Salmonella spp.

I. Organism Information

A. Taxonomy Information
  1. Species:
    1. Salmonella enterica :
      1. Ontology: UMLS:C0995377
      2. GenBank Taxonomy No.: 28901
      3. Description: In 1885, pioneering American veterinary scientist, Daniel E. Salmon, discovered the first strain of Salmonella from the intestine of a pig. This strain was called Salmonella choleraesuis, the designation that is still used to describe the genus and species of this common human pathogen. Salmonella are a type of bacteria that causes typhoid fever and many other infections of intestinal origin. Typhoid fever, rare in the U.S., is caused by a particular strain designated Salmonella typhi. But illness due to other Salmonella strains, just called "salmonellosis," is common in the U.S. Today, the number of known strains (technically termed "serotypes" or "serovars") of these bacteria total over 2300 (Website2).
      4. Variant(s):
        • Salmonella enterica serovar Typhi. :
          • GenBank Taxonomy No.: 90370
          • Description: This bacterium is the causative agent of typhoid fever. Although typhoid fever is not widespread in the United States, it is very common in under-developed countries, and causes a serious, often fatal disease. The symptoms of typhoid fever include nausea, vomiting, fever and death (Website3).
B. Lifecycle Information :
  1. Salmonella lifecycle one stage (Krieg and Holt, 1984, Website4, Website5, Website9):
    1. Shape: Salmonella cells are rod-shaped.
    2. Picture(s):
      1. SEM Image of Salmonella typhi (Website 53):



        Description: Scanning Electron Micrograph of Salmonella typhi - Gram-negative, enteric, rod prokaryote (dividing); causes typhoid fever. Magnification: x3,220.
      2. SEM Image of Salmonella enteritidis (Website 53):



        Description: Scanning Electron Micrograph of Salmonella enteritidis - Gram-negative, enteric, rod prokaryote (dividing); note the flagella. This zoonotic microorganism causes salmonellosis (food poisoning) in humans when infected fowl, domestic mammals or turtles contaminate milk, eggs, meat, poultry or shellfish (which humans ingest). Magnification: x2,750.
      3. SEM Image of Salmonella typhimurium (Website 53):



        Description: Scanning Electron Micrograph of Salmonella typhimurium - Gram-negative, enteric, DT104, rod prokaryote (dividing); note the flagella. Zoonotic microorganism causing salmonellosis (food poisoning) in humans when infected fowl, domestic mammals or turtles contaminate milk, eggs, meat, poultry or shellfish (which humans ingest). Magnification: x3,200.
    3. Other:
      1. Salmonella Salmonella cells are gram-negative bacilli. Salmonella cells are flagellated, facultatively anaerobic and nonsporeforming bacteria.
C. Genome Summary:
  1. Genome of Salmonella enterica
    1. Salmonella Chromosome:
      1. GenBank Accession Number: AE006468
      2. Size: 4,857kb (McClelland et al., 2001, Website34).
      3. Gene Count: 4,330 open reading frames (McClelland et al., 2001).
      4. Description: The chromosomes of enteric bacteria are mosaics, composed of colinear regions interspersed with 'loops' or 'islands' unique to certain species; the islands sometimes encode pathogenicity functions (called Salmonella pathogenicity islands, SPIs) (McClelland et al., 2001).
    2. Salmonella Plasmid pSLT:
      1. GenBank Accession Number: NC_003277
      2. Size: 94 kb (McClelland et al., 2001, Website35).
      3. Description: Salmonella enterica serovar typhimurium LT2 plasmid pSLT (McClelland et al., 2001, Website35).

  2. Genome of Salmonella enterica serovar Typhi.
    1. S_typhi Chromosome:
      1. GenBank Accession Number: AL513382
      2. Size: 4,809 kb (Parkhil et al., 2001, Website36).
      3. Description: S. typhi has hundreds of insertions and deletions, ranging in size from single genes to large islands. The genome sequence identifies over two hundred pseudogenes, several corresponding to genes that are known (Parkhil et al., 2001).
    2. S_typhi Plasmid pHCM1:
      1. GenBank Accession Number: NC_003384
      2. Size: 218160 bp (Parkhil et al., 2001).
      3. Description: Salmonella enterica serovar Typhi plasmid pHCM1 (Parkhil et al., 2001, Website37).
    3. S_typhi Plasmid pHCM2:
      1. GenBank Accession Number: NC_003385
      2. Size: 106516 bp (Parkhil et al., 2001).
      3. Description: Salmonella enterica serovar Typhi plasmid pHCM2 (Parkhil et al., 2001, Website38).

