Rift Valley Fever Virus
I. Organism Information
A. Taxonomy Information
-
Species:
-
Rift Valley fever virus
:
-
GenBank Taxonomy No.:
11588
-
Description:
Rift Valley Fever (RVF) is an arthropod-borne disease primarily causing epizootics of abortion and high mortality in domestic animals during which humans become infected (Meegan and Bailey, 1989). The disease is caused by the RVF virus, a member of the genus Phlebovirus in the family Bunyaviridae. The disease was first reported among livestock by veterinary officers in Kenya in the early 1900s (Website 2).
-
Variant(s):
-
Rift valley fever virus (STRAIN ZH-548 M12)
(Website 3):
-
GenBank Taxonomy No.:
11589
-
Parent:
Rift Valley fever virus
-
Description:
Strain ZH 548 was isolated in Egypt in 1977 from an infected human (Sall et al., 1998). The MP12 attenuated strain of Rift Valley fever virus was obtained by 12 serial passages of a virulent isolate ZH548 in the presence of 5-fluorouracil (Vialat et al., 1997).
B. Lifecycle Information
:
-
Virion
:
-
Size:
Mature particles, liberated by the disintegration of Vero cells, contained ribosome-like structures within the nucleocapsid, which was surrounded by a typical unit membrane through which were inserted some 350-375 surface spikes whose inner ends were incorporated into the nucleocapsid structure. In the negatively stained material, the overall diameter of the virion was 90-110 nm; the spikes were 10-18 nm in length and 5 nm in diameter (Ellis et al., 1988).
-
Shape:
Viruses of the family Bunyaviridae have similar morphological features (Gonzalez-Scarano and Nathanson, 1996). The viral particles are spherical or pleomorphic, depending on the method used for fixation (Gonzales-Scarano and Nathanson, 1996).
C. Genome Summary:
-
Genome of
Rift Valley fever virus
-
Description:
Like all the phleboviruses, RVF virus possesses a tripartite genome consisting of negative sense single-strand RNA segments designated L (large), M (medium) and S (small). The L segment codes for the L viral polymerase. The M segment codes for the precursor to the envelope glycoproteins G1 and G2 and the non structural proteins 14 and 78 kDa. The S segment codes for the nucleocapsid protein N and the non structural protein NSs in an ambisense strategy (Vialat et al., 1997).
-
S segment (Website 11):
-
GenBank Accession Number:
NC_002045
-
Size:
1690 (Website 11)
-
Gene Count:
2 genes. The S segment codes for the nucleocapsid protein N and the non structural protein NSs in an ambisense strategy (Vialat et al., 1997).
-
Description:
The gene organization and expression of the S segment are the major features that distinguish the Phlebovirus genus from bunyaviruses, hantaviruses, and nairoviruses, but are similar to those topoviruses (Giorgi, 1996). The sequences and coding strategies of the S RNAs of two viruses, Toscana (TOS) and the M12 derivative of Rift Valley fever ZH-548 (RVF, Phlebovirus genus, Bunyaviridae) have been determined from cDNA clones and compared to the previously published sequences of Punta Toro (PT), Sandfly fever Sicilian (SFS), and Uukuniemi (UUK) viruses. All five viruses exhibit an ambisense coding strategy for their small (S) RNA species, i.e., one gene product (the NSs protein) is encoded in the 5' half of the viral RNA, a second (the N protein) is encoded in the sequence complementary to the 3' half (Giorgi et al., 1991).
-
M Segment (Website 12):
-
GenBank Accession Number:
NC_002044 M25276 M11157
-
Size:
3884 or 3885 bp (Website 12)
-
Gene Count:
2 genes. The M segment codes for the precursor to the envelope glycoproteins G1 and G2 and the non structural proteins 14 and 78 kDa (Vialat et al., 1997).
-
Description:
The sequence data show that all viruses possess a single large ORF extending the length of the M segment in the viral complementary RNA. This ORF codes for a polypeptide precursor of the viral glycoproteins G1 and G2 (Giorgi, 1996).
-
L Segment (Website 13):
-
GenBank Accession Number:
NC_002043
-
Size:
6606 (Website 13)
-
Gene Count:
1 gene. The L segment codes for the L viral polymerase (Vialat et al., 1997).
