosis. Both duration of eradication therapy and the best antibiotics to use remain uncertain (Currie, 2005). Imipenim, an alternative to ceftazidime, also costs about US $150 per day per person (Samuel and Ty, 2002).
            • Applicable: Initial intensive therapy-minimum of 10-14 days. Imipenem (25 mg.kg, up to 1 g) every 6 hours (Currie, 2005). Initial intensive therapy-minimum of 10-14 days. Meropenem (25 mg/l\kg. up to 1 g) every 8 hours (Currie, 2005).
            • Drug Resistance: All the isolates were susceptible to imipenem. This antibiotic was, with doxycycline and minocycline, one of the most active antibiotics tested. This has been observed previously in a study involving 211 clinical strains, and is of interest because this antibiotic is considered as a good alternative to ceftazidime in the treatment of disseminated disease. It has been recommended by the European Agency for the Evaluation of Medicinal Products (EMEA) for the treatment of suspected or confirmed melioidosis (Thibault et al., 2004)
          • Amoxicillin-clavulanate (Co-amoxiclav): After initial favorable reports of use of amoxicillin-clavulanate, another randomized comparative trial in Thailand showed that initial therapy with high-dose intravenous amoxicillin-clavulanate was as effective as ceftazidime in preventing deaths in severe melioidosis. However, when amoxicillin/clavulanate was continued as eradication therapy, treatment failure was more common (Currie, 2005). Co-amoxiclav (amoxycillin-clavulanate) has been shown to be effective but was associated with a higher rate of treatment failure than ceftazidime (Chaowagul, 2000). Amoxicillin-clavulanate is recommended for eradication therapy in pregnancy and is an alternative to sulfamethoxazole-trimethoprim in children (Currie, 2005).
            • Applicable:
            • Contraindicator: Hypersensitivity to penicillin or cephalosporins (Ehrenpreis and Ehrenpreis, 2001).
            • Complication: Common: Diarrhea. Serious: Stevens-Johnson syndrome, anaphylaxis, angioedema, laryngospasm, pseudomembraneous colitis (Ehrenpreis and Ehrenpreis, 2001).
            • Drug Resistance: All other strains of B. mallei and B. pseudomallei were susceptible to co-amoxiclav (Thibault et al., 2004). In the same series a patient on ceftazidime and another on AMOX/CA developed resistance to these respective agents. Resistance to both ceftazidime and AMOX/CA was seen in a patient in our series who moved interstate and this has been published by Toohey et al. Also in Thailand, Chaowagul et al., describe doxycycline resistance emerging in one of the 12 relapse cases who was taking doxycycline alone in their trial comparing eradication therapy with doxycycline, SMX/TMP and chloramphenicol with doxycycline alone (Jenney et al., 2001).

    4. Prevention:
      1. Vaccine:
        • Description: A licensed animal or human vaccine does not exist. However, there are some promising data on the possibility of developing such a vaccine in the future. In a mouse model an attenuated mutant of B. pseudomallei auxothrophic for branched amino acids due to an interruption of the ilvI gene was protective. Various other B. pseudomallei mutants failed to protect laboratory animals. A live vaccine is favoured, as human patients suffering from melioidosis show a cell mediated immune response (lymphocyte proliferation, interleukin production, increase of CD4+ and CD8+ cells), which may be essential for survival, as IgG content is not predictive for disease outcome. Cross-protection using a live tularaemia vaccine to protect against B. pseudomallei has been suggested and needs to be investigated in the future. In order to develop a subunit vaccine, the O-polysaccharide moiety of the lipopolysaccharide was covalently linked to flagellin protein. When this was used to immunize diabetic mice a clear rate of protection was achieved. In fact, in human patients, the amount of anti-LPS II antibodies is positively correlated with survival. Passive protection has been achieved with mouse monoclonal anti-EPS, anti-LPS or anti-protein antibodies when challenged with low infection doses of virulent B. pseudomallei in mice. However, when a higher dose of 1 x 10(6) colony-forming units (cfu) was applied, none of the antibodies was protective. The anti-EPS antibody was able to significantly prolong the time until death. However, no data are available as to whether total or partial immunity may result in a higher rate of subclinical chronic infection, and regarding what might happen when the 'protected' subject becomes immunocompromised. Research in this field has to be evaluated very carefully (Sprague and Neubauer, 2004).
      2. Limit Exposure:
        • Description: Primary prevention involves education in endemic areas about minimizing exposure to wet-season soils and surface water, especially for diabetics. Footwear and gloves while gardening are recommended in northern Australia, but preventing occupation exposure in rice farmers may be unrealistic in Southeast Asia. Cystic fibrosis patients should consider avoiding travel to high-risk areas (Currie, 2005). Water hygiene is the predominant requirement in endemic areas where animals for human consumption are bred according to modern practice. The keeping of porkers without access to soil by rearing them on artificial, hard surfaces could not prevent infection. In some cases, the chlorination (2-6 mg/l) of water supplies interrupted the chain of infection effectively if the pH was kept at 6-7 prior to chlorination. If possible, infected animals should be removed from the contaminating source. Moreover, B. pseudomallei seems to profit from modern agricultural practices and animal mass production involving the habitual use of enormous amounts of water. Accordingly, strict control of sewage disposal is imperative in order to prevent the spread of B. pseudomallei. Infected carcasses of animals intended for human consumption have to be condemned and destroyed (Sprague and Neubauer, 2004). The use of gloves and disinfection of contaminated knives is recommended to prevent transmission during the processing of meat. As milk from goats and dairy cows can contain B. pseudomallei pasteurization is recommended. It is noteworthy to mention, that there seem to be no reservations against treatment of pet animals such as cats in areas where melioidosis is endemic (Sprague and Neubauer, 2004). For disinfection, the regular use of potassium hypochlorite and cresol solutions is recommended. The faeces of infected animals have to be removed several times a day. Abundant quantities of water have to be avoided or disinfected immediately. The hooves and lower legs as well as the surfaces of the stables have to be disinfected. Food and water must be given as aseptically as possible (Sprague and Neubauer, 2004).
      3. Quicklime - bactericidal inhibitor of B. pseudomallei in soil:
        • Description: Measurement of in vitro activity of quicklime (calcium oxide) against Burkholderia pseudomallei revealed that quicklime at concentrations of 10% or more was bactericidal for up to 35 d. The effect of quicklime as an inhibitor of B. pseudomallei in soil from a rice field was studied in a laboratory setting. The soil, collected from a rice field in north-eastern Thailand, was mixed with B. pseudomallei. In experiment 1, quicklime was mixed with the soil in different amounts. In experiment 2, quicklime was spread over the soil surface. In experiment 3, quicklime solution was poured onto the soil. It was found that the pH of the soil in experiment 1 was much higher than that in experiments 2 and 3. Only quicklime mixed with soil at a concentration of 40% or more (weight/weight) was effective in inhibiting the growth of B. pseudomallei for up to six weeks (Na-ngam et al., 2004).
      4. Prophylaxis:
        • Description: Laboratory-acquired infections, person-to-person spread, and zoonotic infection are all very uncommon, but secondary prophylaxis with sulfamethoxazole-trimethoprim, doxycycline, or amoxicillin-clavulanate could be considered in exceptional circumstances, especially if the exposed person is diabetic of has other risk factors for melioidosis (Currie, 2005). Sixteen workers completed a 3-week regimen of trimethoprim-sulfamethoxazole, and one completed a 3-week regimen of doxycycline. Antibiotics were begun at a median of 2 days postexposure (range: 0-4 days). None of the exposed laboratory workers had symptoms consistent with melioidosis during 5 months after exposure. Two laboratory workers had titers of less than 20 for B. pseudomallei on the first serum drawn. Both workers were born in the United States, and neither demonstrated an increase in titer 6 weeks after exposure. The first (no. 17) reported sniffing a B. pseudomallei culture plate. The worker recalled previous travel to Hawaii, Europe, Mexico, and Jamaica but reported no previous illnesses consistent with melioidosis. The second worker (no. 1) reported low-risk activities. The worker reported previous travel to the Philippines and Singapore and was hospitalized in 2001 for pneumonia with pleural effusions requiring thoracenteses; no pathogen was identified (CDC Report, 2004).