II. Epidemiology Information

A. Outbreak Locations:
  1. Salmonella causes typhoid fever and other infections of intestinal origin. Typhoid fever, rare in the U.S., is caused by a particular strain designated Salmonella typhi. But illness due to Salmonella typhimurium, just called "salmonellosis," is common in the U.S. Non-typhoidal salmonellosis is a worldwide disease of humans and animals (Website8, Website9).
B. Transmission Information:
  1. From: Homo sapiens To: Homo sapiens
    Mechanism: Individuals who carry Salmonella in their intestines may transmit Salmonella to another individual if good personal hygiene is not followed. For example, an infected food handler may transmit Salmonella bacteria if he/she does not wash his/her hands after using the bathroom and before handling or preparing food (Website11).

  2. From: Gallus gallus To: Homo sapiens
    Mechanism: Salmonella bacteria live in the intestinal tracts of humans and birds, and are transmitted by the oral-fecal route. This means eating foods contaminated with feces. Contaminated foods usually look and smell normal. Contaminated food often originates from poultry, poultry products, or wild birds (Website11).

C. Environmental Reservoir:
  1. Environmental Reservoir - Rural :
    1. Description: Rural areas represent a dangerous reservoir of disease, a particular threat to the nation's agriculturally dependent urban populations. Most countries need a more comprehensive public health system that addresses urban and rural problems (Casner, 2001).
    2. Survival Information: Salmonella can certainly survive, but may not actively grow, in many environmental waters. As Salmonella bacteria are present in the faeces of humans and birds they are often present in faecally polluted waters. SURVIVAL OUTSIDE HOST: Ashes - 130 days; rabbit carcass - 17 days; dust - up to 30 days; feces - up to 62 days; linoleum floor - 10 hours; ice - 240 days; skin - 10-20 min (Website12).
D. Intentional Releases:
  1. Intentional Release information :
    1. Description: Salmonella infection
    2. Emergency contact: If you believe that you have been exposed to a biological or chemical agent, or if you believe an intentional biological threat will occur or is occurring, contact your local health department and/or your local police or other law enforcement agency. CDC Emergency Response Hotline (24 hours) 770-488-7100. Call communicable disease epidemiology 206-361-2914 or the food program 360-586-1249. Call USDA's Meat and Poultry Hotline at 1-800-535-4555, 10 a.m. to 4 p.m., Eastern Time. In the Washington, DC area, call (202) 720-3333. TTY: 1-800-256-7072 (Website6, Website7).

III. Infected Hosts

  1. Human and Poultry:
    1. Taxonomy Information:
      1. Species:
        1. Human :
          • GenBank Taxonomy No.: 9606
          • Scientific Name: Homo sapiens (Website32)
          • Description: S. typhi can only infect humans, and no other host has been identified. The main source of S. typhi infection is from swallowing infected water. Food may also be contaminated with S. typhi, if it is washed or irrigated with contaminated water (Website3).
        2. Poultry_chicken :
          • GenBank Taxonomy No.: 9031
          • Scientific Name: Gallus gallus (Website33)
          • Description: Gallus gallus (chiken) (Website33)

    2. Infection Process:
      1. Infectious Dose: More 100,000 cells; variable with gastric acidity and size of inoculum (Website16)
      2. Description: People are most often infected by eating or drinking contaminated food or water or by contact with infected people, birds or animals. Salmonellosis is typically a food-borne illness acquired from contaminated raw poultry, eggs, and unpasteurized milk and cheese products. Other sources of exposure include contact with infected poultry and animals. Anyone who is exposed to Salmonella bacteria can get salmonellosis, but it is most commonly recognized in children, the elderly, and people with a weakened immune system (Website13).

    3. Disease Information:
      1. Salmonellosis/Diarrhea :
        1. Pathogenesis Mechanism: Salmonella pathogenesis is initiated by oral ingestion and penetration into the intestinal epithelium before induction of disease. Invasion into the host intestinal cells results in dramatic morphologic changes to the cell that are due to exploitation of the host cytoskeleton. Once in close contact with the epithelium, Salmonella induce degeneration of enterocyte microvilli. Loss in microvillar structure is followed by profound membrane ruffling localized to the area of bacterial-host cell contact. Membrane ruffling is accompanied by profuse macropinocytosis, which leads to the internalization of bacteria into the host cells. When the entire process is completed, Salmonella resides within membrane-bound vesicles, and the cytoskeleton returns to its normal distribution (Goosney et al., 1999).