-
Description:
The L segment codes for the L viral polymerase (Vialat et al., 1997).
II. Epidemiology Information
A. Outbreak Locations:
-
RVF is generally found in regions of eastern and southern Africa where sheep and cattle are raised, but the virus also exists in most countries of sub-Saharan Africa and in Madagascar. In September 2000, a RVF outbreak was reported in Saudi Arabia and subsequently Yemen. These cases represent the first Rift Valley fever cases identified outside Africa (Website 2).
B. Transmission Information:
-
From:
Culicidae
To:
Homo sapiens
,
With Destination:
Homo sapiens
(Website 2):
Mechanism:
Humans can get RVF as a result of bites from mosquitoes and possibly other bloodsucking insects that serve as vectors (Website 2).
-
From:
Artiodactyls To:
Homo sapiens
,
With Destination:
Homo sapiens
(Website 2):
Mechanism:
Humans can also get the disease if they are exposed to either the blood or other body fluids of infected animals. This exposure can result from the slaughtering or handling of infected animals or by touching contaminated meat during the preparation of food (Website 2).
-
From:
Artiodactyls To:
Homo sapiens
,
With Destination:
Homo sapiens
(Website 2):
Mechanism:
Humans can also get the disease if they are exposed to either the blood or other body fluids of infected animals. This exposure can result from the slaughtering or handling of infected animals or by touching contaminated meat during the preparation of food (Website 2).
-
From:
Artiodactyls To:
Homo sapiens
,
With Destination:
Homo sapiens
(Website 2):
Mechanism:
Humans can also get the disease if they are exposed to either the blood or other body fluids of infected animals. This exposure can result from the slaughtering or handling of infected animals or by touching contaminated meat during the preparation of food (Website 2).
-
From:
Mosquito To:
Mosquito ,
With Destination:
Mosquito (Lupi and Tyring, 2003):
Mechanism:
The interepizootic survival of RVF virus is believed to depend on tranovarian transmission of virus in floodwater Aedes mosquitoes. Virus can persist in mosquito eggs until the next period of heavy rainfall, when they hatch and yield mosquitoes infected with the RVF virus (Lupi and Tyring, 2003).
C. Environment:
No environment information is currently available here.
D. Intentional Releases:
-
Intentional Release information
:
-
Description:
-
Emergency contact:
If clinicians feel that VHF is a likely diagnosis, they should take two immediate steps: 1) isolate the patient, and 2) notify local and state health departments and CDC (MMWR, 1988). Report incidents to state health departments and the CDC (telephone {404} 639-1511; from 4:30 p.m. to 8 a.m., telephone {404} 639-2888). Information on investigating and managing patients with suspected viral hemorrhagic fever, collecting and shipping diagnostic specimens, and instituting control measures is available on request from the following persons at Centers for Disease Control (CDC) in Atlanta, Georgia; for all telephone numbers, dial 404-639 + extension: Epidemic Intelligence Service (EIS) Officer, Special Pathogens Branch, Division of Viral Diseases, Center for Infectious Diseases (ext. 1344); Chief, Special Pathogens Branch, Division of Viral Diseases, Center for Infectious Diseases: Joseph B. McCormick, M.D. (ext. 3308); Senior Medical Officer, Special Pathogens Branch, Division of Viral Diseases, Center for Infectious Diseases: Susan P. Fisher-Hoch, M.D. (ext. 3308); Director, Division of Viral Diseases, Center for Infectious Diseases (ext. 3574). After regular office hours and on weekends, the persons named above may be contacted through the CDC duty officer (ext. 2888) (MMWR, 1988).
-
Delivery mechanism:
The VHF agents are all highly infectious via the aerosol route, and most are quite stable as respirable aerosols. This means that they satisfy at least one criterion for being weaponized, and some clearly have the potential to be biological warfare threats. Most of these agents replicate in cell culture to concentrations sufficiently high to produce a small terrorist weapon, one suitable for introducing lethal doses of virus into the air intake of an airplane or office building. Some replicate to even higher concentrations, with obvious potential ramifications. Since the VHF agents cause serious diseases with high morbidity and mortality, their existence as endemic disease threats and as potential biological warfare weapons suggests a formidable potential impact on unit readiness. Further, returning troops may well be carrying exotic viral diseases to which the civilian population is not immune, a major public health concern (Website 14).