    5. Model System:
      1. Murine Model:
        1. Model Host: Mus musculus.
        2. Description: In the BALB/c and C57BL/6 inbred mouse models, BALB/c mice are susceptible, whereas C57BL/6 are relatively more resistant via intravenous and intranasal routes of infection. BALB/c mice died of septicemic disease with overwhelming bacterial loads in organs and blood, accompanied by organ inflammation and necrosis a few days after infection, reflecting a failure of the host innate immune response to contain the infection (Gan, 2005). A whole-body mouse model of pneumonic melioidosis was established for future evaluation of biodefense vaccine candidates. The aerosol 50% lethal doses of Burkholderia pseudomallei strain 1026b for BALB/c and C57BL/6 mice and the times to death, dissemination in organs, and tissue loads after exposure of the mice to low- and high-dose aerosols are reported (Jeddeloh et al., 2003).
      2. Syrian Hamsters:
        1. Model Host: Mesocricetus auratus
        2. Description: Hamsters are exquisitely sensitive to B. pseudomallei infection. The 50% lethal dose (LD[50]) of B. pseudomallei in hamster is approximately 10 bacteria. The LD(50) is independent of the route of infection as similar values are obtained with intraperitoneal (i.p.), subcutaneous and respiratory infections. In addition, hamsters do not display individual variation in susceptibility to B. pseudomallei. The infection of hamsters with B. pseudomallei typically results in acute septicemic melioidosis and death within 2-3 days. In 1984 Miller et al. described the use of hamsters in the experimental chemotherapy of melioidosis. This animal model of melioidosis has also been used to assess the relative virulence of B. pseudomallei clinical isolates and isogenic mutants (Cheng and Currie, 2005).
      3. Rats:
        1. Model Host: Rattus norvegicus
        2. Description: Rats are relatively resistant to B. pseudomallei infection. The LD(50) of B. pseudomallei in infant rats can be lowered significantly by i.p. injection of the diabetogenic compound streptozotocin (STZ) (De Shazer and Woods, 1999). The infection of infant diabetic rats with B. pseudomallei typically results in acute septicemic melioidosis and death, usually within 7 days. This animal model of melioidosis has been used in passive immunoprophylaxis studies and has been useful in assessing the relative virulence of B. pseudomallei isogenic mutants (De Shazer and Woods, 1999). Diabetic rats and Syrian hamsters have been shown to be exquisitely susceptible to infection, which results in acute disease and rapid death (Gan, 2005).
      4. Amoebae-Model for Intracellular survival:
        1. Model Host: Acanthamoeba astronyxis
        2. Description: In common with other intracellular bacterial pathogens such as Legionella pneumophila and Listeria monocytogenes, B. pseudomallei has been shown to enter and survive within free-living amoebae belonging to the genus Acanthamoeba (Inglis et al., 2003). The B. pseudomallei-A. astronyxis system provides a useful model with which to explore the cellular pathogenesis of melioidosis (Inglis et al., 2003).
  2. Mammalia:
    1. Taxonomy Information:
      1. Species:
        1. African green monkey :
          • GenBank Taxonomy No.: 9534
          • Scientific Name: Cercopithecus aethiops (NCBI Taxonomy)
          • Description: Le bacille de Whitmore, agent de la melioidose, a ete isole de quelques animaux sauvages de la Menagerie du Jardin des Plantes au Museum National d'Historie Naturelle de Paris. (Translation: Whitmore's bacillus, the agent of the melioidosis, was isolated from some of the wild animals in the Menagerie du Jardin des Plantes au Museum National d'Historie Naturelle in Paris.) (Nouvel et al., 1976) Sur 34 animaux ainsi examines, nous avons obtenu 19 resultats positives: 2 concernant les chevaux de Przewalski (Equus przewalskii);1 buffle de l'Inde (Bubalus bubalis) nouveau-ne; 4 ovins (Ovis canadensis, Ovis vignei, Ovis musimon); 2 antilopes (Oryx beisa), nouveau-ne et (Redunca redunca) mort-ne; 6 cervides (Sika nippon, Muntiacus muntjac); 2 singes (Erythrocebus patas, Cercopithecus aethiops sabaeus); 1 goose (Cereopsis novae hollandiae); 1 tatou (Dasypus sexcinctus). (Translation: Of the 34 animals examined, we obtained positive results from: 2 Prezwalski horses (Equus przewalskii); 1 newborn Indian buffalo (Bubalus bubalis); 4 sheep (Ovis canadensis, Ovis vignei, Ovis musimon); 2 newborn antelopes (Oryz beisa), and one stillborn (Redunca redunca); 6 deer (Sika nippon, Muntiacus muntjac); 2 monkeys (Erythrocebus patas, Cercopithecus aethiops sabaeus); 1 goose (Cereopsis novae hollandiae); 1 armadillo (Dasypus sexcinctus) (Nouvel et al., 1976).
        2. Chimpanzee :
          • GenBank Taxonomy No.: 9598
          • Scientific Name: Pan troglodytes (NCBI Taxonomy)
          • Description: Melioidosis was diagnosed in a chimpanzee (Pan troglodytes). The clinical history was one of gradual general degeneration of health, multiple abscesses, and pulmonary radiographic densities. The pathologic changes in the lungs, liver, and bone were similar to those reported for man. Pseudomonas pseudomallei was identified by bacteriologic culture of liver, lung, kidney and spleen. Positive serologic test results were obtained by the hemagglutination and the complement-fixation tests. The source of infection for the chimpanzee was not definitely known (Butler et al., 1971).
        3. Crab-eating macaque :
          • GenBank Taxonomy No.: 9541
          • Scientific Name: Macaca fascicularis (NCBI Taxonomy)
          • Description: An outbreak of melioidosis, a bacterial infection caused by Pseudomonas pseudomallei, was identified in a batch of feral cynomolgus monkeys (Macaca fascicularis) imported to Britain from the Philippines. Thirteen confirmed or possible cases occurred among a batch of 50 animals. Subsequent investigations revealed that the infection was uncommon among imported primates from a variety of sources, although three other cases were identified in monkeys imported from Indonesia. The majority of the affected monkeys had splenic abscesses, and hepatic abscesses and infections of the soft tissues and skin were also frequently observed. Most of the infected animals had no clinical signs despite extensive abscesses, and the presence of infection was only suspected when they were shown to have serum antibodies to P. pseudomallei by an enzyme-linked immunosorbent assay. Although there was no evidence of cross infection of other animals or human handlers, this outbreak is a reminder of the dangers of working with wild-caught primates and the potential for the establishment of environmental foci of melioidosis (Dance et al., 1992).
        4. Common gibbon :
          • GenBank Taxonomy No.: 9580
          • Scientific Name: Hylobates lar (NCBI Taxonomy)
          • Description: The first case of melioidosis was isolated in Perak from a Serow, Capricornis sumatrensis; followed by the Johore Zoo in 1963 and Zoo Negara Malaysia in 1965 from the pig-tailed macaque, Macaca nemestrina; and in 1968 from a spider monkey, Brachytelis arachnoides and a lar gibbon, Hylobates lar in the Johore Zoo (Vellayan, 1994).
        5. Gorilla :
          • GenBank Taxonomy No.: 9593
          • Scientific Name: Gorilla gorilla (NCBI Taxonomy)
          • Description: The situation involved four gorillas, originally from Europe where they had been housed in a concrete environment for most of their lives before they were sent to the Singapore Zoological Gardens. They died of melioidosis within months of living in an 'open' enclosure where they were unwittingly exposed to soil and water (in the surrounding moat) containing P. pseudomallei. Isolates from the gorillas were all of the restriction endonuclease analysis (REA) II group, similar to the isolates recovered from the water of the moat, implying that the animals acquired the infection from organisms in the water (Yap et al., 1995).
        6. Macaques :
        7. Mandrill :
          • GenBank Taxonomy No.: 9561
          • Scientific Name: Mandrillus sphinx (NCBI Taxonomy)
          • Description: To date, only two serotypes, I and II, of P. pseudomallei have been described. Recently, two groups of workers reported using ribotyping which was capable of discriminating up to 22 strains of P. pseudomallei. The present study confirms that these organisms may be divided into at least 12 RE types, with most of them clustered into 5 larger groups, namely RE I to V (Yap et al., 1995). Isolates from other animals who died in the same zoo, namely gibbon, kangaroo, mandrill, and chimpanzee, were of the RE II group (Yap et al., 1995).
        8. Mitred leaf monkey :
          • GenBank Taxonomy No.: 78451
          • Scientific Name: Presbytis melalophos (NCBI Taxonomy)
          • Description: Kaufmann and others reported five cases of melioidosis in three separate outbreaks in imported non-human primates in the United States. This report describes a case of melioidosis in a banded leaf monkey (Presbytis melalophos). The animal was an adult female weighting 4-5 kg caught in the wild (Mutalib et al., 1984) The source of the infection for the animal is unknown. Ps. pseudomallei has been isolated from the soil and water in Malaysia. Drinking water and that used for washing the cages and floors is chlorinated tap water. There is a possibility that the animal contacted the organism in the wild or at the trapper's premises but showed clinical effects during captivity at the primate unit. Another possibility is that the organism was brought into the unit through the vegetable or sweet potatoes that were purchased at the local market (Mutalib et al., 1984).
        9. Orangutan :
          • GenBank Taxonomy No.: 9600
          • Scientific Name: Pongo pygmaeus (NCBI Taxonomy)
          • Description: Two young orangutan (Pongo pygmaeus), a male and female, approximately 18 months old, simultaneously developed signs of mild upper respiratory disease including nasal discharge and sneezing (Smith and Damit, 1982). Microscopic examination showed the isolate to consist of short Gram-negative rods with a bipolar staining reaction (Smith and Damit, 1982). Biochemical tests showed that the organism had Pseudomonas pseudomallei characteristics (Smith and Damit, 1982). In conclusion, it seems likely that there was a latent or early Pseudomonas pseudomallei infection which was triggered off by a mild infection of the upper respiratory tract, probably of human origin. This produced an acute, fulminating, fatal bronchopneumonia. This case emphasizes the susceptibility of orangutan to human respiratory disease and the public health dangers of keeping primates in captivity without suitable precautions (Smith and Damit, 1982).
        10. Pig-tailed macaque :
          • GenBank Taxonomy No.: 9545
          • Scientific Name: Macaca nemestrina (NCBI Taxonomy)
          • Description: A case of melioidosis in a macaque (Macaca nemestrina) at the National Zoo, Kuala Lumpur, Malaysia, was diagnosed in September, 1965. Serologic evidence of infection was obtained 80 days prior to onset of clinical disease, and a source of exposure to Pseudomonas pseudomallei was found. The principal manifestation of the infection was lumbar vertebral osteomyelitis, with the formation of a paravertebral abscess that exteriorized in the right flank. The abscess regressed, and osteomyelitis healed without specific therapy. The animal recovered completely in 6 months and remains in excellent health 3 years later. The portal of entry of P. pseudomallei was thought to be through multiple lacerations sustained in fights with other macaques (Strauss et al., 1969).
        11. Red guenon :
          • GenBank Taxonomy No.: 9538
          • Scientific Name: Erythrocebus patas (NCBI Taxonomy)
          • Description: Le bacille de Whitmore, agent de la melioidose, a ete isole de quelques animaux sauvages de la Menagerie du Jardin des Plantes au Museum National d'Historie Naturelle de Paris. (Translation: Whitmore's bacillus, the agent of the melioidosis, was isolated from some of the wild animals in the Menagerie du Jardin des Plantes au Museum National d'Historie Naturelle in Paris.) (Nouvel et al., 1976) Sur 34 animaux ainsi examines, nous avons obtenu 19 resultats positives: 2 concernant les chevaux de Przewalski (Equus przewalskii);1 buffle de l'Inde (Bubalus bubalis) nouveau-ne; 4 ovins (Ovis canadensis, Ovis vignei, Ovis musimon); 2 antilopes (Oryx beisa), nouveau-ne et (Redunca redunca) mort-ne; 6 cervides (Sika nippon, Muntiacus muntjac); 2 singes (Erythrocebus patas, Cercopithecus aethiops sabaeus); 1 goose (Cereopsis novae hollandiae); 1 tatou (Dasypus sexcinctus). (Translation: Of the 34 animals examined, we obtained positive results from: 2 Prezwalski horses (Equus przewalskii); 1 newborn Indian buffalo (Bubalus bubalis); 4 sheep (Ovis canadensis, Ovis vignei, Ovis musimon); 2 newborn antelopes (Oryz beisa), and one stillborn (Redunca redunca); 6 deer (Sika nippon, Muntiacus muntjac); 2 monkeys (Erythrocebus patas, Cercopithecus aethiops sabaeus); 1 goose (Cereopsis novae hollandiae); 1 armadillo (Dasypus sexcinctus) (Nouvel et al., 1976).
        12. Rhesus monkey :
          • GenBank Taxonomy No.: 9544
          • Scientific Name: Macaca mulatta (NCBI Taxonomy)
          • Description: An aged wild-caught male rhesus monkey (Macaca mulatta), maintained in a research facility for 10 years, developed bilateral pelvic limb paralysis without other signs of disease. Unresponsive to therapy, the monkey was killed and necropsied. Chronic inflammation with osteolysis of thoracic vertebrae 10-13 was observed. Pseudomonas pseudomallei was cultured and identified from cerebrospinal fluid obtained at the site of the thoracic lesion (Fritz et al., 1986). In 1969, five cases of melioidosis in three separate outbreaks were diagnosed in nonhuman primates in the United States. In the first outbreak, two stump-tailed macaque monkeys (Macaca arctoides) developed signs of the disease approximately 6 months after purchase. A third animal, a chimpanzee (Pan troglodytes), probably acquired its infection from one of these monkeys. Two other unrelated cases involving a pig-tailed monkey (Macaca nemestrina) and a rhesus monkey (Macaca mulatta) were diagnosed. These monkeys had been imported 3 years and 6 months, respectively, prior to the recognized onset of their disease. These cases represent the first known occurrences of spontaneous melioidosis in nonhuman primates in the United States (Kaufmann et al., 1970).
        13. Stump-tailed macaque :
          • GenBank Taxonomy No.: 9540
          • Scientific Name: Macaca arctoides (NCBI Taxonomy)
          • Description: In 1969, five cases of melioidosis in three separate outbreaks were diagnosed in nonhuman primates in the United States. In the first outbreak, two stump-tailed macaque monkeys (Macaca arctoides) developed signs of the disease approximately 6 months after purchase. A third animal, a chimpanzee (Pan troglodytes), probably acquired its infection from one of these monkeys. Two other unrelated cases involving a pig-tailed monkey (Macaca nemestrina) and a rhesus monkey (Macaca mulatta) were diagnosed. These monkeys had been imported 3 years and 6 months, respectively, prior to the recognized onset of their disease. These cases represent the first known occurrences of spontaneous melioidosis in nonhuman primates in the United States (Kaufmann et al., 1970).
        14. Woolly spider monkey :
          • GenBank Taxonomy No.: 30594
          • Scientific Name: Brachyteles arachnoides (NCBI Taxonomy)
          • Description: The first case of melioidosis was isolated in Perak from a Serow, Capricornis sumatrensis; followed by the Johore Zoo in 1963 and Zoo Negara Malaysia in 1965 from the pig-tailed macaque, Macaca nemestrina; and in 1968 from a spider monkey, Brachytelis arachnoides and a lar gibbon, Hylobates lar in the Johore Zoo (Vellayan, 1994).
        15. Alpaca :
          • GenBank Taxonomy No.: 30538
          • Scientific Name: Lama pacos (NCBI Taxonomy)
          • Description: The body of a 7-month-old male alpaca (Lama pacos) was presented to Berrimah Veterinary Laboratories, Darwin, for necropsy examination. Around 1 month earlier the alpaca was flown to Darwin from Strathalbyn, South Australia and placed on a dairy goat farm in the rural Darwin region. Four years previously a male goat kid on the farm had confirmed melioidosis (Janmaat et al., 2004). Burkholderia pseudomallei was the only pathogen cultured from abscesses (Janmaat et al., 2004). This is the first alpaca to be brought to the Darwin region and to our knowledge the first report of melioidosis in an alpaca (Janmaat et al., 2004).
        16. Arabian camel, Dromedary :
          • GenBank Taxonomy No.: 9838
          • Scientific Name: Camelus dromedarius (NCBI Taxonomy)
          • Description: In January 1990, we isolated Pseudomonas pseudomallei from a camel at Mingela, northern Queensland, which had a severe purulent bronchopneumonia (Forbes-Faulkner et al., 1992). In May 1990, 4 of 5 camels held near Cooktown were affected with a hacking cough, which was accompanied after a few days by a purulent nasal discharge and respiratory insufficiency. Three of the affected animals died and one recovered slowly. In August of the same year, 3 camels out of a herd of 8 near Rockhampton died after similar signs. In both outbreaks, the major finding at necropsy was extensive necrotic pneumonia, with scattered foci of necrosis in liver and spleen in one case. Pseudomonas pseudomallei was isolated from the affected lungs in both outbreaks (Bergin and Torenbeeck, 1991). In camels, the disease tends to run a chronic course and the lung appears to be the preferred site for B. pseudomallei. Camels are usually affected with a hacking cough which is later accompanied by purulent discharge from the nose and respiratory insufficiency. Ataxia of the hind limbs, dehydration, pyrexia and listlessness have also been observed in one case. Prior to its death, the camel showed signs of wasting disease and was severely emaciated. Melioidosis was diagnosed post-mortem (Sprague and Neubauer, 2004).
        17. Bighorn sheep :
          • GenBank Taxonomy No.: 37174
          • Scientific Name: Ovis canadensis (NCBI Taxonomy)
          • Description: Le bacille de Whitmore, agent de la melioidose, a ete isole de quelques animaux sauvages de la Menagerie du Jardin des Plantes au Museum National d'Historie Naturelle de Paris. (Translation: Whitmore's bacillus, the agent of the melioidosis, was isolated from some of the wild animals in the Menagerie du Jardin des Plantes au Museum National d'Historie Naturelle in Paris.) (Nouvel et al., 1976) Sur 34 animaux ainsi examines, nous avons obtenu 19 resultats positives: 2 concernant les chevaux de Przewalski (Equus przewalskii);1 buffle de l'Inde (Bubalus bubalis) nouveau-ne; 4 ovins (Ovis canadensis, Ovis vignei, Ovis musimon); 2 antilopes (Oryx beisa), nouveau-ne et (Redunca redunca) mort-ne; 6 cervides (Sika nippon, Muntiacus muntjac); 2 singes (Erythrocebus patas, Cercopithecus aethiops sabaeus); 1 goose (Cereopsis novae hollandiae); 1 tatou (Dasypus sexcinctus). (Translation: Of the 34 animals examined, we obtained positive results from: 2 Prezwalski horses (Equus przewalskii); 1 newborn Indian buffalo (Bubalus bubalis); 4 sheep (Ovis canadensis, Ovis vignei, Ovis musimon); 2 newborn antelopes (Oryz beisa), and one stillborn (Redunca redunca); 6 deer (Sika nippon, Muntiacus muntjac); 2 monkeys (Erythrocebus patas, Cercopithecus aethiops sabaeus); 1 goose (Cereopsis novae hollandiae); 1 armadillo (Dasypus sexcinctus) (Nouvel et al., 1976).
        18. Bohar reedbuck :
          • GenBank Taxonomy No.: 59556
          • Scientific Name: Redunca redunca (NCBI Taxonomy)
          • Description: Le bacille de Whitmore, agent de la melioidose, a ete isole de quelques animaux sauvages de la Menagerie du Jardin des Plantes au Museum National d'Historie Naturelle de Paris. (Translation: Whitmore's bacillus, the agent of the melioidosis, was isolated from some of the wild animals in the Menagerie du Jardin des Plantes au Museum National d'Historie Naturelle in Paris.) (Nouvel et al., 1976) Sur 34 animaux ainsi examines, nous avons obtenu 19 resultats positives: 2 concernant les chevaux de Przewalski (Equus przewalskii);1 buffle de l'Inde (Bubalus bubalis) nouveau-ne; 4 ovins (Ovis canadensis, Ovis vignei, Ovis musimon); 2 antilopes (Oryx beisa), nouveau-ne et (Redunca redunca) mort-ne; 6 cervides (Sika nippon, Muntiacus muntjac); 2 singes (Erythrocebus patas, Cercopithecus aethiops sabaeus); 1 goose (Cereopsis novae hollandiae); 1 tatou (Dasypus sexcinctus). (Translation: Of the 34 animals examined, we obtained positive results from: 2 Prezwalski horses (Equus przewalskii); 1 newborn Indian buffalo (Bubalus bubalis); 4 sheep (Ovis canadensis, Ovis vignei, Ovis musimon); 2 newborn antelopes (Oryz beisa), and one stillborn (Redunca redunca); 6 deer (Sika nippon, Muntiacus muntjac); 2 monkeys (Erythrocebus patas, Cercopithecus aethiops sabaeus); 1 goose (Cereopsis novae hollandiae); 1 armadillo (Dasypus sexcinctus) (Nouvel et al., 1976).
        19. Capricornis sumatrensis :
          • GenBank Taxonomy No.: 34865
          • Scientific Name: Capricornis sumatrensis (NCBI Taxonomy)
          • Description: The first case of melioidosis was isolated in Perak from a Serow, Capricornis sumatrensis; followed by the Johore Zoo in 1963 and Zoo Negara Malaysia in 1965 from the pig-tailed macaque, Macaca nemestrina; and in 1968 from a spider monkey, Brachytelis arachnoides and a lar gibbon, Hylobates lar in the Johore Zoo (Vellayan, 1994).
        20. Cattle :
          • GenBank Taxonomy No.: 9913
          • Scientific Name: Bos taurus (NCBI Taxonomy)
          • Description: Melioidosis has occurred in dogs, cats and cattle but these animals are considered to be fairly resistant to disease. Disease in these species is often associated with an underlying immunosuppressive condition (Choy et al., 2000). Bovine melioidosis is very rare and tends to run a chronic course in adult animals. It concluded that susceptibility to B. pseudomallei in cattle is low but abscess formation may occur from infection. The clinical signs observed in one case were fever, aggressive behaviour, rapid, panting respiration, continuous profuse salivation and staggering gait. The second case developed an acute arthritis after a deep cut developed into a chronic granulating sinus. One case of acute melioidosis in a calf has been described. Some authors postulated that cattle and water buffalo may be immune to B. pseudomallei (Sprague and Neubauer, 2004).
        21. Fallow deer :
          • GenBank Taxonomy No.: 30532
          • Scientific Name: Dama dama (NCBI Taxonomy)
          • Description: In 1988, 121 fallow deer were imported into Malaysia from New Zealand. the first death was detected as early as five days after arrival. By the eighth week, about 64% of the animals had died. In most cases there were no clinical signs except for the occasional sick animal that lagged behind the herd and two recumbent animals. Respiratory distress, limping or palpable nodules were absent (Babjee and Nor Aidah, 1994).
        22. Goat :
          • GenBank Taxonomy No.: 9925
          • Scientific Name: Capra hircus (NCBI Taxonomy)
          • Description: Melioidosis affects a wide range of animal species. In Australia the most commonly affected livestock are goats, sheep and pigs. Melioidosis has been a significant cause of death in goats and sheep, which appear to be particularly susceptible to the disease (Choy et al., 2000). The diagnosis of naturally occurring melioidosis in goats is usually made from a combination of clinical signs, skin sensitivity, and seroagglutination methods, and is confirmed by the post-mortem examination of suspected goats. The causative organism of melioidosis (Malleomyces pseudomallei) is frequently recovered on selective culture media, or after intraperitoneal inoculation into guinea pigs (Straus reaction in male) (Ileri, 1965). Both acute and chronic forms are observed in sheep and goats, the chronic form being more common (Sprague and Neubauer, 2004).
        23. Horses :
          • GenBank Taxonomy No.: 9796
          • Scientific Name: Equus caballus (NCBI Taxonomy)
          • Description: Other susceptible species reported with melioidosis in Australia include camels, horses, deer, and laboratory animals (Choy et al., 2000) Central nervous system (CNS) disease with melioidosis has occurred in a number of animal species in Australia. It has been reported in cows, goats and a horse in northern Queensland (Choy et al., 2000).
        24. Mouflon :
          • GenBank Taxonomy No.: 9938
          • Scientific Name: Ovis aries musimon (NCBI Taxonomy)
          • Description: Le bacille de Whitmore, agent de la melioidose, a ete isole de quelques animaux sauvages de la Menagerie du Jardin des Plantes au Museum National d'Historie Naturelle de Paris. (Translation: Whitmore's bacillus, the agent of the melioidosis, was isolated from some of the wild animals in the Menagerie du Jardin des Plantes au Museum National d'Historie Naturelle in Paris.) (Nouvel et al., 1976) Sur 34 animaux ainsi examines, nous avons obtenu 19 resultats positives: 2 concernant les chevaux de Przewalski (Equus przewalskii);1 buffle de l'Inde (Bubalus bubalis) nouveau-ne; 4 ovins (Ovis canadensis, Ovis vignei, Ovis musimon); 2 antilopes (Oryx beisa), nouveau-ne et (Redunca redunca) mort-ne; 6 cervides (Sika nippon, Muntiacus muntjac); 2 singes (Erythrocebus patas, Cercopithecus aethiops sabaeus); 1 goose (Cereopsis novae hollandiae); 1 tatou (Dasypus sexcinctus). (Translation: Of the 34 animals examined, we obtained positive results from: 2 Prezwalski horses (Equus przewalskii); 1 newborn Indian buffalo (Bubalus bubalis); 4 sheep (Ovis canadensis, Ovis vignei, Ovis musimon); 2 newborn antelopes (Oryz beisa), and one stillborn (Redunca redunca); 6 deer (Sika nippon, Muntiacus muntjac); 2 monkeys (Erythrocebus patas, Cercopithecus aethiops sabaeus); 1 goose (Cereopsis novae hollandiae); 1 armadillo (Dasypus sexcinctus) (Nouvel et al., 1976).