        2. Incubation Period: The incubation period for Salmonella (food poisoning) depends on the dose of bacteria. Symptoms usually begin 6 to 48 hours after ingestion of contaminated food or water (Website9).


        3. Prognosis: This is generally a self-limiting illness. Most people are treated on an outpatient basis. Those who are immunocompromised or who are aged at the extremes of life may have significant morbidity and mortality. Small children, the elderly, and others with severe diarrhea should see a doctor (Website17).


        4. Diagnosis Overview: The diagnosis of salmonellosis requires bacteriologic isolation of the organisms from appropriate faecal specimens (Website9).


        5. Symptom Information :
          • Salmonella Infection Symptoms:
            • Description: Gastroenteritis: The incubation period is from 8-48 hours. It begins with nausea and vomiting and progresses to abdominal cramping and diarrhea, which may be bloody. One half of patients have a temperature higher than 38.9 degrees celcius (103 to 104 degrees fahrenheit). Other patients have mild abdominal tenderness or signs consistent with peritonitis. Gross or occult blood may be found on rectal examination. Enteric fever: The incubation period of enteric fever is 1-2 weeks. Fever usually begins 1 week postexposure. It may elevate in a characteristic stepwise manner for 4-5 days before leveling off. Malaise, anorexia, myalgia, arthralgia, cough, sore throat, and headache may follow. After 1 week, untreated patients have worsening of the above symptoms and mental confusion. A bradycardia out of proportion to the fever may be noted. Hepatosplenomegaly is found occasionally. Rose spots may appear typically on the anterior chest wall. They are slightly raised, discrete, and irregular pink macules 2-4 mm in diameter that blanch with pressure. They arise in clusters of 5-15, last for several days, and fade away without scarring (Website18).

        6. Treatment Information:
          • Oral rehydration. : Give plenty of fluids. Oral rehydration solution is highly recommended. It is available at pharmacies and should be administered following the instructions on the packaging. For mildly unwell children, diluted juice or carbonated (fizzy) drinks (one part to three parts water) or cordial (even more diluted) can be given (Website19).
            • Applicable: Salmonella infection.
          • Antibiotic-Ciprofloxacin. : General treatment duration is 48-72 hours. Enteric ( typhoid) fever is best treated with antibiotics for 10-14 days. Prolonged bacteremia and focal infection are treated with maximal doses of antibiotics for 4-6 weeks. Ciprofloxacin (Cipro) - Fluoroquinolone with activity against streptococci, Salmonella, and most gram-negative organisms, but has no activity against anaerobes.It inhibits bacterial DNA synthesis and, consequently, growth. Ciprofloxacin (Cipro) is effective in treatment of long-term carriers of Salmonella. Adult Dose: 500 mg PO bid for 14 d. Pediatric Dose: Not recommended 18 years - Administer as in adults (Website20).
            • Applicable: Salmonella infection.
            • Contraindicator: Documented hypersensitivity (Website20).
            • Complication: Coadministration with antacids, iron salts, and zinc salts may reduce serum levels; administer antacids 2-4 h before or after taking fluoroquinolones; cimetidine may interfere with metabolism of fluoroquinolones; reduces therapeutic effects of phenytoin; probenecid may increase serum concentrations; may increase toxicity of theophylline, caffeine, cyclosporine, and digoxin (monitor digoxin levels); may increase effects of anticoagulants (Website20).
            • Drug Resistance: Salmonella strains with resistance to Ciprofloxacin are now about 15% of the Salmonella isolates (Threlfall, 2002).
          • Antibiotic-Trimethoprim/sulfamethoxazole. : Trimethoprim inhibits bacterial growth by inhibiting synthesis of dihydrofolic acid. Adult Dose - 2 g PO bid. Pediatric Dose - 8 mg/kg/d PO tid/qid for 14 d (Website20).
            • Applicable: Salmonella infection.
            • Contraindicator: Documented hypersensitivity; megaloblastic anemia caused by folate deficiency (Website20).
            • Complication: Coadministration with dapsone may increase blood levels of both drugs; coadministration of diuretics increases incidence of thrombocytopenia purpura in elderly persons; phenytoin levels may increase with coadministration; may potentiate effects of methotrexate in bone marrow depression; hypoglycemic response to sulfonylureas may increase with coadministration; may increase levels of zidovudine (Website20).
            • Drug Resistance: Only seven isolates were resistant to trimethoprim/sulfamethoxazole, reported by Kiessling et al (Kiessling et al., 2002).
          • Antibiotic - Ceftriaxone.: Ceftriaxone (Rocephin) - Third-generation cephalosporin with broad-spectrum antibacterial activity against gram-negative bacteria. Adult Dose: 1-2 g IV bid Pediatric Dose: 50-75 mg/kg/d IV (Website20).
            • Applicable: Salmonella infection.
            • Contraindicator: Documented hypersensitivity (Website20).
            • Complication: Coadministration with ethacrynic acid, furosemide, and aminoglycosides may increase nephrotoxicity (Website20).
            • Drug Resistance: None of the Salmonella samples were resistant to ceftriaxone, reported by Bacon et al. (Bacon et al., 2002).