-
Containment:
Patients with VHF syndrome generally have significant quantities of virus in their blood, and perhaps in other secretions as well (with the exceptions of dengue and classic hantaviral disease). Well-documented secondary infections among contacts and medical personnel not parenterally exposed have occurred. Thus, caution should be exercised in evaluating and treating patients with suspected VHF syndrome. Over-reaction on the part of medical personnel is inappropriate and detrimental to both patient and staff, but it is prudent to provide isolation measures as rigorous as feasible. At a minimum, these should include the following: stringent barrier nursing; mask, gown, glove, and needle precautions; hazard-labeling of specimens submitted to the clinical laboratory; restricted access to the patient; and autoclaving or liberal disinfection of contaminated materials, using hypochlorite or phenolic disinfectants. For more intensive care, however, increased precautions are advisable. Members of the patient care team should be limited to a small number of selected, trained individuals, and special care should be directed toward eliminating all parenteral exposures. Use of endoscopy, respirators, arterial catheters, routine blood sampling, and extensive laboratory analysis increase opportunities for aerosol dissemination of infectious blood and body fluids. For medical personnel, the wearing of flexible plastic hoods equipped with battery-powered blowers provides excellent protection of the mucous membranes and airways (Website 14).
III. Infected Hosts
-
Human:
-
Taxonomy Information:
-
Species:
-
Human
(Website 4):
-
GenBank Taxonomy No.:
9606
-
Scientific Name:
Homo sapiens (Website 4)
-
Description:
During an epidemic, disease usually occurs first in animals, then in humans. Human infection occurs mainly among farmers and others in close contact with animals during an epizootic. The virus can be transmitted to humans by contact with tissues or blood of infected animals during care, autopsy, slaughter, or disposal of infected animals, and infection is postulated to result from transcutaneous or aerosol exposure. During an epizootic, when there are many infected and dying animals, contact transmission may be a more important source of human infections than is mosquito transmission. In addition to outbreaks, sporadic mosquito-transmitted infections of human are occasionally reported. Laboratory-acquired infections, probably due to aerosols, have long been recognized and extreme precautions should be taken by those working with the virus (Gonzales-Scarano and Nathanson, 1996).
-
Infection Process:
-
Infectious Dose:
1 -10 organisms (Franz et al., 1997)
-
Description:
Humans can get RVF as a result of bites from mosquitoes and possibly other bloodsucking insects that serve as vectors. Humans can also get the disease if they are exposed to either the blood or other body fluids of infected animals. This exposure can result from the slaughtering or handling of infected animals or by touching contaminated meat during the preparation of food. Infection through aerosol transmission of RVF virus has resulted from contact with laboratory specimens containing the virus (Website 2).
-
-
Rift Valley fever virus in a liver cell (Website 19):
Description: Rift Valley fever virus. In this micrograph virions are seen budding into membrane vesicles (Golgi vesicles) in the cytoplasm of a liver cell (hepatocyte) of an infected rat. The 100 nm (nanometer) virions then make their way to the cell surface and are released. This virus replicates to very high concentrations very quickly and causes very rapid damage to the liver and other organs. The virus is mosquito-borne and in nature affects sheep, cattle, wild mammals and humans. The virus was the cause of one of the most explosive epidemics ever seen when it appeared in 1977 in Egypt. A recent epidemic in Saudi Arabia and Yemen represents the first time that the virus has appeared outside Africa. This virus, because it can infect many different vertebrates and many different mosquitoes, presents perhaps the greatest potential threat posed by any virus. Magnification approximately x30,000. Micrograph from T. W. Geisbert, U. S. Army Medical Research Institute of Infectious Diseases, Ft. Detrick, Maryland.
-
Disease Information:
-
Enzootic hepatitis
(i.e., Rift Valley Fever)
(Gear, 1988):
-
Pathogenesis Mechanism:
The pathogenesis of Rift Valley fever virus infection after natural transmission by a mosquito bite can be reconstructed from experimental studies. Inoculated virus presumably moves from skin to draining lymph nodes and probably replicates there before spreading by efferent lymphatics to the circulation. The liver is rapidly invaded, with rapid involvement of hepatocytes; it is unclear whether the initial site of entry is the Kupffer cells, with subsequent spread to the hepatic parenchyma. Replication in the liver produces high virus titers and probably is a major source of the high titer plasma viremia. Virus also may cross the blood-brain barrier and infect neurons and glia. The virus is cytocidal, which probably accounts for the liver necrosis. However, the meningoencephalitis and retinitis that develop 2 to 3 weeks after infection are highly inflammatory and may be mediated at least in part by immune mechanisms (Gonzales-Scarano and Nathanson, 1996).