        25. Muntjak :
          • GenBank Taxonomy No.: 9888
          • Scientific Name: Muntiacus muntjak (NCBI Taxonomy)
          • Description: Le bacille de Whitmore, agent de la melioidose, a ete isole de quelques animaux sauvages de la Menagerie du Jardin des Plantes au Museum National d'Historie Naturelle de Paris. (Translation: Whitmore's bacillus, the agent of the melioidosis, was isolated from some of the wild animals in the Menagerie du Jardin des Plantes au Museum National d'Historie Naturelle in Paris.) (Nouvel et al., 1976) Sur 34 animaux ainsi examines, nous avons obtenu 19 resultats positives: 2 concernant les chevaux de Przewalski (Equus przewalskii);1 buffle de l'Inde (Bubalus bubalis) nouveau-ne; 4 ovins (Ovis canadensis, Ovis vignei, Ovis musimon); 2 antilopes (Oryx beisa), nouveau-ne et (Redunca redunca) mort-ne; 6 cervides (Sika nippon, Muntiacus muntjac); 2 singes (Erythrocebus patas, Cercopithecus aethiops sabaeus); 1 goose (Cereopsis novae hollandiae); 1 tatou (Dasypus sexcinctus). (Translation: Of the 34 animals examined, we obtained positive results from: 2 Prezwalski horses (Equus przewalskii); 1 newborn Indian buffalo (Bubalus bubalis); 4 sheep (Ovis canadensis, Ovis vignei, Ovis musimon); 2 newborn antelopes (Oryz beisa), and one stillborn (Redunca redunca); 6 deer (Sika nippon, Muntiacus muntjac); 2 monkeys (Erythrocebus patas, Cercopithecus aethiops sabaeus); 1 goose (Cereopsis novae hollandiae); 1 armadillo (Dasypus sexcinctus) (Nouvel et al., 1976).
        26. Oryx beisa :
          • GenBank Taxonomy No.:
          • Scientific Name: Oryx beisa (Nouvel et al., 1976)
          • Description: Le bacille de Whitmore, agent de la melioidose, a ete isole de quelques animaux sauvages de la Menagerie du Jardin des Plantes au Museum National d'Historie Naturelle de Paris. (Translation: Whitmore's bacillus, the agent of the melioidosis, was isolated from some of the wild animals in the Menagerie du Jardin des Plantes au Museum National d'Historie Naturelle in Paris.) (Nouvel et al., 1976) Sur 34 animaux ainsi examines, nous avons obtenu 19 resultats positives: 2 concernant les chevaux de Przewalski (Equus przewalskii);1 buffle de l'Inde (Bubalus bubalis) nouveau-ne; 4 ovins (Ovis canadensis, Ovis vignei, Ovis musimon); 2 antilopes (Oryx beisa), nouveau-ne et (Redunca redunca) mort-ne; 6 cervides (Sika nippon, Muntiacus muntjac); 2 singes (Erythrocebus patas, Cercopithecus aethiops sabaeus); 1 goose (Cereopsis novae hollandiae); 1 tatou (Dasypus sexcinctus). (Translation: Of the 34 animals examined, we obtained positive results from: 2 Prezwalski horses (Equus przewalskii); 1 newborn Indian buffalo (Bubalus bubalis); 4 sheep (Ovis canadensis, Ovis vignei, Ovis musimon); 2 newborn antelopes (Oryz beisa), and one stillborn (Redunca redunca); 6 deer (Sika nippon, Muntiacus muntjac); 2 monkeys (Erythrocebus patas, Cercopithecus aethiops sabaeus); 1 goose (Cereopsis novae hollandiae); 1 armadillo (Dasypus sexcinctus) (Nouvel et al., 1976).
        27. Pig :
          • GenBank Taxonomy No.: 9823
          • Scientific Name: Sus scrofa (NCBI Taxonomy)
          • Description: Melioidosis affects a wide range of animal species. In Australia the most commonly affected livestock are goats, sheep and pigs (Choy et al., 2000). All recent cases of melioidosis in pigs in the Northern Territory (NT) have been reported as asymptomatic abscesses, often as a cause for carcass condemnation at the abattoir (Choy et al., 2000). The pig is considered to have a high natural resistance to B. pseudomallei. Cases have been reported from Vietnam, Malaysia and Australia. The appearance of lesions is believed to be postponed by the route of infection, as inhalation of aerosols will produce abscess formation in the bronchial region, and ingestion will affect the mandibular lymph nodes. Rarely seen clinical signs include fever, anorexia with progressive emaciation, discharge from nose and eyes, coughing, dyspnoea, uncoordinated gait and diarrhoea. In adult animals the disease tends to run a more chronic course with few clinical signs, whereas in young pigs the disease tends to be acute (Sprague and Neubauer, 2004).
        28. Plain's zebra, Mountain zebra, or Burchell's zebra :
          • GenBank Taxonomy No.: 9790 9791
          • Scientific Name: Equus burchellii or Equus zebra (NCBI Taxonomy)
          • Description: Das Malaysische Zentralinstitut in Ipoh isolierte 1981 Pseudomonas pseudomallei aus einem Rind, einer Ziege, einem Kamel und zwei Zebras aus einem Safaripark und aus drei Ziegen, einem Schaf, funf Kaninchen, einem Pferd und zwei Meerschweinchen aus dem Einzugsgebiet. (Translation: The Malaysian Central Institute in Ipoh isolated Pseudomonas pseudomallei in 1981 from a cow, a goat, a camel and two zebras at a Safari park (von Kruedener et al., 1984).
        29. Przewalski's horse :
          • GenBank Taxonomy No.: 9798
          • Scientific Name: Equus przewalskii (NCBI Taxonomy)
          • Description: Le bacille de Whitmore, agent de la melioidose, a ete isole de quelques animaux sauvages de la Menagerie du Jardin des Plantes au Museum National d'Historie Naturelle de Paris. (Translation: Whitmore's bacillus, the agent of the melioidosis, was isolated from some of the wild animals in the Menagerie du Jardin des Plantes au Museum National d'Historie Naturelle in Paris.) (Nouvel et al., 1976) Sur 34 animaux ainsi examines, nous avons obtenu 19 resultats positives: 2 concernant les chevaux de Przewalski (Equus przewalskii);1 buffle de l'Inde (Bubalus bubalis) nouveau-ne; 4 ovins (Ovis canadensis, Ovis vignei, Ovis musimon); 2 antilopes (Oryx beisa), nouveau-ne et (Redunca redunca) mort-ne; 6 cervides (Sika nippon, Muntiacus muntjac); 2 singes (Erythrocebus patas, Cercopithecus aethiops sabaeus); 1 goose (Cereopsis novae hollandiae); 1 tatou (Dasypus sexcinctus). (Translation: Of the 34 animals examined, we obtained positive results from: 2 Prezwalski horses (Equus przewalskii); 1 newborn Indian buffalo (Bubalus bubalis); 4 sheep (Ovis canadensis, Ovis vignei, Ovis musimon); 2 newborn antelopes (Oryz beisa), and one stillborn (Redunca redunca); 6 deer (Sika nippon, Muntiacus muntjac); 2 monkeys (Erythrocebus patas, Cercopithecus aethiops sabaeus); 1 goose (Cereopsis novae hollandiae); 1 armadillo (Dasypus sexcinctus) (Nouvel et al., 1976).
        30. Sheep :
          • GenBank Taxonomy No.: 9940
          • Scientific Name: Ovis aries (NCBI Taxonomy)
          • Description: Melioidosis affects a wide range of animal species. In Australia the most commonly affected livestock are goats, sheep and pigs. Melioidosis has been a significant cause of death in goats and sheep, which appear to be particularly susceptible to the disease (Choy et al., 2000). Both acute and chronic forms are observed in sheep and goats, the chronic form being more common (Sprague and Neubauer, 2004). Naturally and experimentally infected sheep can show evidence of central nervous system (CNS) involvement, including lameness, walking in circles, nystagmus, blindness, hyperaesthesia and mild tetanic convulsions. Pneumonia with respiratory distress can be present. In rams, orchitis with testicular nodules can be seen (Sprague and Neubauer, 2004).
        31. Sika deer :
          • GenBank Taxonomy No.: 9863
          • Scientific Name: Cervus nippon (NCBI Taxonomy)
          • Description: Le bacille de Whitmore, agent de la melioidose, a ete isole de quelques animaux sauvages de la Menagerie du Jardin des Plantes au Museum National d'Historie Naturelle de Paris. (Translation: Whitmore's bacillus, the agent of the melioidosis, was isolated from some of the wild animals in the Menagerie du Jardin des Plantes au Museum National d'Historie Naturelle in Paris.) (Nouvel et al., 1976) Sur 34 animaux ainsi examines, nous avons obtenu 19 resultats positives: 2 concernant les chevaux de Przewalski (Equus przewalskii);1 buffle de l'Inde (Bubalus bubalis) nouveau-ne; 4 ovins (Ovis canadensis, Ovis vignei, Ovis musimon); 2 antilopes (Oryx beisa), nouveau-ne et (Redunca redunca) mort-ne; 6 cervides (Sika nippon, Muntiacus muntjac); 2 singes (Erythrocebus patas, Cercopithecus aethiops sabaeus); 1 goose (Cereopsis novae hollandiae); 1 tatou (Dasypus sexcinctus). (Translation: Of the 34 animals examined, we obtained positive results from: 2 Prezwalski horses (Equus przewalskii); 1 newborn Indian buffalo (Bubalus bubalis); 4 sheep (Ovis canadensis, Ovis vignei, Ovis musimon); 2 newborn antelopes (Oryz beisa), and one stillborn (Redunca redunca); 6 deer (Sika nippon, Muntiacus muntjac); 2 monkeys (Erythrocebus patas, Cercopithecus aethiops sabaeus); 1 goose (Cereopsis novae hollandiae); 1 armadillo (Dasypus sexcinctus) (Nouvel et al., 1976).
        32. Sika deer :
          • GenBank Taxonomy No.: 92867
          • Scientific Name: Cervus nippon nippon (NCBI Taxonomy)
          • Description: This paper describes a case of melioidosis in an adult Sika deer (Cervus nippon nippon) and its calf. A 4-year-old Sika deer and its 8-month-old female calf died after showing anorexia for a week (Sheikh-Omar and Muda, 1986). Direct smears of the nodules and the exudate from the bronchi revealed numerous short Gram-negative rods. Organisms resembling P. pseudomallei were isolated in pure cultures on blood agar and MacConkey agar from replicate specimens. These organisms were later confirmed to be P. pseudomallei by standard cultural and biochemical tests (Sheikh-Omar and Muda, 1986).
        33. Urial :
          • GenBank Taxonomy No.: 59896
          • Scientific Name: Ovis vignei (NCBI Taxonomy)
          • Description: Le bacille de Whitmore, agent de la melioidose, a ete isole de quelques animaux sauvages de la Menagerie du Jardin des Plantes au Museum National d'Historie Naturelle de Paris. (Translation: Whitmore's bacillus, the agent of the melioidosis, was isolated from some of the wild animals in the Menagerie du Jardin des Plantes au Museum National d'Historie Naturelle in Paris.) (Nouvel et al., 1976) Sur 34 animaux ainsi examines, nous avons obtenu 19 resultats positives: 2 concernant les chevaux de Przewalski (Equus przewalskii);1 buffle de l'Inde (Bubalus bubalis) nouveau-ne; 4 ovins (Ovis canadensis, Ovis vignei, Ovis musimon); 2 antilopes (Oryx beisa), nouveau-ne et (Redunca redunca) mort-ne; 6 cervides (Sika nippon, Muntiacus muntjac); 2 singes (Erythrocebus patas, Cercopithecus aethiops sabaeus); 1 goose (Cereopsis novae hollandiae); 1 tatou (Dasypus sexcinctus). (Translation: Of the 34 animals examined, we obtained positive results from: 2 Prezwalski horses (Equus przewalskii); 1 newborn Indian buffalo (Bubalus bubalis); 4 sheep (Ovis canadensis, Ovis vignei, Ovis musimon); 2 newborn antelopes (Oryz beisa), and one stillborn (Redunca redunca); 6 deer (Sika nippon, Muntiacus muntjac); 2 monkeys (Erythrocebus patas, Cercopithecus aethiops sabaeus); 1 goose (Cereopsis novae hollandiae); 1 armadillo (Dasypus sexcinctus) (Nouvel et al., 1976).
        34. Water buffalo :
          • GenBank Taxonomy No.: 89462
          • Scientific Name: Bubalus bubalis (NCBI Taxonomy)
          • Description: Le bacille de Whitmore, agent de la melioidose, a ete isole de quelques animaux sauvages de la Menagerie du Jardin des Plantes au Museum National d'Historie Naturelle de Paris. (Translation: Whitmore's bacillus, the agent of the melioidosis, was isolated from some of the wild animals in the Menagerie du Jardin des Plantes au Museum National d'Historie Naturelle in Paris.) (Nouvel et al., 1976) Sur 34 animaux ainsi examines, nous avons obtenu 19 resultats positives: 2 concernant les chevaux de Przewalski (Equus przewalskii);1 buffle de l'Inde (Bubalus bubalis) nouveau-ne; 4 ovins (Ovis canadensis, Ovis vignei, Ovis musimon); 2 antilopes (Oryx beisa), nouveau-ne et (Redunca redunca) mort-ne; 6 cervides (Sika nippon, Muntiacus muntjac); 2 singes (Erythrocebus patas, Cercopithecus aethiops sabaeus); 1 goose (Cereopsis novae hollandiae); 1 tatou (Dasypus sexcinctus). (Translation: Of the 34 animals examined, we obtained positive results from: 2 Prezwalski horses (Equus przewalskii); 1 newborn Indian buffalo (Bubalus bubalis); 4 sheep (Ovis canadensis, Ovis vignei, Ovis musimon); 2 newborn antelopes (Oryz beisa), and one stillborn (Redunca redunca); 6 deer (Sika nippon, Muntiacus muntjac); 2 monkeys (Erythrocebus patas, Cercopithecus aethiops sabaeus); 1 goose (Cereopsis novae hollandiae); 1 armadillo (Dasypus sexcinctus) (Nouvel et al., 1976).
        35. Cat :
          • GenBank Taxonomy No.: 9685
          • Scientific Name: Felis catus (NCBI Taxonomy)
          • Description: Melioidosis has occurred in dogs, cats and cattle but these animals are considered to be fairly resistant to disease. Disease in these species is often associated with an underlying immunosuppressive condition (Choy et al., 2000). Melioidosis in cats has been described, with abscess formation in the liver, spleen and lymph nodes (Sprague and Neubauer, 2004).
        36. California sealion :
          • GenBank Taxonomy No.: 9704
          • Scientific Name: Zalophus californianus (NCBI Taxonomy)
          • Description: Reports of melioidosis in other species, such as cetaceans, are infrequent, but multiple deaths in an oceanarium in Hong Kong, occurring during the annual rainy 'typhoon season' are reported. Described here are the pathological findings in 25 marine mammals that died in this oceanarium over an 11-year period (1982-1993) and from which B. pseudomallei was isolated. Included in the study were seven false killer whales (Pseudorca crassidens), six aduncas type bottlenosed dolphins (Tursiops truncatus), five gill type bottlenosed dolphins (Tursiops truncatus), four Pacific white-sided dolphins (Lagenorhynchus obliquidens), and single cases in killer whale (Orcinus orca), Californian sea lion (Zalophus californianus), and grey seal (Halichoerus grypus). These animals were introduced to the oceanarium from a variety of locations especially Japan and Taiwan, between January 1978 and April 1989 (Hicks et al., 2000). Probably recurrent infection had occurred in two of our animals (a dolphin and a California sealion) that clinically and at necropsy appeared to have been infected for longer periods (Hicks et al., 2000).
        37. Dog :
          • GenBank Taxonomy No.: 9615
          • Scientific Name: Canis familiaris (NCBI Taxonomy)
          • Description: Melioidosis has occurred in dogs, cats and cattle but these animals are considered to be fairly resistant to disease. Disease in these species is often associated with an underlying immunosuppressive condition (Choy et al., 2000). In dogs acute, subacute and chronic melioidosis can be distinguished. The most significant clinical signs in acute cases are fever, severe diarrhoea, fulminant pneumonia and septicaemia. The subacute form can last from 7 days to several months and frequently starts as a skin lesion with development of lymphangitis and lymphadenitis resulting in septicaemia. However, pulmonary involvement with subsequent septicaemia can also be observed. Necrosis and granulomatous inflammation of localized lesions describe the chronic form. Further symptoms are anorexia, myalgia, oedema of the limbs, dermal abscesses and epididymitis (Sprague and Neubauer, 2004).
        38. Gray seal :
          • GenBank Taxonomy No.: 9711
          • Scientific Name: Halichoerus grypus (NCBI Taxonomy)
          • Description: Reports of melioidosis in other species, such as cetaceans, are infrequent, but multiple deaths in an oceanarium in Hong Kong, occurring during the annual rainy 'typhoon season' are reported. Described here are the pathological findings in 25 marine mammals that died in this oceanarium over an 11-year period (1982-1993) and from which B. pseudomallei was isolated. Included in the study were seven false killer whales (Pseudorca crassidens), six aduncas type bottlenosed dolphins (Tursiops truncatus), five gill type bottlenosed dolphins (Tursiops truncatus), four Pacific white-sided dolphins (Lagenorhynchus obliquidens), and single cases in killer whale (Orcinus orca), Californian sea lion (Zalophus californianus), and grey seal (Halichoerus grypus). These animals were introduced to the oceanarium from a variety of locations especially Japan and Taiwan, between January 1978 and April 1989 (Hicks et al., 2000). Probably recurrent infection had occurred in two of our animals (a dolphin and a California sealion) that clinically and at necropsy appeared to have been infected for longer periods (Hicks et al., 2000).
        39. Giant panda :
          • GenBank Taxonomy No.: 9646
          • Scientific Name: Ailuropoda melanoleuca (NCBI Taxonomy)
          • Description: En revanche, parmi 5 animaux conserves en chamber froide (une gazelle d'Arabie, un glouton, deux chimpanzes et un panda), le bacilli de Whitmore fut isole a partir du panda, de la gazelle et d'un chimpanze. (Translated: On the other hand, among 5 animals preserved in chamber cold (a gazelle of Arabia, a glouton, two chimpanzees and a panda), Whitmore's bacilli was insolated the panda, one of the gazelles, and a chimpanzee.) (Mollaret, 1988)
        40. Bottle-nosed dolphin :
          • GenBank Taxonomy No.: 9739
          • Scientific Name: Tursiops truncatus (NCBI Taxonomy)
          • Description: Reports of melioidosis in other species, such as cetaceans, are infrequent, but multiple deaths in an oceanarium in Hong Kong, occurring during the annual rainy 'typhoon season' are reported. Described here are the pathological findings in 25 marine mammals that died in this oceanarium over an 11-year period (1982-1993) and from which B. pseudomallei was isolated. Included in the study were seven false killer whales (Pseudorca crassidens), six aduncas type bottlenosed dolphins (Tursiops truncatus), five gill type bottlenosed dolphins (Tursiops truncatus), four Pacific white-sided dolphins (Lagenorhynchus obliquidens), and single cases in killer whale (Orcinus orca), Californian sea lion (Zalophus californianus), and grey seal (Halichoerus grypus). These animals were introduced to the oceanarium from a variety of locations especially Japan and Taiwan, between January 1978 and April 1989 (Hicks et al., 2000). Probably recurrent infection had occurred in two of our animals (a dolphin and a California sealion) that clinically and at necropsy appeared to have been infected for longer periods (Hicks et al., 2000).
        41. False killer whale :
          • GenBank Taxonomy No.: 82174
          • Scientific Name: Pseudorca crassidens (NCBI Taxonomy)
          • Description: Reports of melioidosis in other species, such as cetaceans, are infrequent, but multiple deaths in an oceanarium in Hong Kong, occurring during the annual rainy 'typhoon season' are reported. Described here are the pathological findings in 25 marine mammals that died in this oceanarium over an 11-year period (1982-1993) and from which B. pseudomallei was isolated. Included in the study were seven false killer whales (Pseudorca crassidens), six aduncas type bottlenosed dolphins (Tursiops truncatus), five gill type bottlenosed dolphins (Tursiops truncatus), four Pacific white-sided dolphins (Lagenorhynchus obliquidens), and single cases in killer whale (Orcinus orca), Californian sea lion (Zalophus californianus), and grey seal (Halichoerus grypus). These animals were introduced to the oceanarium from a variety of locations especially Japan and Taiwan, between January 1978 and April 1989 (Hicks et al., 2000).
        42. Killer whale :
          • GenBank Taxonomy No.: 9733
          • Scientific Name: Orcinus orca (NCBI Taxonomy)
          • Description: Reports of melioidosis in other species, such as cetaceans, are infrequent, but multiple deaths in an oceanarium in Hong Kong, occurring during the annual rainy 'typhoon season' are reported. Described here are the pathological findings in 25 marine mammals that died in this oceanarium over an 11-year period (1982-1993) and from which B. pseudomallei was isolated. Included in the study were seven false killer whales (Pseudorca crassidens), six aduncas type bottlenosed dolphins (Tursiops truncatus), five gill type bottlenosed dolphins (Tursiops truncatus), four Pacific white-sided dolphins (Lagenorhynchus obliquidens), and single cases in killer whale (Orcinus orca), Californian sea lion (Zalophus californianus), and grey seal (Halichoerus grypus). These animals were introduced to the oceanarium from a variety of locations especially Japan and Taiwan, between January 1978 and April 1989 (Hicks et al., 2000).
        43. Pacific white-sided dolphin :
          • GenBank Taxonomy No.: 90247
          • Scientific Name: Lagenorhynchus obliquidens (NCBI Taxonomy)
          • Description: Reports of melioidosis in other species, such as cetaceans, are infrequent, but multiple deaths in an oceanarium in Hong Kong, occurring during the annual rainy 'typhoon season' are reported. Described here are the pathological findings in 25 marine mammals that died in this oceanarium over an 11-year period (1982-1993) and from which B. pseudomallei was isolated. Included in the study were seven false killer whales (Pseudorca crassidens), six aduncas type bottlenosed dolphins (Tursiops truncatus), five gill type bottlenosed dolphins (Tursiops truncatus), four Pacific white-sided dolphins (Lagenorhynchus obliquidens), and single cases in killer whale (Orcinus orca), Californian sea lion (Zalophus californianus), and grey seal (Halichoerus grypus). These animals were introduced to the oceanarium from a variety of locations especially Japan and Taiwan, between January 1978 and April 1989 (Hicks et al., 2000). Probably recurrent infection had occurred in two of our animals (a dolphin and a California sealion) that clinically and at necropsy appeared to have been infected for longer periods (Hicks et al., 2000).
        44. Euphractus sexcinctus :
          • GenBank Taxonomy No.: 143300
          • Scientific Name: Euphractus sexcinctus (NCBI Taxonomy)
          • Description: Le bacille de Whitmore, agent de la melioidose, a ete isole de quelques animaux sauvages de la Menagerie du Jardin des Plantes au Museum National d'Historie Naturelle de Paris. (Translation: Whitmore's bacillus, the agent of the melioidosis, was isolated from some of the wild animals in the Menagerie du Jardin des Plantes au Museum National d'Historie Naturelle in Paris.) (Nouvel et al., 1976) Sur 34 animaux ainsi examines, nous avons obtenu 19 resultats positives: 2 concernant les chevaux de Przewalski (Equus przewalskii);1 buffle de l'Inde (Bubalus bubalis) nouveau-ne; 4 ovins (Ovis canadensis, Ovis vignei, Ovis musimon); 2 antilopes (Oryx beisa), nouveau-ne et (Redunca redunca) mort-ne; 6 cervides (Sika nippon, Muntiacus muntjac); 2 singes (Erythrocebus patas, Cercopithecus aethiops sabaeus); 1 goose (Cereopsis novae hollandiae); 1 tatou (Dasypus sexcinctus). (Translation: Of the 34 animals examined, we obtained positive results from: 2 Prezwalski horses (Equus przewalskii); 1 newborn Indian buffalo (Bubalus bubalis); 4 sheep (Ovis canadensis, Ovis vignei, Ovis musimon); 2 newborn antelopes (Oryz beisa), and one stillborn (Redunca redunca); 6 deer (Sika nippon, Muntiacus muntjac); 2 monkeys (Erythrocebus patas, Cercopithecus aethiops sabaeus); 1 goose (Cereopsis novae hollandiae); 1 armadillo (Dasypus sexcinctus) (Nouvel et al., 1976).
        45. Koala :
          • GenBank Taxonomy No.: 38626
          • Scientific Name: Phascolarctos cinereus (NCBI Taxonomy)
          • Description: Pseudomonas pseudomallei was isolated from a lactating, free-living female koala (Phascolarctos cinereus) which died after being captured and released for routine survey purposes. The subject was a 4-year-old female weighing 5.7 kg (Ladds et al., 1990). Presumably this koala became infected 'between trees', by eating contaminated soil during its brief time on the ground. Possibly its susceptibility was heightened by the stress of lactation (Ladds et al., 1990).
        46. Wallaby :
          • GenBank Taxonomy No.: 9312
          • Scientific Name: Macropus sp (NCBI Taxonomy).
          • Description: Three wallabies were received from Australia on 26 March 1978. All were reported healthy on arrival in Penang. One died on 9 June 1978 (Case No. 1) and another on 4 July 1978 (Case No. 2) (Saroja, 1979). On the basis of colonial characteristics, cellular morphology, staining characteristics, biochemical reactions, and slide agglutination tests, both the isolates were identified as Ps. pseudomallei (Saroja, 1979).
        47. Tree kangaroos :
          • GenBank Taxonomy No.: 38603
          • Scientific Name: Dendrolagus sp (NCBI Taxonomy).
          • Description: A case of melioidosis in a tree climbing kangaroo (Dendrolagus sp) is recorded. The case was characterized by posterior paralysis and by abscess formation in the liver and spleen. The causative organism Pseudomonas pseudomallei has bacteriological and pathogenic properties very similar to those described for isolates from domestic animals (Egerton, 1963). The origin of the infection at the zoo is unknown. No other cases have appeared among twelve other marsupials held there. The animal which died had been in captivity for two years and came from a remote area north east of Port Moresby (Egerton, 1963).