    4. Prevention:
      1. Preventing - Rural:
        • Description: Salmonella bacteria are difficult to eradicate from the environment. However, because the major reservoir for human infection is poultry and livestock, reducing the number of Salmonella harbored in these animals would significantly reduce human exposure. For example, all animal feeds are treated to kill Salmonella before distribution, resulting in a marked reduction in salmonellosis. Other helpful measures include changing animal slaughtering practices to reduce cross-contamination of animal carcasses; protecting processed foods from contamination; providing training in hygienic practices for all food-handling personnel in slaughterhouses, food processing plants, and restaurants; cooking and refrigerating foods adequately in food processing plants, restaurants, and homes; and expanding of governmental enteric disease surveillance programs (Website9, Rabsch et al., 2001).
      2. Preventing Salmonellosis:
        • Description: How can Salmonellosis be prevented? SOME GENERAL GUIDELINES ARE: Always wash your hands with soap and warm water before and after handling food, using the toilet, after changing diapers, or after playing with your pet. Always refrigerate meats and eggs. Always cook meats completely. Never eat raw meat. Always cook eggs and food containing raw eggs completely. Never eat dough or batter that contain raw eggs. Avoid unpasteurized milk or foods made with unpasteurized milk (Website14, Website15).

    5. Model System:

      No model system information is currently available here.

IV. Labwork Information

A. Biosafety Information:
  1. General biosafety information :
    • Biosafety Level: Biosafety Level 2.
    • Precautions:
      • The agent may be present in feces, blood, urine, and in food, feed, and environmental materials. Ingestion or parenteral inoculation are the primary laboratory hazards. The importance of aerosol exposure is not known. Naturally or experimentally infected animals are a potential source of infection for laboratory and animal care personnel, and for other animals. Recommended Precautions: Biosafety Level 2 practices, containment equipment, and facilities are recommended for activities with clinical materials and cultures known to contain or potentially contain the agents. Animal Biosafety Level 2 practices, containment equipment, and facilities are recommended for activities with experimentally or naturally infected animals (Website21).
B. Culturing Information:
  1. Salmonella Culturing Method :
    1. Description: Rappaport-Vassiliadis (RV) medium is comparable to, or even more effective than, the other selective enrichments for recovery of Salmonella from all of the foods. Twenty-three laboratories participated in a collaborative study to compare the relative effectiveness of Rappaport-Vassiliadis (RV) medium (Hammack et al., 2001).

    2. Medium:
      1. BROTH BASE: Tryptone 5 g. NaCl 8 g. KH2PO4 1.6 g. Add distilled water to 1 liter. MAGNESIUM CHLORIDE SOLUTION (40%): MgCl2 6H2O 400 g. Add distilled water to 1 liter. MALACHITE GREEN OXALATE SOLUTION (0.4%): Malachite green oxalate 0.4 g. Add distilled water to 100 ml. To prepare the complete medium, combine 1000 ml broth base, 100 ml magnesium chloride solution, and 10 ml malachite green oxalate solution (total volume of complete medium is 1110 ml). Broth base must be prepared on same day that components are combined to make complete medium. Magnesium chloride solution may be stored in dark bottle at room temperature up to 1 year. To prepare solution, dissolve entire contents of MgCl2 6H2O from newly opened container according to formula, because this salt is very hygroscopic. Malachite green oxalate solution may be stored in dark bottle at room temperature up to 6 months. Merck analytically pure malachite green oxalate is recommended because other brands may not be equally effective. Dispense 10 ml volumes of complete medium into 16 x 150 mm test tubes. Autoclave 15 min at 115 degrees celcius. Final pH, 5.5 0.2. Store in refrigerator and use within 1 month. This medium must be made from its individual ingredients. Use of commercially available dehydrated media is not recommended. Users of this medium should be aware that there are formulations and incubation temperatures for this medium other than those recommended by U.S. Food and Drug Administration (Website22).
    3. Optimal Temperature: Incubate at 42 degrees celcius (Hammack et al., 2001, Website22).
    4. Optimal pH: Final pH 5.5 0.2 (Website22).
C. Diagnostic Tests :
  1. Organism Detection Tests:
    1. Gram Staining:
      1. Time to Perform: minutes-to-1-hour
      2. Description: Salmonella are Gram (-) bacilli. Gram-staining is a four- part procedure which uses certain dyes to make a bacterial cell stand out against its background. The specimen should be mounted and heat fixed on a slide before you proceed to stain it (Website23, Website24).
      3. False Positive: Not using enough decolorizer may yield a false Gram (+) result (Website23).
      4. False Negative: Using too much decolorizer could result in a false Gram (-) result (Website23).