-
Incubation Period:
2 to 6 days (Isaacson, 2001)
-
Prognosis:
Most patients recover spontaneously, but in less than 5% of cases, complications develop relatively late in the course of illness, or in early convalescence. These manifest in the form of encephalitis, retinitis, or a generalized hemorrhagic state (Isaacson, 2001). The most common complication associated with RVF is inflammation of the retina (a structure connecting the nerves of the eye to the brain). As a result, approximately 1% - 10% of affected patients may have some permanent vision loss (Website 2).
Fatal cases of RVF associated with a hemorrhagic state and produce gastrointestinal hemorrhage were first recognized in South Africa in 1975. The hemorrhagic state in RVF develops towards the end of the fever, usually about 1 week after the onset of illness. The first signs of this developing state are often epistaxis and persistent bleeding from needle puncture wounds, followed by gastrointestinal bleeding with hematemesis and melena. The patient may become deeply jaundiced and show increasing signs of liver and kidney dysfunction, often with the development of anuria (Gear, 1988).
-
Symptom Information
:
-
Syndrome --
Rift Valley Fever:
-
Description:
Asymptomatic infections with Rift Valley fever virus are common. In symptomatic cases, after a short incubation period of usually 2-6 days (occasionally longer), RFV presents with abrupt onset of a nonspecific flu-like illness with fever, headache, flushing, photophobia, retro-orbital pain, myalgia, rigors, and joint pain. Nausea and vomiting are frequent, and a faint maculopapular rash occurs in some patients. The fever is often biphasic, returning to normal after 1 week but recurring for a brief spell, after a further interval of a few days. Most patients recover spontaneously, but in less than 5% of cases, complications develop relatively late in the course of illness, or in early convalescence. These manifest in the form of encephalitis, retinitis, or a generalized hemorrhagic state. Bleeding usually presents within the first week of illness and is a common cause of RVF-associated deaths, estimated to occur in less than 1% of cases. Encephalitis may leave the patient with residual brain damage, whereas retinitis, which presents with a typical cotton-wool exudate on the macula, may in some cases result in permanently defective vision or blindness (Isaacson, 2001).
-
Observed:
The majority of infected humans have a nonspecific viral syndrome, but a small percentage of patients may progress to develop hemorrhagic fever, encephalitis, or ocular disease (Gubler, 2002).
Symptoms Shown in the Syndrome:
-
Vision loss:
-
Description:
Late in the course of the illness, or early in convalescence, patients may complain of defective vision which on ophthamological examination is found to be associated with retinitis with typical 'cotton-wool' exudate on the macula. When only one eye is involved, as in most cases, the effect is not too disabling, for most individuals can do well with the vision of only one eye; but when both eyes are affected the patient is severely handicapped by the loss of central vision. These lesions in most patients have gradually resolved with the return of normal vision, but in some the defect has been more permanent (Gear, 1988).
-
Observed:
Approximately 1% - 10% of affected patients may have some permanent vision loss (Website 2). Eight of 683 patients (1.5%) reported vision loss or scotomas (Madani et al., 2003).
-
Encephalitis:
-
Description:
Encephalitis, a relatively rare complication, appears from 3-12 days after the fever and is characterized by very severe headache, meningismus, often confusion, stupor, and in some cases coma. Lumbar puncture reveals a slightly elevated protein, normal sugar, and a moderate pleocytosis with a predominance of lymphocytes. Nearly all patients recover, but some may be left with signs of residual brain damage (Gear, 1988).
-
Fever:
-
Nausea:
-
Vomiting:
-
Abdominal pain:
-
Diarrhea:
-
Jaundice:
-
CNS manifestations:
-
Description:
Unexplained febrile illness of more than 2 days duration associated with features of encephalitis, such as confusion, disorientation, drowsiness, coma, neck stiffness, hemiparesis, paraparesis, or convulsions (Madani et al., 2003).