    2. Infection Process:

      No infection process information is currently available here.

    3. Disease Information:

      No disease information is currently available here.

    4. Prevention:

      No prevention information is currently available here.

    5. Model System:

      No model system information is currently available here.

  3. Aves:
    1. Taxonomy Information:
      1. Species:
        1. Cape Barren goose :
          • GenBank Taxonomy No.: 8858
          • Scientific Name: Cereopsis novaehollandiae (NCBI Taxonomy)
          • Description: Le bacille de Whitmore, agent de la melioidose, a ete isole de quelques animaux sauvages de la Menagerie du Jardin des Plantes au Museum National d'Historie Naturelle de Paris. (Translation: Whitmore's bacillus, the agent of the melioidosis, was isolated from some of the wild animals in the Menagerie du Jardin des Plantes au Museum National d'Historie Naturelle in Paris.) (Nouvel et al., 1976) Sur 34 animaux ainsi examines, nous avons obtenu 19 resultats positives: 2 concernant les chevaux de Przewalski (Equus przewalskii);1 buffle de l'Inde (Bubalus bubalis) nouveau-ne; 4 ovins (Ovis canadensis, Ovis vignei, Ovis musimon); 2 antilopes (Oryx beisa), nouveau-ne et (Redunca redunca) mort-ne; 6 cervides (Sika nippon, Muntiacus muntjac); 2 singes (Erythrocebus patas, Cercopithecus aethiops sabaeus); 1 goose (Cereopsis novae hollandiae); 1 tatou (Dasypus sexcinctus). (Translation: Of the 34 animals examined, we obtained positive results from: 2 Prezwalski horses (Equus przewalskii); 1 newborn Indian buffalo (Bubalus bubalis); 4 sheep (Ovis canadensis, Ovis vignei, Ovis musimon); 2 newborn antelopes (Oryz beisa), and one stillborn (Redunca redunca); 6 deer (Sika nippon, Muntiacus muntjac); 2 monkeys (Erythrocebus patas, Cercopithecus aethiops sabaeus); 1 goose (Cereopsis novae hollandiae); 1 armadillo (Dasypus sexcinctus) (Nouvel et al., 1976).
        2. Cassowary :
          • GenBank Taxonomy No.: 8786
          • Scientific Name: Casuarius spp (NCBI Taxonomy).
          • Description: Isolates from birds belonging to the Jurong Bird Park, located several kilometers away from the Singapore Zoological Gardens, were also of the RE II (cassowary and palm cockatoo) as well as RE I (crown pigeons) types (Yap et al., 1995).
        3. Galah :
          • GenBank Taxonomy No.: 176039
          • Scientific Name: Eolophus roseicapillus (NCBI Taxonomy)
          • Description: Birds have always been regarded as relatively resistant to melioidosis. A survey in Australia showed no serological evidence of Pseudomonas pseudomallei in 4 species of native birds. No other studies have been reported. Recently, the first case of avian melioidosis was recorded in Australia. This paper reports a second case of infection in a native bird (Thomas et al., 1980). Pseudomonas pseudomallei was isolated in pure culture from the liver, spleen and intestinal contents of a galah (Cacatua roseicapilla). The case was characterised by focal granuloma formation, often associated with necrosis, in the brain, lungs, liver, spleen and kidneys (Thomas et al., 1980). As Ps. pseudomallei has been recovered from muddy water and soil in the Townsville area, it would appear likely that the disease was contracted from the earthen floor of the transit aviary (Thomas et al., 1980).
        4. Palm cockatoo :
          • GenBank Taxonomy No.: 141839
          • Scientific Name: Probosciger aterrimus (NCBI Taxonomy)
          • Description: Isolates from birds belonging to the Jurong Bird Park, located several kilometers away from the Singapore Zoological Gardens, were also of the RE II (cassowary and palm cockatoo) as well as RE I (crown pigeons) types (Yap et al., 1995).
        5. Macaroni Penguin :
          • GenBank Taxonomy No.: 9627
          • Scientific Name: Eudyptes chrysolophus (NCBI Taxonomy)
          • Description: A female macaroni penguin, Eudyptes chrysolophus, at Ocean Park, Hong Kong, died suddenly during a period of extremely high ambient temperature and humidity. Necropsy results including pathological, histological, and microbiological observations indicated that the penguin died due to disseminated Pseudomonas pseudomallei infection. This is the third report of this disease in avian species, and the first report involving a penguin (MacKnight et al., 1990).
        6. Sulfur-crested cockatoo :
          • GenBank Taxonomy No.: 141274
          • Scientific Name: Cacatua galerita (NCBI Taxonomy)
          • Description: A case of melioidosis in a sulphur-crested cockatoo (Cacatua galerita) kept as a pet in Townsville is described. This case was characterised by liver necrosis with both a heterophil and mononuclear cell inflammatory response associated with giant cells. Pseudomonas pseudomallei was isolated by blood plate culture and guinea pig inoculation. This is the first case of melioidosis reported in a native bird in Australia (Thomas et al., 1978). In a recent laboratory case dealing with melioidosis in a sulphur-crested cockatoo, it was noted that the organisms in the histological sections were long, thin and non-polar staining and thus not morphologically typical of Ps. pseudomallei as described from culture. The normal avian body temperature range of 40.0 - 43.0 C with the higher temperatures being found in the smaller birds may be a factor in this difference. Three points of interest arise from this case. First, the appearance of long, thin, non-bipolar staining organisms in avian tissue sections should not exclude Ps. pseudomallei from the diagnosis. Secondly, the disease may not be as rare in birds as first thought, especially in native birds that are subjected to stress when captured and caged. Lastly, there is a human health risk involved if pet birds can contract this disease and excrete the organisms in the faeces (Thomas et al., 1980).
        7. White-fronted parrot :
          • GenBank Taxonomy No.: 241569
          • Scientific Name: Amazona albifrons (NCBI Taxonomy)
          • Description: A disease characterized by inappetance and diarrhoea occurred among a group of African parrots (Amazoa albifrous) [sic] which were kept as household pets. Seven out of twelve birds died as a result of the disease and two were submitted to the Veterinary Research Institute, Ipoh, for examination. No macroscopic lesions were seen at autopsy in one of the birds, neither were pathogenic bacteria isolated in culture. The liver and spleen of the other bird showed numerous yellowish pin-point lesions. Histologically these lesions were seen as non-capsulated foci of necrosis and abscess formation. No acid-fast bacilli were seen in smears. From the liver a pure culture of A. whitmori was isolated on 10 per cent ox-blood agar incubated aerobically (Lim and Tan, 1967).

    2. Infection Process:

      No infection process information is currently available here.

    3. Disease Information:

      No disease information is currently available here.

    4. Prevention:

      No prevention information is currently available here.

    5. Model System:

      No model system information is currently available here.


IV. Labwork Information

A. Biosafety Information:
  1. Biosafety information for : Burkholderia pseudomallei :
    • Biosafety Level: Biosafety level (BSL) 2 practices, equipment, and containment are recommended for working with known or potentially infectious body fluids, tissue specimens, or cultures. However, a review of work in a clinical laboratory in an area in which melioidosis is endemic indicated low risk to laboratory workers (CDC Report, 2004). Serologic follow-up of 60 laboratory workers over 15 years identified three workers with titers suggestive of subclinical infection, consistent with the background seroprevalence in the local community. These data suggest that infection is not easily acquired from routine, open-bench laboratory work with B. pseudomallei (CDC Report, 2004). Two laboratory-acquired cases have been described, one associated with sonication outside a safety hood the other after organisms were spilled during centrifugation, highlighting the need for biosafety precautions (Cheng and Currie, 2005).
B. Culturing Information:
  1. Culture of B. pseudomallei using Ashdown's selective agar :
    1. Description: Isolation of the organism from any sample is diagnostic for melioidosis and remains the "gold standard." Specimens from nonsterile sites may be the only specimen positive by culture, and the use of selective agar is necessary to reduce the overgrowth and masking of B. pseudomallei by commensal flora. Ashdown's agar is the most common selective medium in use in countries where the disease is endemic. The presumptive identification of colonies of B. pseudomallei can be made from their characteristic purple color and dry and wrinkled appearance, which becomes evident after 24 to 48 h of incubation (Peacock et al., 2005). Ashdown's selective medium is commonly used to culture the organism. This is a simple agar containing crystal-violet, glycerol, and gentamicin. The colonies develop a characteristic appearance (rugose, or like cornflower heads) and they take up crystal-violet dye from the medium (White, 2003) Definitive diagnosis of melioidosis requires a positive culture of B. pseudomallei. Melioidosis must be considered in febrile patients in or returning from endemic regions to enable appropriate samples and laboratory awareness. B. pseudomallei readily grows in commercially available blood culture media but it is not unusual for laboratories in nonendemic locations to misidentify the bacteria. Culture from nonsterile sites can be problematic and the likelihood of successful culture is increased if sputum, throat swabs, ulcer/skin lesion swabs and rectal swabs are placed into Ashdown's medium, a gentamicin-containing liquid transport broth that results in selective growth of B. pseudomallei (Currie, 2003).

    2. Medium:
      1. A selective medium consisting of trypticase soy agar with 4% glycerol, 5 mg/l crystal violet, 50 mg/l neutral red and 4 mg/l of gentamicin was devised for isolation of Pseudomonas pseudomallei from clinical specimens. Absorption of neutral red was found to be suitable for differentiating this organism from other bacteria, while gentamicin was effective in selecting Ps. pseudomallei from organisms commonly found in clinical material. The medium was more suitable for screening clinical specimens than MacConkey's agar with colistin-S because it was more selective and allowed multiple specimens to be inoculated on a single plate (Ashdown, 1979).
    3. Optimal Temperature: 35 C (Howard and Inglis, 2003)
    4. Note: The time to blood culture positivity, reflecting the density of bacteremia, correlated with mortality; 73.7% of patients died if blood cultures became positive with 24 h, compared to 40.9% of those with a time to detection of greater than 24 h. In that study, using the automatic BacT/Alert system, 62% of positive cultures were detected in the first 24 h and more than 90% were detected within 48 h. Alternative blood culture methods could decrease the time to obtain a positive culture, but at the cost of reduced sensitivity (Cheng and Currie, 2005).
  2. Novel Burkholderia pseudomallei selective agar (BPSA) for culturing B. pseudomallei :
    1. Description: B. pseudomallei, Burkholderia cepacia, and Pseudomonas aeruginosa were used to determine the selectivity and sensitivity of BPSA. BPSA was more inhibitory to P. aeruginosa and B. cepacia and should make recognition of Burkholderia species easier due to distinctive colony morphology. BPSA also inhibited Enterococcus, Escherichia, Staphylococcus, and Streptococcus: These results indicate that BPSA is a potential replacement for ASA. BPSA provides large wrinkled colonies faster than ASA. This means that B. pseudomallei colonies are more visible and there is more bacterial growth for supplementary tests. This is particularly important for melioidosis, for public health control strategies that rely on rapid isolation of B. pseudomallei will also benefit from faster detection. This time reduction should also improve the quality of antibiotic treatment for patients. While public health investigations of melioidosis are hampered at present by delays in isolation of B. pseudomallei from nonsterile clinical sites, isolation of B. pseudomallei from environmental specimens such as soil and water takes even longer (Howard and Inglis, 2003). The selectivity of BPSA was lower than that of Ashdown's or B. cepacia medium (Peacock et al., 2005).