  2. Immunoassay Tests:
    1. Serobact Salmonella Test:
      1. Description: A simple one step latex slide agglutination test for both clinical and food laboratories. Serobact Salmonella is a rapid latex slide agglutination test for the identification of Salmonella from selective enrichment broths. Serobact latex technology is more sensitive than direct agglutination methods and the use of Serobact Salmonella permits the presumptive identification of Salmonella spp. at least 24 hours earlier than using conventional techniques. PRINCIPLE: Polyvalent H antisera prepared against a comprehensive range of Salmonella flagella antigens is coated onto latex particles. Additional information: http://www.diffchamb.com/ (Website25).
      2. False Positive: Specificity 97.2%. Predictive negative value 100% (Website25).
      3. False Negative: Sensitivity 100%. Predictive positive value 98.2% (Website25).
    2. REVEAL for Salmonella:
      1. Description: The test is designed to screen one or several samples concurrently. Detectable levels of Salmonella are present within 20 hours of sample collection. Rappaport-Vassiliadis (RV) can also be used as a selective enrichment. When using RV, the sample is ready to test after four hours of sample incubation. To begin the test, a sample of the enriched culture is placed into the sample port. Contents of the sample are wicked through the pad to a specimen reaction zone containing colloidal gold-labeled antibodies specific to Salmonella. Reactive Salmonella combine with the gold-labeled antibodies and migrate through the support until they encounter a binding reagent zone which includes a second antibody specific to Salmonella. When this occurs, a line appears in the test window indicating a positive result. The rest of the sample continues to migrate until it encounters a second binding reagent zone. This results in the formation of a line in the control window. Regardless of whether or not the sample contains any Salmonella, a line will form, ensuring the test is working correctly. Additional information: http://www.neogen.com/revealsalmonella.htm (Website26).
    3. Transia Card:
      1. Description: Transia Card Salmonella: The Transia Card Salmonella is used directly on an enrichment broth. It is on a sandwich - type, immunochromatographic reaction using highly- specific antibodies immobilised onto a membrane and conjugated to a dye. This allows the detection of all Salmonella serotypes present in sample. Additional information: http://www.diffchamb.com/ (Website27).
      2. False Positive: No cross - reaction with other enterobacteria (Website27).
      3. False Negative: Maximised sensitivity through lipopolysaccharide (LPS) detection (Website27).

  3. Nucleic Acid Detection Tests: :
    1. Salmonella BAX System:
      1. Time to Perform: 1-hour-to-1-day
      2. Description: Salmonella BAX System. Food labs can now use an automated system to quickly and accurately detect bacteria in raw ingredients, finished products and environmental samples. Tested on meat, poultry, fruit, vegetable, dairy, chocolate/bakery products, animal feed and pasta. The BAX system cycler/detector is used to load the prepared samples. In less than four hours, computer-generated results are clearly displayed on the screen. A single tablet of integrated PCR reagents combines sample and control primers, plus reagents that overcome inhibition in chocolate and other challenging food types. There is no need to run a separate control. Process up to 96 samples in one batch. BAX for screening Salmonella can work with even the most difficult samples. Additional information: http://www.qualicon.com/ (Website28).
      3. False Positive: Specificity 98% (Website28).
      4. False Negative: Sensitivity 98% (Website28).
    2. Ferretti's Salmonella PCR Detection :
      1. Time to Perform: 1-hour-to-1-day
      2. Description: A PCR-based method for the detection of Salmonella (in food) is sensitive and specific when contaminated foods are analyzed. It can be easily performed within a maximum of 12 h from food sampling, thus allowing prompt detection of Salmonella in the food stocks. This method allows the detection of a 389-bp fragment within the conserved invA gene sequence of Salmonella (Ferretti et al., 2001).
      3. Primers:
        • Salm
          • Forward: GCTGCGCGCGAACGGCGAAG
          • Reverse: TCCCGGCAGAGTTCCCATT
          • Product
    3. Oliveira/Eyigor's Salmonella PCR Detection:
      1. Time to Perform: 1-hour-to-1-day
      2. Description: A polymerase chain reaction (PCR) assay was developed for the generic detection of Salmonella. The assay combined with Rappaport-Vassiliadis (RV) selective enrichment broth (PCR-RV) was designed, and field samples were analyzed. Three sets of primer pairs were used: 139 and 141, specific for the invA gene ; Fli15 and Typ04, specific for the fliC gene from ; A058 and A01, specific for the sefA gene (Oliveira et al., 2002).
      3. Primers:
        • InvA
          • Forward: GTGAAATTATCGCCACGTTCGGGCAA
          • Reverse: TCATCGCACCGTCAAAGGAACC
          • Product
        • Fli-Typ
          • Forward: CGGTGTTGCCCAGGTTGGTAAT
          • Reverse: 16 ACTGGTAAAGATGGCT
          • Product
        • A0
          • Forward: GATACTGCTGAACGTAGAAGG
          • Reverse: GCGTAAATCAGCATCTGCAGTAGC
          • Product

    4. DNA hybridization test/Salmonella Microwell Test:
      1. Description: Gene-Trak Salmonella Microwell Test provides for the detection of Salmonella in food. Test based on microtiter colorimetric absorbance reading. The DNA hybridization test employs Salmonella-specific DNA probes which are directly labeled with horseradish peroxidase. A colorimetric endpoint is then used for the detection of Salmonella in food samples following broth culture enrichment. PRODUCT SPECIFICATIONS: Sensitivity: 1-5 CFU/25g. Testing time: 1.5 hours (after 40 to 48 hour enrichment). Tests per kit: Up to 93 (Website29).
      2. False Positive: A sample is considered negative for the presence of Salmonella if the absorbance value obtained is less than or equal to 0.10 (Website29).
      3. False Negative: A sample is considered presumptively positive for the presence of Salmonella if the absorbance value obtained is greater than 0.10 (Website29).
    5. DNA hybridization test/Salmonella DLP Assay:
      1. Description: Gene-Trak Salmonella Direct Labeled Probe (DLP) Assay provides for the detection of Salmonella in food. Test based on photometer absorbance reading in tubes. The DNA hybridization test employs Salmonella-specific DNA probes directly labeled with horseradish peroxidase and a colorimetric detection system for the detection of Salmonella in food samples following broth culture enrichment. PRODUCT SPECIFICATIONS: Sensitivity: 1-5 CFU/25g. Testing time: 2 hours (after 40 to 48 hour enrichment). Tests per kit: Up to 98 (Website30).
      2. False Positive: A sample is considered negative for the presence of Salmonella if the absorbance value obtained is less than or equal to the established cutoff value for the assay (Website30).
      3. False Negative: A sample is considered presumptively positive for the presence of Salmonella if the absorbance value obtained is greater than the established cutoff value of the assay (Website30).

  4. Other Types of Diagnostic Tests:

    No other tests available here.