    2. Medium:
      1. BPSA comprised 23.5 g of SMA (BBL, Cockeysville, Md.), 4 g of maltose (Sigma, St. Louis, Mo.), and 100 mg of neutral red (Sigma) in 1 liter of distilled water sterilized at 134 C for 10 min (or 121 C for 15 min). The agar is allowed to cool to 40 to 45C, and then 20 mg of gentamicin (Sigma) per liter and 1 ml of 20-g/liter Nile blue (dissolved in 1% dimethyl sulfoxide) are added after filter sterilization via a 0.2-um-pore-size membrane (Pall Corporation, Ann Arbor, Mich.). Ten milliliters of glycerol (equivalent to 1%) (BDH, Merck P/L, Kilsyth, Australia) is added and the medium is placed onto a heated magnetic stirrer at 40 C for 5 min before plates are poured (18 ml/plate) (Howard and Inglis, 2003).
    3. Optimal Temperature: 35 C (Howard and Inglis, 2003)
    4. Note: The time to blood culture positivity, reflecting the density of bacteremia, correlated with mortality; 73.7% of patients died if blood cultures became positive with 24 h, compared to 40.9% of those with a time to detection of greater than 24 h. In that study, using the automatic BacT/Alert system, 62% of positive cultures were detected in the first 24 h and more than 90% were detected within 48 h. Alternative blood culture methods could decrease the time to obtain a positive culture, but at the cost of reduced sensitivity (Cheng and Currie, 2005).
  3. Sputum Culture (Huis in 't Veld et al., 2005):
    1. Description: A total of 712 patients presenting to Sappasithiprasong Hospital, Ubon Ratchathani, Thailand, with melioidosis between January 1992 and December 2002 had a sputum culture performed during admission, which was positive for B. pseudomallei in 444 patients (62%). The median duration of sputum positivity was 9 days (range, 1 to 49 days). Sputum cultures were negative in 32% of patients with radiologic changes suggestive of pulmonary involvement. Overall in-hospital mortality was 48%. A positive sputum culture was associated with mortality (adjusted OR 2.8, 95% CI: 1.9, 4.0; P less than 0.001). This was independent of renal disease, a prior history of melioidosis, positive blood cultures, and other potential confounders. The presence of B. pseudomallei in the sputum of patients with melioidosis is associated with a poorer prognosis (Huis in 't Veld et al., 2005).

    2. Medium:
      1. Sputum was collected into a sterile container and transferred to an on-site research microbiology laboratory. A 10 uL loop of specimen was plated onto each of three agar plates (Ashdown, MacConkey, and blood agar), and the remainder added to a selective enrichment broth (Huis in 't Veld et al., 2005).
    3. Optimal Temperature: Plates and broth were incubated in air at 37C (Howard and Inglis, 2003).
    4. Picture(s):
      1. Burkholderia pseudomallei on MacConkey agar (Website 61):



        Description: Burkholderia pseudomallei on MacConkey agar. Melioidosis is a common problem in Darwin. Submitted by: Dr. Gary Lum, Royal Darwin Hospital, Darwin, Australia (Website 61).
C. Diagnostic Tests :
  1. Organism Detection Tests:
    1. Gram stain:
      1. Description: An organism was presumptively identified as Ps. pseudomallei if: it was an oxidase positive, bipolar, or irregularly staining Gram negative rod, which grew on Columbia agar to within 2 mm of both antibiotic discs after 24 hours' incubation; had a metallic sheen over the area of confluent growth; had a distinctive sweet, earthy odour; and produced opaque, purple, rugose colonies, with no discolouration of the surrounding medium, after 48-72 hours' incubation on Ashdown's agar (Dance et al., 1989). Gram stains were performed on a thin-smear preparation of fresh culture emulsified in sterile 0.89% NaCl solution (ELP, Bentley, WA). Crystal violet, Lugol's iodine, acetone, and dilute carbol fuchsin were used. Gram reaction, bacterial shape, and the presence or absence of intracellular granules were noted. Oxidase tests were performed by spreading a linear smear from the single colony on filter paper impregnated with oxidase reagent. To be considered positive, a strong purple reaction was required in the paper before 10 s had elapsed (Inglis et al., 2005).
    2. Rapid immunofluorescence microscopy (IF):
      1. Time to Perform: minutes-to-1-hour
      2. Description: An immunofluorescent (IF) method that detects Burkholderia pseudomallei in clinical specimens within 10 min was devised. The results of this rapid method and those of an existing IF method were prospectively compared with the culture results for 776 specimens from patients with suspected melioidosis. The sensitivities of both IF tests were 66%, and the specificities were 99.5 and 99.4%, respectively (Wuthiekanun et al., 2005A). The rapid method was a one-step technique in which 1 drop (10 ul) of specimen was mixed on a clean glass microscopic slide with an equal volume of conjugate and a coverslip applied. The white blood cells present in pus were lysed prior to examination by the addition of an equal volume of distilled water, and respiratory secretions were mixed with an equal volume of sterile distilled water before examination. Conjugate was used at a 1:200 dilution in blocking buffer. The slides were examined with a fluorescent microscope with a x100 oil-immersion lens. A positive result by either test was recorded when the periphery of the bacilli showed a strong apple-green fluorescence. A slide known to be positive (for a clinical isolate of B. pseudomallei) was prepared and examined in each test run. The results of this rapid method and those of an existing IF method were prospectively compared with the culture results for 776 specimens from patients with suspected melioidosis. The sensitivities of both IF tests were 66%, and the specificities were 99.5 and 99.4%, respectively (Wuthiekanun et al., 2005A). To date, none of the newly developed tests has been or is commercially available and no positive and negative control sera of the various animal species which could be infected with B. pseudomallei are available. Serology is still a technique restricted to a limited number of expert laboratories worldwide (Sprague and Neubauer, 2004).
      3. False Positive: Four of the 622 specimens (from 526 patients) that were culture negative for B. pseudomallei were positive by either IF method. Three were false positive by both methods, and an additional sample was false positive only by the standard IF method. Two of these were urine samples that grew Pseudomonas aeruginosa and Acinetobacter spp., respectively, on Ashdown's medium; and two were respiratory secretions that were negative on Ashdown's medium but that grew mixed respiratory flora on blood agar (Wuthiekanun et al., 2005A).

  2. Immunoassay Tests:
    1. Monoclonal Antibody Agglutination Test:
      1. Time to Perform: minutes-to-1-hour
      2. Description: A B. pseudomallei-specific agglutination test was performed on each isolate using a B. pseudomallei monoclonal antibody preparation (All Eights Sdn. Bhd., Kuala Lumpur, Malaysia) according to the manufacturer's instructions except that the volumes of emulsified culture and antibody suspension were 4 ul and were dispensed by automatic displacement pipette with sterile disposable tips. New, acid-washed glass microscope slides were used for agglutination reactions, and a new slide was started after each positive test result. B. pseudomallei NCTC 13177 was used for the positive control. Positive-control isolates and all negative isolates were retested after a further 24 h incubation. All agglutination reactions were conducted in a class II biological safety cabinet by gowned and gloved staff (Inglis et al., 2005). The minimum time to completion of an agglutination test result was 5 min, including preparatory stages (Inglis et al., 2005). The rapid agglutination test correctly identified the majority of B. pseudomallei isolates. This test was quick to perform, producing a useful positive result on the same day as the presumptive screening tests, and had a high sensitivity. We used a commercially available reagent developed in Malaysia. Previous reports have been based on in-house reagents that have not yet been independently validated to the standard expected of commercially available diagnostic test kits. The lack of validated diagnostic reagents for either immunological or molecular diagnostic tests for B. pseudomallei has been recognized as a significant hindrance to reliable laboratory diagnosis of melioidosis. Our agglutination test results provide a reference point for future comparisons with in-house methods. However, the agglutination reaction was sometimes difficult to read behind the glass of a microbiological safety cabinet, possibly explaining why a small proportion of isolate results were positive after a further 24 h of incubation. It is notable that the test was reliably positive at just less than half the recommended volume of 10 ul. However, a lower sensitivity than the PCR identification method highlights the need for another confirmatory identification method. This observation places the B. pseudomallei agglutination test result somewhere between a presumptive and definitive identification. Of the tests considered in this study, only the B. pseudomallei agglutination test offered any prospect of shortening the time to culture-based diagnosis (Inglis et al., 2005).
    2. Monoclonal antibody-based latex agglutination:
      1. Time to Perform: minutes-to-1-hour
      2. Description: A monoclonal antibody-based latex agglutination (MAb-LA) test was employed for the rapid identification of Burkholderia pseudomallei in blood culture fluid from patients with community-acquired septicaemia. These patients were admitted to 12 hospitals in the northeastern part of Thailand which is a region known to be endemic for melioidosis. Blood samples were collected and immediately added to the blood culture bottles which were incubated in either automated (five hospitals) or manual (seven hospitals) culture systems (Anuntagool et al., 2000). The method described is highly reproducible, simple to perform even by inexperienced laboratory personnel and does not require expensive or elaborate equipment (Anuntagool et al., 2000).
      3. False Positive: Among the 204 specimens culture positive for B. pseudomallei, 194 (95.1%) were positive by the MAb-LA test. When the blood culture fluid was used directly for testing, a total of 10 B. pseudomallei culture-positive samples were negative in the MAb-LA test (five from each system). Six of these MAB-LA negative specimens became positive after subculturing in BHI (Anuntagool et al., 2000). The specificity of the MAb-LA test was greater than 99%. The overall performance of the MAb-LA test was acceptable, with 95.1% sensitivity, 99.7% specificity, 98.8% positive predictive value and 99.2% negative predictive value. The sensitivity figure could be raised to 98.1% if the MAb-LA test was performed with the BHI broth subcultured from the blood culture LA test (Anuntagool et al., 2000).
      4. False Negative: Of the 552 culture-negative specimens (i.e., 'no growth' after incubation for a further 7 days at 37 C), only one was positive in the MAb-LA test (Anuntagool et al., 2000).
    3. Latex Agglutination using Lipopolysaccharide-specific monoclonal antibody:
      1. Time to Perform: minutes-to-1-hour
      2. Description: A latex agglutination test kit based on a specific monoclonal antibody to the bacterial lipopolysaccharide was developed and the performance of the test was prospectively evaluated in an area endemic for melioidosis (Dharakul et al., 1999). The monoclonal antibody was produced using a standard hybridoma technique 4 by fusion of the splenocytes with the P3X63-Ag8/653 mouse myeloma cell line using polyethylene glycol (PEG-4000; Accurate Chemical and Scientific Co., Westbury, NY). The antigen used for immunizing BALB/c mice was prepared from sonicated B. pseudomallei. Several hybridoma clones that recognized the lipopolysaccharide (LPS) of B. pseudomallei were produced, all of which produced antibodies of IgM isotype. One clone was selected for further characterization (Bps-L1). This monoclonal antibody recognized the LPS of B. pseudomallei as demonstrated by a characteristic ladder pattern of staining by Western blot analysis (Dharakul et al., 1999). The Bps-L1 monoclonal antibody recognized the lipopolysaccharide antigen of 96.8% of B. pseudomallei clinical isolates and was highly specific for B. pseudomallei. The diagnostic value of the latex agglutination test based on Bps-L1 monoclonal antibody was prospectively evaluated in an area endemic for melioidosis. The agglutination test kit was evaluated in 88 blood cultures with gram-negative bacteria identified with Gram staining. The sensitivity and specificity of the test kit were both 100%. These results indicated that the detection of B. pseudomallei lipopolysaccharide by specific monoclonal antibody in a latex agglutination format is clinically useful for the rapid identification of the bacteria in blood cultures in areas endemic for melioidosis (Dharakul et al., 1999).
      3. False Negative: The reactivity of the monoclonal antibody Bps-L1 was evaluated using 126 B. pseudomallei clinical isolates (Table 1). This antibody reacted with 122 (96.8%) of 126 B. pseudomallei isolates, and reacted with all isolates from blood (100%), but not with 1, 1, and 2 specimens from sputum, urine, and pus, respectively (Dharakul et al., 1999).
    4. Latex Agglutination using a Monoclonal antibody (MAb) specific to the 30-kDa protein of B. pseudomallei :
      1. Time to Perform: 1-to-2-days
      2. Description: In this study, we produced a monoclonal antibody (MAb) specific to the 30-kDa protein of B. pseudomallei by in vivo and in vitro immunization of BALB/c mice with a crude culture filtrate antigen. The MAb could directly agglutinate with all 243 clinical isolates of B. pseudomallei but not with other gram-negative bacteria, except for one strain of Burkholderia mallei. However, the MAb cross-reacted with the gram-positive Bacillus sp. and Streptococcus pyogenes. B. pseudomallei in brain heart infusion broth (BHIB) subcultured from a BacT/Alert automated blood culture system could be identified by simple agglutination with this MAb assay. The sensitivity and specificity of direct agglutination compared to the "gold standard," the culture method, were 94.12 and 98.25%, respectively. However, the MAb adsorbed to polystyrene beads or latex particles directly identified the bacterium in blood culture specimens and in BHIB subcultured from a BacT/Alert automated blood culture system. The sensitivity of the latex agglutination test was 100% for both blood culture and BHIB specimens. The specificity was 85.96 and 96.49% for the blood culture and BHIB specimens, respectively. The specificity could be increased if the nonspecific materials in the blood culture broths were eradicated by centrifugation at low speeds. Thus, a combination of blood culture and the agglutination method could be used for the rapid diagnosis of melioidosis in the routine bacteriological laboratory. This method could speed up detection of the bacterium in blood culture by at least 2 days, compared to the conventional bacterial culture method. In addition, the MAb is stable at room temperature for 2 weeks and at 4, -20, and -70 degrees C for at least 1 year. The latex reagent was stable for at least 6 months at 4 degrees C (Pongsunk et al., 1999).
      3. False Positive: The MAb reacted with all 243 isolates of B. pseudomallei but not with 27 other species of gram-negative bacteria. However, it cross-reacted with the type strain of B. mallei (the gram-negative strain ATCC 23344, isolated from a patient) but it did not react with ATCC 10399, which had been isolated from a horse. Of seven species of gram-positive bacteria, the MAb reacted with two species, a Bacillus sp. (1 of 4) and S. pyogenes (4 of 4) (Pongsunk et al., 1999).
    5. Latex Agglutination using a Monoclonal antibody specific for exopolysaccharide of B. pseudomallei:
      1. Time to Perform: minutes-to-1-hour
      2. Description: We recently identified and purified a constitutively expressed species-specific exopolysaccharide of B. pseudomallei reactive with the monoclonal antibody (MAb) 3015 immunoglobulin G1 (IgG1). This exopolysaccharide appeared to be a unique linear tetrasaccharide repeating unit consisting of three galactose residues and one 3-deoxy-d-manno-2-octulosonic acid (Kdo) residue. In this study we developed a latex agglutination test based on the MAb 3015 IgG1 and evaluated this test for the rapid identification of B. pseudomallei culture isolates originating from different areas in Southeast Asia, Australia, and Africa (Steinmetz et al., 1999). This monoclonal antibody-based test is a simple, rapid, and highly specific method for identifying B. pseudomallei culture isolates from different geographic areas (Steinmetz et al., 1999).
      3. False Positive: A total of 52 strains agglutinated with neither the specific nor the control latex. Four strains showed reactions with both the B. pseudomallei-specific latex and the control latex. These nonspecific reactions were absent when bacteria were heat treated and bacterial supernatant was tested. In these tests heat-treated B. pseudomallei supernatant served as a positive control and always strongly agglutinated (Steinmetz et al., 1999).
    6. ELISA:
      1. Description: Serodiagnosis of melioidosis is fraught with problems. Two recent papers from the same group looked at antibody class and sub-class responses in melioidosis using an enzyme-linked immunosorbent assay (ELISA) for antibodies to a partly purified culture filtrate antigen. The immunoglobulin G ELISA exhibited a sensitivity of 96% and a specificity of 97%, whereas the immunoglobulin M ELISA had a sensitivity of 74% and a specificity of 99%. The responses were studied in more detail in a smaller group of patients. Immunoglobulin G was detectable in 96-100% of patients with proved or suspected melioidosis, immunoglobulin A was detectable in 86-100%, and immunoglobulin M in 66-85%, whereas immunoglobulin E was not detected. A higher proportion of cases with localized than with septicaemic infections were antibody positive. Immunoglobulin G1 and G2 were the predominant subclasses detected. However, an internationally standardized serodiagnostic test for melioidosis is much needed (Dance, 2002). The diagnostic value of all serological tests is questionable in endemic areas, as healthy individuals may show persistent IgG levels. In non-endemic areas, the tests might be useful for detection of chronic infections (Sprague and Neubauer, 2004). To date, none of the newly developed tests has been or is commercially available and no positive and negative control sera of the various animal species which could be infected with B. pseudomallei are available. Serology is still a technique restricted to a limited number of expert laboratories worldwide (Sprague and Neubauer, 2004).
    7. Rapid immunochromogenic cassette test (ICT):
      1. Time to Perform: minutes-to-1-hour
      2. Description: Definitive diagnosis requires positive bacterial culture and confirmation of the organism, which usually takes several days. Furthermore, B. pseudomallei is resistant to many standard antibiotics used in empirical therapy for sepsis. Therefore, various antigen and nucleic acid detection tests and serology assays have been developed to expedite diagnosis. A commercially available immunochromatographic test (ICT) kit for the rapid determination of immunoglobulin M (IgM) and IgG antibodies to B. pseudomallei has been developed, with excellent sensitivity and specificity reported (O'Brien et al., 2004). Melioidosis Rapid Cassette Test kits were supplied by PanBio (Windsor, Queensland, Australia), and sera were tested and reported according to the manufacturer's instructions, which have been slightly modified from the previously described methods. Briefly, 5 ul of serum was placed on each of the target areas of the separate IgG and IgM test cassettes. Three drops of kit buffer were then added, and after 15 min the results were read; any trace of a pink-purple line was recorded as a positive result. All sera were also tested by standard B. pseudomallei indirect hemagglutination (IHA) assay, with a titer of greater than or equal to 1:40 considered reactive in our examination. A definitive diagnosis of melioidosis was the culture of B. pseudomallei from patient clinical specimens by using standard bacterial identification methods (O'Brien et al., 2004) The ICT IgG test gave results very similar to those of IHA, which remains the most widely used serology assay for melioidosis. For both assays a level of background seropositivity is expected because of prior exposure to B. pseudomallei in areas where melioidosis is endemic, and this may well account for the low positive predictive value for active disease (melioidosis) in our region. However, the specificities determined in this study of 90 and 91.3%, respectively, suggest serology remains useful for selecting patients for more intensive culturing for B. pseudomallei. Negative initial serology in acute melioidosis is well recognized, and sensitivities in this study demonstrate that negative serology cannot be used to exclude melioidosis, especially early in acute disease. False-negative serology is less common with chronic melioidosis, occurring in only 1 of 20 patients in this study (O'Brien et al., 2004). The ICT IgG cassette kit has the advantages of being transportable, user friendly, and able to produce an immediate result. It could be useful in hospital laboratories in areas where the disease is not endemic for rapid single-sample testing of patients with possible imported melioidosis. In these situations background seropositivity is less likely, especially in returning travelers. While patients presenting with acute melioidosis may initially have a negative ICT IgG result, the positive and negative predictive values should be especially high for those presenting with chronic symptoms consistent with melioidosis in areas where the disease is not endemic. This is an increasingly common clinical scenario, as more people with risk factors from the United States, Europe, and other locations where melioidosis is not endemic travel to regions where melioidosis is endemic. Nevertheless, culture of B. pseudomallei remains the gold standard for the diagnosis of melioidosis. A positive ICT IgG result could suggest the need for further appropriate cultures in laboratories not experienced with isolating and identifying B. pseudomallei. Cultures in selective media of throat and rectal swabs and any skin lesions are recommended, as is careful attention to correct identification of any gram-negative organisms isolated from blood and sterile sites (O'Brien et al., 2004). Despite the high proportion of patients with melioidosis at our institution, the clinical utility of both the ICT and the IHA are poor due to the high background rate of positive B. pseudomallei serology. Clinical criteria for identifying patients with melioidosis also are problematic, and reflect the protean nature of disease manifestations that mimic a range of other infections affecting this patient group (Cheng et al., 2006).
      3. False Positive: Previous studies in Thailand and Australia have suggested equivalent sensitivity but an improved specificity for the IgG ICT compared with IHA. An unexpected finding in this study was the high rate of false positive ICT tests and consequent poor specificity (less than 50%). It is likely that this reflects the nature of patients selected as controls in the previous study; the majority of patients in that study were blood culture-positive for organisms other than B. pseudomallei. In this study, however, many were culture-negative and possibly had leptospirosis, which is known to be endemic in this area (Cheng et al., 2006).

  3. Nucleic Acid Detection Tests: :
    1. Multiplex PCR:
      1. Description: The multiplex PCR consists of primers that flank a 10-bp repetitive element in B. pseudomallei and B. mallei amplifying PCR fragment of varying sizes between 400-700 bp, a unique sequence in B. thailandensis amplifying a PCR fragment of 308 bp and the metalloprotease gene amplifying a PCR fragment of 245 bp in B. pseudomallei and B. thailandensis. The multiplex PCR not only can differentiate the three Burkholderia species but can also be used for epidemiological typing of B. pseudomallei and B. mallei strains (Lee et al., 2005). The five primers, SR1, SR5, SRT3, 14F5 and 14R5 were multiplexed into a single PCR to detect and differentiate B. pseudomallei, B. mallei and B. thailandensis isolates (Lee et al., 2005).
      2. Primers:
        • Multiplex primers SR1 SR5 14F 14R and SRT3
          • Forward: SR1: 5'ACC GCG TAT GAA GGG ATG TC 3', 14F5: 5'ACC TGC TGC CGG GCT ACG ACT TCA 3', and SRT3: 5'AAA GCT GCG CGC TCG GCA TC 3'
          • Reverse: SR5: 5' ACG CGC ACG CAC CTG CTG AAC 3', 14R5: 5'CAC CTT GCC GAC CCA CGA GAT GC 3'
          • Product
    2. Real-time PCR Assay using Fluorescent Hybridization Probes:
      1. Description: We established real-time PCR assays using fluorescent hybridization probes targeting the 16S rDNA, the flagellin C (fliC) and the ribosomal protein subunit S21 (rpsU) genes (Tomaso et al., 2005). The 16S rDNA target was chosen, because it is highly conserved within the species B. pseudomallei and B. mallei. It is present in four copies on the genome, and sequence data from a large number of other bacteria were available to design highly specific primers. Recently, it was shown that B. pseudomallei and B. mallei can be consistently distinguished using 16S rDNA gene sequencing due to a 1-bp difference at position 75 (Tomaso et al., 2005) The test sensitivity and specificity were assessed with a representative panel of 39 B. pseudomallei, 9 B. mallei, 126 other Burkholderia strains of 29 species, and 45 clinically relevant non-Burkholderia organisms. The detection limit for the 16S rDNA, fliC, and rpsU assay was 40, 40, and 400 genome equivalents per reaction, however, in spiked blood samples it was 300, 300, and 3000, respectively. Specificity, positive and negative predictive value of the assays was 100%. In conclusion, it was recommend the use of the 16S rDNA and/or fliC real-time PCR assays for the rapid identification of B. mallei and B. pseudomallei in positive blood cultures or from suspicious bacterial colonies (Tomaso et al., 2005).
      2. Primers:
        • Target :16S rDNA
          • Forward: Burk 16S: TTCTGGCTAATACCCGGAGT (426-445)
          • Reverse: Burk 16S R: GCCCAACTCTCATCGGGC (974-991)
          • Product
            • Name: 16S ribosomal RNA gene
            • Size: 1488 bp
            • Product GenBank Accession Number: AY305818
        • Target: Flagellin C (fliC)
          • Forward: fliC S: AAGGGCGGCTTCACGTTCA (1383-1401)
          • Reverse: fliC A: GTGCTGATGTCGAGGTTCGAGA (1606-1627)
          • Product
            • Name: Flagellin (fliC) gene
            • Product GenBank Accession Number: AF084813
        • Target: Ribosomal protein subunit S21 (rpsU)
          • Forward: UF2: GAGCTTCTTCGGCAGCA (11-27)
          • Reverse: UR2: ATCAAGCAAATTAGGAACGACAT (216-238)
          • Product
            • Name: Ribosomal protein S21 gene
            • Product GenBank Accession Number: U73848
    3. Multiplex PCR Patterns as genetic markers for B. pseudomallei:
      1. Description: The technique of multiplex PCR has proved to be a rapid and simple method for typing B. pseudomallei. The type patterns correlated with the ability of the organism to assimilate L-arabinose and two types (M4, M15) were associated with the most serious clinical profile of melioidosis found in patients in the northeastern part of Thailand. This method is not only useful in clinical analysis but will also be of great use in the future study of B. pseudomallei epidemiology (Wongratanacheewin et al., 2000).
      2. Primers:

  4. Other Types of Diagnostic Tests:
    1. Gas-liquid chromatography analysis of bacterial fatty acid methyl esters (GLC-FAME):
      1. Time to Perform: 1-to-2-days
      2. Description: FAME profile analysis was performed on the fatty acid methyl ester derivative of bacterial suspensions using a fine capillary column gas chromatograph (MIDI Systems Inc., Wilmington, DE), according to the manufacturer's instructions, and a previously reported protocol (Inglis et al., 2005). FAME profile analysis was more sensitive than the agglutination test but significantly better than the API 20NE. The longer processing time makes GLC analysis less suited to a routine confirmatory role. In combination with the agglutination test, GLC analysis was more effective as a supplementary confirmatory tool. Its additive contribution to B. pseudomallei identification suggests that GLC might have a supporting role to the agglutination test in centers that are unable or unwilling to use PCR methods for bacterial identification, particularly when the API 20NE has produced an unclear or equivocal result. We recognize that most centers with a FAME-GLC capability will also have bacterial identification PCR capability and may prefer to validate their in-house PCR protocol (Inglis et al., 2005). The analytical process was lengthy and more suited to processing batches than single isolates. The minimum time to obtain a result was 28 h, including 24 h of incubation on suitable solid medium (tryptic soy agar) and 4 h for extraction, derivatization, and GLC batch analysis (Inglis et al., 2005).
      3. False Negative: One negative isolate was the one that possessed other features (wrinkled colony surface, agglutination test positive) consistent with B. pseudomallei (Inglis et al., 2005).
    2. Vitek system identification of Burkholderia pseudomallei:
      1. Description: VITEK SYSTEM. The rapid and reliable detection of bloodstream infections, including characterization of the bacterial microorganism to the species level and determination of its susceptibility pattern, is one of the most important tasks of clinical microbiologists. It has been well documented that rapid and reliable blood culture (BC) results significantly influence patient management and reduce overall hospital costs. During the 1990s we witnessed the introduction of highly automated and very sensitive BC systems, such as the BacT/Alert system (BioMerieux, Marcy l'Etoile, France) and the BACTEC 9240 system (BD, Sparks, Md.). Automated methods for bacterial identification (ID) and susceptibility testing in parallel have further improved, and machines such as the VITEK system (BioMerieux) and the PHOENIX Automated Microbiology System (PHX system; BD) are widely accepted and distributed in clinical microbiology laboratories (Funke and Funke-Kissling, 2004). The VITEK 2 system (BioMerieux) is a new automated bacterial identification and susceptibility testing system that uses fluorescence-based technology. Previous studies showed that this system could give reliable identification and susceptibility results with pure bacterial cultures (Ling et al., 2003). This study compares the manual API 20NE and 20E identification systems with the automated Vitek 1 and 2 systems. A total of 103 B. pseudomallei isolates were tested and correctly identified in 98%, 99%, 99%, and 19% of cases, respectively. The failure of the Vitek 2 to correctly identify B. pseudomallei was largely due to differences in the biochemical reactions achieved compared to expected values in the database. It is suggested that this deficiency in the Vitek 2 may be due to the large number of uncertain results reported for these isolates. These results reduce the discriminating ability of the instrument to distinguish between uncommonly encountered isolates such as those of B. pseudomallei (Lowe et al., 2002).