V. References

A. Journal References:
Bacon et al., 2002: Bacon RT, Sofos JN, Belk KE, Hyatt DR, Smith GC. Prevalence and antibiotic susceptibility of Salmonella isolated from beef animal hides and carcasses. Journal of Food Protection. 2002; 65(2): 284 - 290. [PubMed: 11848559].
Casner, 2001: Casner N. "Do It Now!" Yakima, Wash, and the campaign against rural typhoid. American Journal of Public Health. 2001; 91(11): 1768 - 1775. [PubMed: 11684599].
Eyigor et al., 2002: Eyigor A, Carli KT, Unal CB. Implementation of real-time PCR to tetrathionate broth enrichment step of Salmonella detection in poultry. Letters in Applied Microbiology. 2002; 34(1): 37 - 41. [PubMed: 11849490].
Ferretti et al., 2001: Ferretti R, Mannazzu I, Cocolin L, Comi G, Clementi F. Twelve-hour PCR-based method for detection of Salmonella spp. in food. Applied and Environmental Microbiology. 2001; 67(2): 977 - 978. [PubMed: 11157272].
Goosney et al., 1999: Goosney DL, Knoechel DG, Finlay BB. Enteropathogenic E. coli, Salmonella, and Shigella: masters of host cell cytoskeletal exploitation. Emerging Infectious Diseases. 1999; 5(2): 216 - 223. [PubMed: 10221873].
Hammack et al., 2001: Hammack TS, Amaguana RM, Andrews WH, Lerner I. Rappaport-Vassiliadis medium for recovery of Salmonella spp. from low microbial load foods: collaborative study. J AOAC Int. 2001; 84(1): 65 - 83. [PubMed: 11234854].
Kiessling et al., 2002: Kiessling CR, Cutting JH, Loftis M, Kiessling WM, Datta AR, Sofos JN. Antimicrobial resistance of food-related Salmonella isolates, 1999-2000. Journal of Food Protection. 2002; 65(4): 603 - 608. [PubMed: 11952207].
McClelland et al., 2001: McClelland M, Sanderson KE, Spieth J, Clifton SW, Latreille P, Courtney L, Porwollik S, Ali J, Dante M, Du F, Hou S, Layman D, Leonard S, Nguyen C, Scott K, Holmes A, Grewal N, Mulvaney E, Ryan E, Sun H, Florea L, Miller W, Stoneking T, Nhan M, Waterston R, Wilson RK. Complete genome sequence of Salmonella enterica serovar Typhimurium LT2. Nature. 2001; 413(6858): 852 - 856. [PubMed: 11677609].
Oldfield, 2001: Oldfield 3rd EC. Emerging foodborne pathogens: keeping your patients and your families safe. Review of Gastroenterology Disorders. 2001; 1(4): 177 - 186. [PubMed: 12120184].
Oliveira et al., 2002: Oliveira SD, Santos LR, Schuch DM, Silva AB, Salle CT, Canal CW. Detection and identification of salmonellas from poultry-related samples by PCR. Veterinary Microbiology. 2002; 87(1): 25 - 35. [PubMed: 12079744].
Parkhil et al., 2001: Parkhill J, Dougan G, James KD, Thomson NR, Pickard D, Wain J, Churcher C, Mungall KL, Bentley SD, Holden MT, Sebaihia M, Baker S, Basham D, Brooks K, Chillingworth T, Connerton P, Cronin A, Davis P, Davies RM, Dowd L, White N, Farrar J, Feltwell T, Hamlin N, Haque A, Hien TT, Holroyd S, Jagels K, Krogh A, Larsen TS, Leather S, Moule S, O'Gaora P, Parry C, Quail M, Rutherford K, Simmonds M, Skelton J, Stevens K, Whitehead S, Barrell BG. Complete genome sequence of a multiple drug resistant Salmonella enterica serovar Typhi CT18. Nature. 2001; 413(6858): 848 - 852. [PubMed: 11677608].
Rabsch et al., 2001: Rabsch W, Tschape H, Baumler AJ. Non-typhoidal salmonellosis: emerging problems. Microbes and Infection. 2001; 3(3): 237 - 247. [PubMed: 11358718].
Threlfall, 2002: Threlfall EJ. Antimicrobial drug resistance in Salmonella: problems and perspectives in food- and water-borne infections. FEMS Microbiology Reviews. 2002; 26(2): 141 - 148. [PubMed: 12069879].
B. Book References:
Krieg and Holt, 1984: Krieg NR, Holt JG. Salmonella. . 427 - 458. In: Bergeys Manual of Systematic Bacteriology.1984. Williams and Wilkinson, Baltimore, London.
C. Website References:
Website1: The NCBI Entrez Taxonomy. Salmonella enterica. [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=28901 ].
Website2: About Salmonella. [ http://www.about-salmonella.com/main.html ].
Website3: What are Salmonella? [ http://www.salmonella.org/info.html ].
Website4: FDA. Salmonella spp. [ http://vm.cfsan.fda.gov/~mow/chap1.html ].
Website5: Salmonella picture. [ http://www.med.sc.edu:85/fox/salmon-dk.jpg ].