V. References

A. Journal References:
Abbink et al., 2001: Abbink FC, Orendi JM, de Beaufort AJ. Mother-to-child transmission of Burkholderia pseudomallei. N Engl J Med. 2001; 344(15): 1171 - 1172. [PubMed: 11302149].
Anuntagool et al., 2000: Anuntagool N, Naigowit P, Petkanchanapong V, Aramsri P, Panichakul T, Sirisinha S. Monoclonal antibody-based rapid identification of Burkholderia pseudomallei in blood culture fluid from patients with community-acquired septicaemia. Journal of Medical Microbiology. 2000; 49(12): 1075 - 1078. [PubMed: 11129718].
Ashdown, 1979: Ashdown LR. An improved screening technique for isolation of Pseudomonas pseudomallei from clinical specimens. Pathology. 1979; 11(2): 293 - 297. [PubMed: 460953].
Bergin and Torenbeeck, 1991: Bergin TJ, Torenbeeck LR. Melioidosis in camels. Aust Vet J. 1991; 68(9): 309 - . [PubMed: 1953569].
Bergin et al., 2005: Bergin P, Boyes L, Sage M. Cerebral melioidosis. Australasian Radiology. 2005; 49(1): 79 - 83. [PubMed: 15727617].
Bharadwaj et al., 1994: Bharadwaj R, Kagal A, Deshpandey SK, Joshi SA, Khare PM, Junnarkar AR, Phadke MA. Outbreak of plague-like illness caused by Pseudomonas pseudomallei in Maharashtra, India. Lancet. 1994; 344(8936): 1574 - 1574. [PubMed: 7527114].
Bossi et al., 2004: Bossi P., Tegnell A, Baka A, Van Loock F, Hendriks J, Werner A, Maidhof H, Gouvras G. Bichat guidelines for the clinical management of glanders and melioidosis and bioterrorism-related glanders and melioidosis. Euro Surveill. 2004; 9(12): E17 - E18. [PubMed: 15677841].
Brett and Woods, 2000: Brett PJ, Woods DE. Pathogenesis of and immunity to melioidosis. Acta Trop. 2000; 74(2-3): 201 - 210. [PubMed: 10674650].
Butler et al., 1971: Butler TM, Schmidt RE, Wiley GL. GL. Melioidosis in a chimpanzee. Am J Vet Res. 1971; 32(7): 1109 - 1117. [PubMed: 5104397].
CDC Report, 2004: CDC Report Laboratory exposure to Burkholderia pseudomallei--Los Angeles, California, 2003. MMWR. Morbidity and Mortality Weekly Report. 2004; 53(42): 988 - 990. [PubMed: 15514581].
Chadwick et al., 2002: Chadwick DR, Ang B, Sitoh YY, Lee CC. Cerebral melioidosis in Singapore: a review of five cases. Trans R Soc Trop Med Hyg. 2002; 96(1): 72 - 76. [PubMed: 11926000].
Chan et al., 1984: Chan CK, Hyland RH, Leers WD, Hutcheon MA, Chang D. Pleuropulmonary melioidosis in a Cambodian refugee. Can Med Assoc J. 1984; 131(11): 1365 - 1367. [PubMed: 6498689].
Chaowagul, 2000: Chaowagul W Recent advances in the treatment of severe melioidosis. Acta Trop. 2000; 74(2-3): 133 - 137. [PubMed: 10674641].
Chen et al., 2004: Chen YS, Chen SC, Wu TR, Kao CM, Chen YL. Seroprevalence of anti-flagellin antibody against Burkholderia pseudomallei in Taiwan. Jpn J Infect Dis. 2004; 57(5): 224 - 225. [PubMed: 15507783].
Cheng and Currie, 2005: Cheng AC, Currie BJ. Melioidosis: epidemiology, pathophysiology, and management. Clin Microbiol Rev. 2005; 18(2): 383 - 416. [PubMed: 15831829].
Cheng et al., 2006: Cheng AC, Peacock SL, Limmathurotsakul D, Wongsuvan G, Chierakul W, Amornchai P, Getchalarat N, Chaowagul W, White NJ, Day NP, Wuthiekanun V. Prospective evaluation of a rapid immunochromogenic cassette test for the diagnosis of melioidosis in northeast Thailand. Trans R Soc Trop Med Hyg. 2006; 100(1): 64 - 67. [PubMed: 16168447].
Choy et al., 2000: Choy JL, Mayo M, Janmaat A, Currie BJ. Animal melioidosis in Australia. Acta Tropica. 2000; 74(2-3): 153 - 158. [PubMed: 10674644].
Coenye and Vandamme, 2003: Coenye T, Vandamme P. Diversity and significance of Burkholderia species occupying diverse ecological niches. Environ Microbiol. 2003; 5(9): 719 - 729. [PubMed: 12919407].
Currie, 2003: Currie BJ. Melioidosis: an important cause of pneumonia in residents of and travelers returned from endemic regions. The European Respiratory Journal. 2003; 22(3): 542 - 550. [PubMed: 14516149].
Currie et al., 2000 (a): Currie BJ, Fisher DA, Anstey NM, Jacups SP. Melioidosis: acute and chronic disease, relapse and re-activation. Transactions of the Royal Society of Tropical Medicine and Hygiene. 2000; 94(3): 301 - 304. [PubMed: 10975006].
Currie et al., 2000 (b): Currie BJ, Fisher DA, Howard DM, Burrow JN, Selvanayagam S, Snelling PL, Anstey NM, Mayo MJ. The epidemiology of melioidosis in Australia and Papua New Guinea. Acta Tropica. 2000; 74(2-3): 121 - 127. [PubMed: 10674639].
Currie et al., 2000 (c): Currie BJ, Fisher DA, Howard DM, Burrow JN. Neurological melioidosis. Acta Tropica. 2000; 74(2-3): 145 - 151. [PubMed: 10674643].
Currie et al., 2001: Currie BJ, Mayo M, Anstey NM, Donohoe P, Haase A, Kemp DJ. A cluster of melioidosis cases from an endemic region is clonal and is linked to the water supply using molecular typing of Burkholderia pseudomallei isolates. Am J Trop Med Hyg. 2001; 65(3): 177 - 179. [PubMed: 11561699].
Dance, 2000A: Dance DA Ecology of Burkholderia pseudomallei and the interactions between environmental Burkholderia spp. and human-animal hosts. Acta Tropica. 2000; 74(2-3): 159 - 168. [PubMed: 10674645].
Dance, 2000B: Dance DA Melioidosis as an emerging global problem. Acta Tropica. 2000; 74(2-3): 115 - 119. [PubMed: 10674638].
Dance, 2002: Dance DA. Melioidosis. Current Opinion in Infectious Diseases. 2002; 15(2): 127 - 132. [PubMed: 11964912].
Dance et al., 1989: Dance DA, Wuthiekanun V, Naigowit P, White NJ. Identification of Pseudomonas pseudomallei in clinical practice: use of simple screening tests and API 20NE. J Clin Pathol. 1989; 42(6): 645 - 648. [PubMed: 2472432].
Dance et al., 1992: Dance DAB, King C, Aucken H, Knott CD, West PG, Pitt TL. An outbreak of melioidosis in imported primates in Britain. Vet Rec. 1992; 130(24): 525 - 529. [PubMed: 1279882].
Demontoy-Bomsel and Chove, 1976: Demontoy-Bomsel MC, Chove MA Aspects cliniques de la melioidose dans un zoo. Rec Med Vet. 1976; 152(10): 663 - 669. [PubMed: ].
Dharakul et al., 1999: Dharakul T, Songsivilai S, Smithikarn S, Thepthai C, Leelaporn A. Rapid identification of Burkholderia pseudomallei in blood cultures by latex agglutination using lipopolysaccharide-specific monoclonal antibody. The American Journal of Tropical Medicine and Hygiene. 1999; 61(4): 658 - 662. [PubMed: 10548306].
Egerton, 1963: Egerton JR Melioidosis in a tree climbing kangaroo. Australian Veterinary Journal. 1963; 39(6): 243 - 244. [PubMed: ].
Essex-Lopresti et al., 2005: Essex-Lopresti AE, Boddey JA, Thomas R, Smith MP, Hartley MG, Atkins T, Brown NF, Tsang CH, Peak IR, Hill J, Beacham IR, Titball RW. A type IV pilin, PilA, Contributes To Adherence of Burkholderia pseudomallei and virulence in vivo. Infection and Immunity. 2005; 73(2): 1260 - 1264. [PubMed: 15664977].
Forbes-Faulkner et al., 1992: Forbes-Faulkner JC, Townsend WL, Thomas AD. Pseudomonas pseudomallei infection in camels. Aust Vet J. 1992; 69(6): 148 - . [PubMed: 1642603].
Fritz et al., 1986: Fritz PE, Miller JG, Slayter M, Smith TJ. Naturally occurring melioidosis in a colonized rhesus monkey (Macaca mulatta). Lab Anim. 1986; 20(4): 281 - 285. [PubMed: 3773432].
Funke and Funke-Kissling, 2004: Funke G, Funke-Kissling P. Use of the BD PHOENIX Automated Microbiology System for direct identification and susceptibility testing of gram-negative rods from positive blood cultures in a three-phase trial. J Clin Microbiol. 2004; 42(4): 1466 - 1470. [PubMed: 15070990].
Gan, 2005: Gan YH Interaction between Burkholderia pseudomallei and the host immune response: sleeping with the enemy?. J Infect Dis. 2005; 192(10): 1845 - 1850. [PubMed: 6235187].
Gauthier et al., 2001: Gauthier YP, Hagen RM, Brochier GS, Neubauer H, Splettstoesser WD, Finke EJ, Vidal DR. Study on the pathophysiology of experimental Burkholderia pseudomallei infection in mice. FEMS Immunology and Medical Microbiology. 2001; 30(1): 53 - 63. [PubMed: 11172992].
Hagen et al., 2002: Hagen RM, Gauthier YP, Sprague LD, Vidal DR, Zysk G, Finke EJ, Neubauer H. Strategies for PCR based detection of Burkholderia pseudomallei DNA in paraffin wax embedded tissues. Molecular Pathology. 2002; 55(6): 398 - 400. [PubMed: 12456780].
Heng et al., 1998: Heng BH, Goh KT, Yap EH, Loh H, Yeo M. Epidemiological surveillance of melioidosis in Singapore. Ann Acad Med Singapore. 1998; 27(4): 478 - 484. [PubMed: 9791650].
Hicks et al., 2000: Hicks CL, Kinoshita R, Ladds PW. Pathology of melioidosis in captive marine mammals. Australian Veterinary Journal. 2000; 78(3): 193 - 195. [PubMed: 10860161].
Holden et al., 2004: Holden MT, Titball RW, Peacock SJ, Cerdeno-Tarraga AM, Atkins T, Crossman LC, Pitt T, Churcher C, Mungall K, Bentley SD, Sebaihia M, Thomson NR, Bason N, Beacham IR, Brooks K, Brown KA, Brown NF, Challis GL, Cherevach I, Chillingworth T, Cronin A, Crossett B, Davis P, DeShazer D, Feltwell T, Fraser A, Hance Z, Hauser H, Holroyd S, Jagels K, Keith KE, Maddison M, Moule S, Price C, Quail MA, Rabbinowitsch E, Rutherford K, Sanders M, Simmonds M, Songsivilai S, Stevens K, Tumapa S, Vesaratchavest M, Whitehead S, Yeats C, Barrell BG, Oyston PC, Parkhill J. Genomic plasticity of the causative agent of melioidosis, Burkholderia pseudomallei. Proceedings of the National Academy of Sciences of the United States of America. 2004; 101(39): 14240 - 14245. [PubMed: 15377794].
Holland et al., 2002: Holland DJ, Wesley A, Drinkovic D, Currie BJ. Cystic Fibrosis and Burkholderia pseudomallei Infection: An Emerging Problem?. Clin Infect Dis. 2002; 35(12): e138 - 140. [PubMed: 12471591].
Hoppe et al., 1999: Hoppe I, Brenneke B, Rohde M, Kreft A, Haussler S, Reganzerowski A, Steinmetz I. Characterization of a murine model of melioidosis: comparison of different strains of mice. Infection and Immunity. 1999; 67(6): 2891 - 2900. [PubMed: 10338496].
Howard and Inglis, 2003: Howard K, Inglis TJ. Novel selective medium for isolation of Burkholderia pseudomallei. Journal of Clinical Microbiology. 2003; 41(7): 3312 - 3316. [PubMed: 12843080].
Howard and Inglis, 2005: Howard K, Inglis TJ. Disinfection of Burkholderia pseudomallei in potable water. Water Res. 2005; 39(6): 1085 - 1092. [PubMed: 15766962].
How et al., 2005: How HS, Ng KH, Yeo HB, Tee HP, Shah A. Pediatric melioidosis in Pahang, Malaysia. J Microbiol Immunol Infect. 2005; 38(5): 314 - 319. [PubMed: 16211138].
How et al., 2005: How HS, Ng KH, Yeo HB, Tee HP, Shah A. Pediatric melioidosis in Pahang, Malaysia. J Microbiol Immunol Infect. 2005; 38(5): 314 - 319. [PubMed: 16211138].
Huis in 't Veld et al., 2005: Huis in 't Veld D, Wuthiekanun V, Cheng AC, Chierakul W, Chaowagul W, Brouwer AE, White NJ, Day NP, Peacock SJ. The role and significance of sputum cultures in the diagnosis of melioidosis. Am J Trop Med Hyg. 2005; 73(4): 657 - 661. [PubMed: 16222004].
Ileri, 1965: Ileri SZ The indirect haemagglutination test in the diagnosis of melioidosis in goats. Br Vet J. 1965; 121(): 164 - 170. [PubMed: 14306014].
Inglis et al., 1998: Inglis TJ, Garrow SC, Adams C, Henderson M, Mayo M. Dry-season outbreak of melioidosis in Western Australia. Lancet. 1998; 352(9140): 1600 - 1600. [PubMed: 9843113].
Inglis et al., 1999: Inglis TJ, Garrow SC, Adams C, Henderson M, Mayo M, Currie BJ. Acute melioidosis outbreak in Western Australia. Epidemiol Infect. 1999; 123(3): 437 - 443. [PubMed: 10694154].
Inglis et al., 2000: Inglis TJ, Inglis TJ, Garrow SC, Henderson M, Clair A, Sampson J, O'Reilly L, Cameron B. Burkholderia pseudomallei traced to water treatment plant in Australia. Emerg Infect Dis. 2000; 6(1): 56 - 59. [PubMed: 10653571].
Inglis et al., 2000: Inglis TJ, Rigby P, Robertson TA, Dutton NS, Henderson M, Chang BJ. Interaction between Burkholderia pseudomallei and Acanthamoeba species results in coiling phagocytosis, endamebic bacterial survival, and escape. Infect Immun. 2000; 68(3): 1681 - 1686. [PubMed: 10678988].
Inglis et al., 2003: Inglis TJ, Robertson T, Woods DE, Dutton N, Chang BJ. Flagellum-mediated adhesion by Burkholderia pseudomallei precedes invasion of Acanthamoeba astronyxis. Infect Immun. 2003; 71(4): 2280 - 2282. [PubMed: 12654857].
Inglis et al., 2005: Inglis TJ, Merritt A, Chidlow G, Aravena-Roman M, Harnett G. Comparison of diagnostic laboratory methods for identification of Burkholderia pseudomallei. J Clin Microbiol. 2005; 43(5): 2201 - 2206. [PubMed: 15872242].
Inglis et al., 2005: Inglis TJ, Merritt A, Chidlow G, Aravena-Roman M, Harnett G. Comparison of diagnostic laboratory methods for identification of Burkholderia pseudomallei. J Clin Microbiol. 2005; 43(5): 2201 - 2206. [PubMed: 15872242].
Issack et al., 2005: Issack MI, Bundhun CD, Gokhool H. Melioidosis in Mauritius. Emerg Infect Dis. 2005; 11(1): 139 - 140. [PubMed: 15705340].
Janmaat et al., 2004: Janmaat A, Choy JL, Currie BJ. Melioidosis in an alpaca (Lama pacos). Aust Vet J. 2004; 82(10): 622 - 623. [PubMed: 15887386].
Jeddeloh et al., 2003: Jeddeloh JA, Fritz DL, Waag DM, Hartings JM, Andrews GP. Biodefense-driven murine model of pneumonic melioidosis. Infection and Immunity. 2003; 71(1): 584 - 587. [PubMed: 12496217].
Jenney et al., 2001: Jenney AW, Lum G, Fisher DA, Currie BJ. Antibiotic susceptibility of Burkholderia pseudomallei from tropical northern Australia and implications for therapy of melioidosis. International Journal of Antimicrobial Agents. 2001; 17(2): 109 - 113. [PubMed: 11165114].
Kaufmann et al., 1970: Kaufmann AF, Alexander AD, Allen AM, Cronin RJ, Dillingham LA, Douglas JD, Moore TD. Melioidosis in imported non-human primates. Journal of Wildlife Diseases. 1970; 6(): 211 - 219. [PubMed: ].
Ladds et al., 1990: Ladds PW, Thomas AD, Speare R, Brown AS. Melioidosis in a koala. Aust Vet J. . 1990; 67(8): 304 - 305. [PubMed: 2222378].
Lee et al., 2005: Lee MA, Wang D, Yap EH. Detection and differentiation of Burkholderia pseudomallei, Burkholderia mallei and Burkholderia thailandensis by multiplex PCR. FEMS Immunology and Medical Microbiology. 2005; 43(3): 413 - 417. [PubMed: 15708316].
Leelarasamee, 1998: Leelarasamee A. Burkholderia pseudomallei: the unbeatable foe?. Southeast Asian Journal of Tropical Medicine and Public Health. 1998; 29(2): 410 - 415. [PubMed: 9886137].
Leelarasamee, 2000: Leelarasamee A. Melioidosis in Southeast Asia. Acta Tropica. 2000; 74(2-3): 129 - 132. [PubMed: 10674640].
Leelarasamee, 2004: Leelarasamee A Recent development in melioidosis. Curr Opin Infect Dis. 2004; 17(2): 131 - 136. [PubMed: 15021053].
Leelarasamee, 2004: Leelarasamee A. Recent development in melioidosis. Current Opinion in Infectious Diseases. 2004; 17(2): 131 - 136. [PubMed: 15021053].
Lim and Tan, 1967: Lim SY, Tan BE. Actinobacillus whitmori isolated from a parrot. Kajian Veterinaire. 1967; I(1): 44 - 48. [PubMed: ].
Ling et al., 2003: Ling TK, Liu ZK, Cheng AF. Evaluation of the VITEK 2 system for rapid direct identification and susceptibility testing of gram-negative bacilli from positive blood cultures. J Clin Microbiol. 2003; 41(10): 4705 - 4707. [PubMed: 14532207].
Liu et al., 2002: Liu Y, Wang D, Yap EH, Yap E, Lee MA. Identification of a novel repetitive DNA element and its use as a molecular marker for strain typing and discrimination of ara- from ara+ Burkholderia pseudomallei isolates. J Med Microbiol. 2002; 51(1): 76 - 82. [PubMed: 11800476].
Liu et al., 2005: Liu Y, Loh JP, Aw LT, Yap EP, Lee MA, Ooi EE. Rapid molecular typing of Burkholderia pseudomallei, isolated in an outbreak of melioidosis in Singapore in 2004, based on variable-number tandem repeats. Trans R Soc Trop Med Hyg. 2005; Dec 9(): Epub ahead of print - . [PubMed: 16343569].
Lowe et al., 2002: Lowe P, Engler C, Norton R. Comparison of automated and nonautomated systems for identification of Burkholderia pseudomallei. Journal of Clinical Microbiology. 2002; 40(12): 4625 - 4627. [PubMed: 12454163].
Luo et al., 2003: Luo CY, Ko WC, Lee HC, Yang YJ. Relapsing melioidosis as cause of iliac mycotic aneurysm: an indigenous case in Taiwan. Journal of Vascular Surgery. 2003; 37(4): 882 - 885. [PubMed: 12663992].
MacKnight et al., 1990: MacKnight K, Chow D, See B, Vedros N. Melioidosis in a macaroni penguin Eudyptes chrysolophus. Disease of Aquatic Organisms. 1996; 9(): 105 - 107. [PubMed: ].
McCormick et al., 1975: McCormick JB, Sexton DJ, McMurray JG, Carey E, Hayes P, Feldman RA. Human-to-human transmission of Pseudomonas pseudomallei. Annals of Internal Medicine. 1975; 83(4): 512 - 513. [PubMed: 1174405].
McGovern et al., 1999: McGovern TW, Christopher GW, Eitzen EM. Cutaneous manifestations of biological warfare and related threat agents. Arch Dermatol. 1999; 135(3): 311 - 322. [PubMed: 10086453].
Mollaret, 1988: Mollaret HH L'Affaire du jardin des plantes. Medicine et Maladies Infectieuses. 1988; (Special Novembre)(): 643 - 654. [PubMed: ].
Moore et al., 2004: Moore RA, Reckseidler-Zenteno S, Kim H, Nierman W, Yu Y, Tuanyok A, Warawa J, DeShazer D, Woods DE. Contribution of gene loss to the pathogenic evolution of Burkholderia pseudomallei and Burkholderia mallei. Infection and Immunity. 2004; 72(7): 4172 - 4187. [PubMed: 15213162].
Mukhopadhyay et al., 2004: Mukhopadhyay A, Lee KH, Tambyah PA. Bacteraemic melioidosis pneumonia: impact on outcome, clinical and radiological features. J Infect. 2004; 48(4): 334 - 338. [PubMed: 15066335].
Mutalib et al., 1984: Mutalib AR, Sheikh-Omar AR, Zamri M. Melioidosis in a banded leaf-monkey (Presbytis melalophos). Vet Rec. 1984; 115(17): 438 - 439. [PubMed: 6506434].
Na-ngam et al., 2004: Na-ngam N, Angkititakul S, Noimay P, Thamlikitkul V. The effect of quicklime (calcium oxide) as an inhibitor of Burkholderia pseudomallei. Transactions of the Royal Society of Tropical Medicine and Hygiene. 2004; 98(6): 337 - 341. [PubMed: 15099988].
Neubauer et al., 2005: Neubauer H, Sprague LD, Zacharia R, Tomaso H, Al Dahouk S, Wernery R, Wernery U, Scholz HC. Serodiagnosis of Burkholderia mallei infections in horses: state-of-the-art and perspectives. J Vet Med B Infect Dis Vet Public Health. 2005; 52(5): 201 - 205. [PubMed: 16115091].
Nouvel et al., 1976: Nouvel MMJ, Dodin A, Demontoy MC, Chove MA La melioidose a la menagerie du Jardin des Plantes de Paris. Bull Acad Vet de France. 1976; 49(): 223 - 230. [PubMed: ].
O'Brien et al., 2004: O'Brien M, Freeman K, Lum G, Cheng AC, Jacups SP, Currie BJ. Further evaluation of a rapid diagnostic test for melioidosis in an area of endemicity. Journal of Clinical Microbiology. 2004; 42(5): 2239 - 2240. [PubMed: 15131200].
Parry et al., 1999: Parry CM, Wuthiekanun V, Hoa NT, Diep TS, Thao LT, Loc PV, Wills BA, Wain J, Hien TT, White NJ, Farrar JJ. Melioidosis in Southern Vietnam: clinical surveillance and environmental sampling. Clin Infect Dis. 1999; 29(5): 1323 - 1326. [PubMed: 10524986].
Peacock et al., 2005: Peacock SJ, Chieng G, Cheng AC, Dance DA, Amornchai P, Wongsuvan G, Teerawattanasook N, Chierakul W, Day NP, Wuthiekanun V. Comparison of Ashdown's medium, Burkholderia cepacia medium, and Burkholderia pseudomallei selective agar for clinical isolation of Burkholderia pseudomallei. J Clin Microbiol. 2005; 43(10): 5359 - 5361. [PubMed: 16208018].
Pongsunk et al., 1999: Pongsunk S, Thirawattanasuk N, Piyasangthong N, Ekpo P. Rapid identification of Burkholderia pseudomallei in blood cultures by a monoclonal antibody assay. Journal of Clinical Microbiology. 1999; 37(11): 3662 - 3667. [PubMed: 10523570].
Powell et al., 2003: Powell K, Ulett G, Hirst R, Norton R. G-CSF immunotherapy for treatment of acute disseminated murine melioidosis. FEMS Microbiology Letters. 2003; 224(2): 315 - 318. [PubMed: 12892898].
Ralph et al., 2004: Ralph A, McBride J, Currie BJ. Transmission of Burkholderia pseudomallei via breast milk in northern Australia. The Pediatric Infectious Disease Journal. 2004; 23(12): 1169 - 1171. [PubMed: 15626961].
Retnasabapathy and Joseph, 1966: Retnasabapathy A, Joseph PG. A case of melioidosis in a macaque monkey. Vet Rec. 1966; 79(3): 72 - 73. [PubMed: 4959292].
Rolim, 2005: Rolim DB. Melioidosis, northeastern Brazil. Emerg Infect Dis. 2005; 11(9): 1458 - 1460. [PubMed: 16229782].
Samuel and Ty, 2002: Samuel M, Ti TY. Interventions for treating melioidosis. Cochrane Database Syst Rev. 2002; (4): CD001263 - . [PubMed: 12519552].
Saroja, 1979: Saroja S Melioidosis in wallabies. Aust Vet J. 1979; 55(9): 439 - 440. [PubMed: 543838].
Sheikh-Omar and Muda, 1986: Sheikh-Omar AR, Muda H. Melioidosis in Sika deer (Cervus nippon nippon). Aust Vet J. 1986; 63(5): 168 - . [PubMed: 3753349].
Sirisinha et al., 1998: Sirisinha S, Anuntagool N, Intachote P, Wuthiekanun V, Puthucheary SD, Vadivelu J, White NJ. Antigenic differences between clinical and environmental isolates of Burkholderia pseudomallei. Microbiology and immunology. 1998; 42(11): 731 - 737. [PubMed: 9886145].