Website6: CDC.What to Do in an Emergency. [ http://www.bt.cdc.gov/EmContact/index.asp ].
Website7: CDC. Information Networks and Other Information Sources. [ http://www.cdc.gov/other.htm#states ].
Website8: About Salmonella. What is the risk of Salmonella infection? [ http://www.about-salmonella.com/page3.htm ].
Website9: I. Salmonella. [ http://gsbs.utmb.edu/microbook/ch021.htm ].
Website10: Typhoid Fever. [ http://www.cdc.gov/ncidod/dbmd/diseaseinfo/typhoidfever_g.htm ].
Website11: McKinley Health Center. Salmonella. [ http://www.mckinley.uiuc.edu/health-info/dis-cond/commdis/salmonel.html ].
Website12: II. Salmonella. [ http://www.sciencenet.com.au/frames/profiles/negative/families/enteroba/profile2.htm ].
Website13: Salmonellosis fact sheet. [ http://www.aegis.com/news/bw/1997/bw970321.html#factsheet ].
Website14: Preventing food poisoning in the home. [ http://www.dhs.sa.gov.au/pehs/Youve-got-what/gen-topic-food-poisoning.htm ].
Website15: Salmonella enteritidis. [ http://www.cdc.gov/ncidod/dbmd/diseaseinfo/salment_g.htm ].
Website16: Material safety data sheet - Infectious substances. [ http://www.hc-sc.gc.ca/pphb-dgspsp/msds-ftss/msds134e.html ].
Website17: SALMONELLOSIS [ http://hlunix.hl.state.ut.us/els/epidemiology/epifacts/salmon.html ].
Website18: Robert Barrali. Salmonella Infection. [ http://www.emedicine.com/EMERG/topic515.htm ].
Website19: Food poisoning. [ http://www.emedicine.com/med/topic807.htm ].
Website20: Diana L Crevi. Salmonella Infection. [ http://author.emedicine.com/ped/topic2033.htm ].
Website21: CDC. Office of Health and Safety (OHS). [ http://www.cdc.gov/od/ohs/biosfty/bmbl4/bmbl4s7a.htm ].
Website22: FDA. Bacteriological Analytical Manual (BAM). Rappaport-Vassiliadis Medium. [ http://www.cfsan.fda.gov/~ebam/m132.html ].
Website23: Gram-staining procedure. [ http://medic.med.uth.tmc.edu/path/00001445.htm ].
Website24: FDA. BAM. Microscopic Examination of Foods. [ http://www.cfsan.fda.gov/~ebam/bam-2.html ].
Website25: Diffchamb. Serobact Salmonella Kit (Click on Product information leaflet). [ http://www.diffchamb.com/website/Archive/Templates/Item/product.asp?iSecId=375 ].
Website26: Neogen. The REVEAL for Salmonella. [ http://www.neogen.com/pdf/FS_Catalog2003/RevealSalmonella.pdf ].
Website27: Diffchamb. Transia Card Salmonella (Click on Transia Card Salmonella). [ http://www.diffchamb.com/website/Archive/Templates/Item/product.asp?iSecId=38 ].
Website28: BAX System PCR Assay for Screening Salmonella. [ http://www.qualicon.com/bax_targets.html#target:%20Salmonella ].
Website29: GENE-TRAK Salmonella Microwell Test. [ http://www.neogen.com/pdf/FS_Catalog2003/GT_SalMicrowell.pdf ].
Website30: GENE-TRAK Salmonella Direct Labeled Probe (DLP) Assay. [ http://www.neogen.com/pdf/FS_Catalog2003/GT_SalAssayDLP.pdf ].
Website31: The NCBI Entrez Taxonomy: Salmonella enterica subsp. enterica serovar Typhi. [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=90370 ].
Website32: The NCBI Entrez Taxonomy: Homo sapiens. [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9606 ].
Website33: The NCBI Entrez Taxonomy: Gallus gallus. [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9031 ].
Website34: The NCBI: Salmonella typhimurium LT2, complete genome. [ http://www.ncbi.nlm.nih.gov/genomes/framik.cgi?db=genome&gi=202 ].
Website35: The NCBI: Salmonella typhimurium LT2 plasmid pSLT. [ http://www.ncbi.nlm.nih.gov/genomes/framik.cgi?db=genome&gi=15873 ].
Website36: The NCBI: Salmonella enterica subsp. enterica serovar Typhi, complete genome. [ http://www.ncbi.nlm.nih.gov/genomes/framik.cgi?db=genome&gi=203 ].
Website37: The NCBI: Salmonella enterica subsp. enterica serovar Typhi plasmid pHCM1. [ http://www.ncbi.nlm.nih.gov/genomes/framik.cgi?db=genome&gi=15930 ].
Website38: The NCBI: Salmonella enterica subsp. enterica serovar Typhi plasmid pHCM2. [ http://www.ncbi.nlm.nih.gov/genomes/framik.cgi?db=genome&gi=15931 ].
Website 53: Dennis Kunkel Microscopy, Inc. [ http://www.denniskunkel.com/ ].
D. Thesis References:

No thesis or dissertation references used.

VI. Curation Information