Siritapetawee et al., 2004: Siritapetawee J, Prinz H, Krittanai C, Suginta W. Expression and refolding of Omp38 from Burkholderia pseudomallei and Burkholderia thailandensis, and its function as a diffusion porin. The Biochemical Journal. 2004; 384(Pt3): 609 - 617. [PubMed: 15329048].
Smith and Damit, 1982: Smith NR, Damit M. Fatal bronchopneumonia in a young orangutan caused by Pseudomonas pseudomallei. Vet Rec. 1982; 110(11): 251 - 251. [PubMed: 7080412].
Smith et al., 1997: Smith MD, Angus BJ, Wuthiekanun V, White NJ. Arabinose assimilation defines a nonvirulent biotype of Burkholderia pseudomallei. Infection and Immunity. 1997; 65(10): 4319 - 4321. [PubMed: 9317042].
Sonthayanon et al., 2002: Sonthayanon P, Krasao P, Wuthiekanun V, Panyim S, Tungpradabkul S. A simple method to detect and differentiate Burkholderia pseudomallei and Burkholderia thailandensis using specific flagellin gene primers. Molecular and Cellular Probes. 2002; 16(3): 217 - 222. [PubMed: 12144773].
Sprague and Neubauer, 2004: Sprague LD, Neubauer H. Melioidosis in animals: a review on epizootiology, diagnosis and clinical presentation. Journal of Veterinary Medicine. B, Infectious Diseases and Veterinary Public Health. 2004; 51(7): 305 - 320. [PubMed: 15525357].
Steinmetz et al., 1999: Steinmetz I, Reganzerowski A, Brenneke B, Haussler S, Simpson A, White NJ. Rapid identification of Burkholderia pseudomallei by latex agglutination based on an exopolysaccharide-specific monoclonal antibody. Journal of Clinical Microbiology. 1999; 37(1): 225 - 228. [PubMed: 9854098].
Stevens et al., 2004: Stevens MP, Haque A, Atkins T, Hill J, Wood MW, Easton A, Nelson M, Underwood-Fowler C, Titball RW, Bancroft GJ, Galyov EE. Attenuated virulence and protective efficacy of a Burkholderia pseudomallei bsa type III secretion mutant in murine models of melioidosis. Microbiology. 2004; 150(Pt 8): 2669 - 2676. [PubMed: 15289563].
Strauss et al., 1969: Strauss JM, Jason S, Lee H, Gan E. Melioidosis with spontaneous remission of osteomyelitis in a macaque (Macaca nemestrina). J Am Vet Med Assoc. 1969; 155(7): 1169 - 1175. [PubMed: 4981371].
Suputtamongkol et al., 1991: Suputtamongkol Y, Dance DA, Chaowagul W, Wattanagoon Y, Wuthiekanun V, White NJ. Amoxycillin-clavulanic acid treatment of melioidosis. Trans R Soc Trop Med Hyg. 1991; 85(5): 672 - 675. [PubMed: 1781006].
Thepthai et al., 2001: Thepthai C, Dharakul T, Smithikarn S, Trakulsomboon S, Songsivilai S. Differentiation between non-virulent and virulent Burkholderia pseudomallei with monoclonal antibodies to the Ara+ or Ara- biotypes. The American Journal of Tropical Medicine and Hygiene. 2001; 65(1): 10 - 12. [PubMed: 11504398].
Thibault et al., 2004: Thibault FM, Hernandez E, Vidal DR, Girardet M, Cavallo JD. Antibiotic susceptibility of 65 isolates of Burkholderia pseudomallei and Burkholderia mallei to 35 antimicrobial agents. The Journal of Antimicrobial Chemotherapy. 2004; 54(6): 1134 - 1138. [PubMed: 15509614].
Thomas et al., 1978: Thomas AD, Wilson AJ, Aubrey JN. Melioidosis in a sulphur-crested cockatoo (Cacatua galerita). Australian Veterinary Journal. 1978; 54(6): 306 - 307. [PubMed: 687299].
Thomas et al., 1980: Thomas AD, Norton JH, Pott BW. Melioidosis in a galah (Cacatua roseicapilla). Australian Veterinary Journal. 1980; 56(4): 192 - 193. [PubMed: 7436921].
Tomaso et al., 2005: Tomaso H, Pitt TL, Landt O, Al Dahouk S, Scholz HC, Reisinger EC, Sprague LD, Rathmann I, Neubauer H. Rapid presumptive identification of Burkholderia pseudomallei with real-time PCR assays using fluorescent hybridization probes. Molecular and Cellular Probes. 2005; 19(1): 9 - 20. [PubMed: 15652215].
Vadivelu et al., 1997: Vadivelu J, Puthucheary SD, Mifsud A, Drasar BS, Dance DA, Pitt TI. Ribotyping and DNA macrorestriction analysis of isolates of Burkholderia pseudomallei from cases of melioidosis in Malaysia. Trans R Soc Trop Med Hyg. 1997; 91(3): 358 - 360. [PubMed: 9231217].
von Kruedener et al., 1984: von Kruedener R, Lingelbach W, Rietschel W Vorkommen und Diagnose Von Melioidose beim Tier in Sudostasiatischen Landern. Giessener Beitrage zur Entwicklungsforschung. Reihe 1. 1984; 10(): 117 - 124. [PubMed: ].
White, 2003: White NJ. Melioidosis. Lancet. 2003; 361(9370): 1715 - 1722. [PubMed: 12767750].
Wongratanacheewin et al., 2000: Wongratanacheewin S, Komutrin K, Sermswan RW. Use of multiplex PCR patterns as genetic markers for Burkholderia pseudomallei. Acta Tropica. 2000; 74(2-3): 193 - 198. [PubMed: 10674649].
Wongratanacheewin et al., 2004: Wongratanacheewin S, Kespichayawattana W, Intachote P, Pichyangkul S, Sermswan RW, Krieg AM, Sirisinha S. Immunostimulatory CpG oligodeoxynucleotide confers protection in a murine model of infection with Burkholderia pseudomallei. Infection and Immunity. 2004; 72(8): 4494 - 4502. [PubMed: 15271908].
Wuthiekanun et al., 2005A: Wuthiekanun V, Desakorn V, Wongsuvan G, Amornchai P, Cheng AC, Maharjan B, Limmathurotsakul D, Chierakul W, White NJ, Day NP, Peacock SJ. Rapid immunofluorescence microscopy for diagnosis of melioidosis. Clinical and Diagnostic Laboratory Immunology. 2005; 12(4): 555 - 556. [PubMed: 15817767].
Wuthiekanun et al., 2005B: Wuthiekanun V, Mayxay M, Chierakul W, Phetsouvanh R, Cheng AC, White NJ, Day NP, Peacock SJ. Detection of Burkholderia pseudomallei in soil within the Lao People's Democratic Republic. J Clin Microbiol. 2005; 43(2): 923 - 924. [PubMed: 15695707].
Yang, 2000: Yang S. Melioidosis research in China. Acta Trop. 2000; 77(2): 157 - 165. [PubMed: 11080506].
Yang et al., 1998: Yang S, Tong S, Mo C, Jiang Z, Yang S, Ma Y, Lu Z. Prevalence of human melioidosis on Hainan Island in China. Microbiol Immunol. 1998; 42(9): 651 - 654. [PubMed: 9802565].
Yap et al., 1995: Yap EH, Thong TW, Tan AL, Yeo M, Tan HC, Loh H, Teo TP, Thong KT, Singh M, Chan YC. Comparison of Pseudomonas pseudomallei from humans, animals, soil and water by restriction endonuclease analysis. Singapore Med J. 1995; 36(1): 60 - 62. [PubMed: 7570138].
B. Book References:
Babjee and Nor Aidah, 1994: Babjee AM, Nor Aidah AR Melioidosis in animals. 112 - 121. In: Puthucheary SD, Malik YA Melioidosis: Prevailing Problems and Future Directions1994. SP-Muda Printing Sdn., Kuala Lumpur.
Currie, 2005: Currie BJ Burkholderia pseudomallei and Burkholderia mallei: Melioidosis and Glanders. 2622 - 2632. In: Mandell GL, Bennett JE, Dolin R Principles and Practice of Infectious Diseases2005. Elsevier, Philadelphia PA.
De Shazer and Woods, 1999: De Shazer D, Woods DE Animal Models of Melioidosis. 199 - 203. In: Zak O, Sande M Handbook of animal Models of Infection1999. Academic Press, London, UK.
Ehrenpreis and Ehrenpreis, 2001: Ehrenpreis S, Ehrenpreis E - . In: Ehrenpreis S, Ehrenpreis E Clinician's Handbook of Prescription Drugs2001. McGraw Hill, New York.
Vellayan, 1994: Vellayan S Melioidosis in zoo animals in Malaysia. 123 - 123. In: Puthucheary SD, Malik YA Melioidosis: Prevailing Problems and Future Directions1994. SP-Muda Printing Sdn., Kuala Lumpur.
Yabuuchi et al., 1994: Yabuuchi E, Kosaoko Y, Oyaizu H, Yano I, Ezaki T Burkholderia gen.nov and 7 species comb.nov with the type species Burkholderia cepacia. 1 - 7. In: Puthucheary SD, Malik YA Melioidosis: Prevailing Problems and Future Directions1994. SP-Muda Printing Sdn., Kuala Lumpur.
C. Website References:
CDC: BMBL Section VII: BMBL Section VII: Agent Summary Statements Section VII-A: Bacterial Agents [ http://www.cdc.gov/od/ohs/biosfty/bmbl4/bmbl4s7a.htm ].
CDC: Melioidosis: Melioidosis (Burkholderia pseudomallei) [ http://www.cdc.gov/ncidod/dbmd/diseaseinfo/melioidosis_g.htm ].
NCBI Taxonomy: Burkholderia pseudomallei [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=28450&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: B. pseudomallei (Ara+ biotype) [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=95163&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: B. pseudomallei K96243 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=272560&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Homo Sapiens [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9606&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Ovis aries [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9940&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Capra hircus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9925&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Bos taurus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9913&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Sus scrofa [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9823&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Equus caballus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9796&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Canis familiaris [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9615&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Felis catus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9685&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Camelus dromedarius [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9838&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Cervus nippon nippon [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=92867&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Dama dama [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=30532&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Macropus sp. [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9322&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Phascolarctos cinereus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=38626&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Psittacus erithacus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=57247&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Cacatua galerita [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=141274&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Pseudorca crassidens [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=82174&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Orcinus orca [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9733&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Tursiops truncatus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9739&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Lagenorhynchus obliquidens [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=90247&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Zalophus californianus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9704&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Halichoerus grypus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9711&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Animals [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=33208&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: B. pseudomallei 1710a [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=320371&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: B. pseudomallei 1710b [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=320372&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: B. pseudomallei 668 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=320373&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: B. pseudomallei S13 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=320374&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Genome: NCBI. Chromosome1 [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=53717639 ].
NCBI Genome: NCBI. Chromosome2 [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=53721039 ].
NCBI Taxonomy: Eolophus roseicapillus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=176039&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Gorilla gorilla [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9593&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Pan troglodytes [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9598&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Presbytis melalophos [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=78451&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Macaca [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9539&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Macaca nemestrina [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9545&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Macaca mulatta [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9544&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Pongo pygmaeus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9600&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Burkholderia pseudomallei 1106a [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=357348&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI 1106a Sequencing Project: Burkholderia pseudomallei 1106a project at TIGR [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=16182 ].
NCBI Taxonomy: Burkholderia pseudomallei 1106b [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=357347&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI 1106b Sequencing Project: Burkholderia pseudomallei 1106b project at TIGR [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=16181 ].
NCBI Taxonomy: Burkholderia pseudomallei 1655 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=331109&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI 1655 Sequencing Project: Burkholderia pseudomallei 1655 project at TIGR [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=13949 ].
NCBI 1710a Sequencing Project: Burkholderia pseudomallei 1710a project at TIGR [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=13950 ].
NCBI 1710b Sequencing Project: Burkholderia pseudomallei 1710b project at TIGR [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=13954 ].
NCBI 668 Sequencing Project: Burkholderia pseudomallei 668 project at TIGR [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=13953 ].
NCBI K96243 Sequencing Project: Burkholderia pseudomallei K96243 project at Sanger Institute [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=178 ].
NCBI Taxonomy: Burkholderia pseudomallei Pasteur [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=331978&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Pasteur Sequencing Project: Burkholderia pseudomallei Pasteur project at TIGR [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=13952 ].
NCBI S13 Sequencing Project: Burkholderia pseudomallei S13 project at TIGR [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=13951 ].
NCBI Genome Sequence: Burkholderia pseudomallei 1106a, unfinished sequence, whole genome shotgun sequence [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi??db=nucleotide&val=NZ_AAMA00000000 ].
NCBI Genome Sequence: Burkholderia pseudomallei 1106b, unfinished sequence, whole genome shotgun sequence [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi??db=nucleotide&val=NZ_AAMB00000000 ].
NCBI Genome Sequence: Burkholderia pseudomallei 1655, unfinished sequence, whole genome shotgun sequence [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi??db=nucleotide&val=NZ_AAHR00000000 ].
NCBI Genome Sequence: Burkholderia pseudomallei 1710a, unfinished sequence, whole genome shotgun sequence [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi??db=nucleotide&val=NZ_AAHS00000000 ].
NCBI Genome Sequence: Burkholderia pseudomallei 1710b chromosome I, complete sequence [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi??db=nucleotide&val=NC_007434 ].
NCBI Genome Sequence: Burkholderia pseudomallei 1710b chromosome II, complete sequence [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi??db=nucleotide&val=NC_007435 ].
NCBI Genome Sequence: Burkholderia pseudomallei 668, unfinished sequence, whole genome shotgun sequencing project [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi??db=nucleotide&val=NZ_AAHU00000000 ].
NCBI Genome Sequence: Burkholderia pseudomallei Pasteur, unfinished sequence, whole genome shotgun sequencing project [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi??db=nucleotide&val=NZ_AAHV00000000 ].
NCBI Genome Sequence: Burkholderia pseudomallei S13, unfinished sequence, whole genome shotgun sequence [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi??db=nucleotide&val=NZ_AAHW00000000 ].
NCBI Taxonomy: Capricornis sumatrensis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=34865&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Camelus dromedarius [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9838&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Brachyteles arachnoides [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=30594&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Hylobates lar [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9580&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Macaca arctoides [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9540&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Mandrillus sphinx [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9561&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Casuarius [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=8786&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Probosciger aterrimus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=141839&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Macropus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9312&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Dendrolagus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=38603&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Amazona albifrons [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=241569&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Eudyptes chrysolophus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=79627&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Lama pacos [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=30538&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Equus burchellii [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9790&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Equus zebra [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9791&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Bubalus bubalis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=89462&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Equus przewalskii [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9798&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Ovis canadensis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=37174&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Ovis vignei [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=59896&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Ovis aries musimon [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9938&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Redunca redunca [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=59556&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Cervus nippon [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9863&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Muntiacus muntjak [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9888&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Erythrocebus patas [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9538&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Cercopithecus aethiops [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9534&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Cereopsis novaehollandiae [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=8858&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Euphractus sexcinctus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=143300&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Ailuropoda melanoleuca [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9646&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Macaca fascicularis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9541&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
TIGR Sequencing Project: B. pseudomallei Genome Project [ http://www.tigr.org/msc/b_pseudomallei/index.shtml ].
Website 25: NCBI. Primates [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9443 ].
Website 26: NCBI. Rodents [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9989 ].
Website 42: NCBI. Burkholderia pseudomallei Genome [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=178 ].
Website 43: CDC. Melioidosis in New Caledonia [ http://www.cdc.gov/ncidod/EID/vol11no10/05-0823.htm ].
Website 61: Gram Negative Bacteria [ http://www.asm.org/Division/c/gramneg.htm ].
D. Thesis References:

No thesis or dissertation references used.


VI. Curation Information