-
Observed:
Eighty-one of 475 patients (17.1%) had CNS manifestations (Madani et al., 2003) (Madani et al., 2003).
-
Hemorrhagic manifestations:
-
Description:
Unexplained febrile illness of more than 2 days duration associated with bleeding, such as ecchymosis, purpura, petechiae, gastrointestinal bleeding (hematemesis, melena, or hematochesia), epistaxis, bleeding from puncture sites, or menorrhagia (Madani et al., 2003).
-
Observed:
Thirty-five of 494 patients (7.1%) had hemorrhagic manifestations (Madani et al., 2003).
-
Treatment Information:
-
Supportive:
Treatment is supportive and may require intensive care (MMWR, 1988). Early diagnosis and supportive care can be lifesaving for most patients with VHF. The cornerstone of therapy for all these infections is judicious fluid and electrolyte management (Website 15). Patients with RVF should be nursed in mosquito-protected premises (Isaacson, 2001).
There is no established course of treatment for patients infected with RVF virus. However, studies in monkeys and other animals have shown promise for ribavirin, an antiviral drug, for future use in humans. Additional studies suggest that interferon, immune modulators, and convalescent-phase plasma may also help in the treatment of patients with RVF (Website 2).
-
Prevention:
-
Vaccine (Pittman et al., 1999):
-
Description:
To protect animals and humans from contracting RVF virus, a formalin-killed RVF virus vaccine (P-MKC) from monkey kidney cells infected with the pantropic strain of virus was developed. The prepared vaccine (NDBR-103) was evaluated in mice and hamsters for immune response and efficacy and for its immune response in humans. As applied technologies have been improved, a more modern inactivated product TSI-GSD-200 was developed and after successful preclinical evaluation tested in humans (Pittman et al., 1999).
The immunogenicity and safety profiles of TSI-GSD-200 are excellent. The vaccine protects laboratory workers or others at high risk for RVF disease such as veterinarians in endemic areas. Booster injections can recall immunity lost after the primary series and can elicit antibodies in those with a sub-optimal response to the initial immunizations (Pittman et al., 1999). We conclude that the use of TSI-GSD-200 is safe and provides good long-term immunity in humans when the primary series and one boost are administered (Pittman et al., 1999).
RVF vaccination is not recommended for the average traveler, but although it is not generally available, it may be indicated for those who are traveling to participate in international RVF-outbreak investigations or are otherwise at high risk of exposure (Isaacson, 2001).
-
Efficacy:
-
Rate:
The subjects of this study received three subcutaneous doses (0, 7 and 28 days) of 0.5 ml of TSI-GSD-200. A total of 540 vaccinees (90.3%) initially responded (group A) with an 80% plaque-reduction neutralization antibody titer (PRNT80) of 1:40; whereas 58 subjects (9.7%) were initial nonresponders (group B) failing to achieve this titer. Volunteers who either failed to respond or who achieved a titer of 1:40 but whose titer waned below 1:40 were boosted 1 to 4 times with the same vaccine. Among 247 group A subjects who received the first recall injection, 242 (98%) were successfully boosted, achieving a PRNT80 1:40. Thirty-three of 44 (75%) initial nonresponders were converted to responder status after the first booster, which is a lower rate than that of group A (P less than 0.001). After the primary series and the first booster, Kaplan Meier analysis showed 50% probability of group A members maintaining a titer of 1:40 for approximately eight years; whereas group B had a 50% probability of maintaining a titer for only 204 days. Group A immune response rates to boosts 1 to 4 ranged from 87 to 100% with geometric mean titers (GMTs) ranging from 80 to 916. Boosts 1 to 4 immune response rates of group B volunteers ranged from 67 to 79% with GMTs ranging from 90 to 177 (Pittman et al., 1999).
-
Duration:
A primary series plus one booster dose of TSI GSD 200 should protect most vaccinees against RVF virus for approximately 6 years (Pittman et al., 1999).
-
Complication:
Of the 598 vaccinees who received primary injections of the TSI-GSD-200 of RVF vaccine, 16 subjects reported clinical reactions. Erythema (n=6) and induration (n=6) predominated, followed by headache (n=3), nausea (n=2), itching (n=2), redness (n=2), as well as arthralgia (n=1), malaise (n=1) and dizziness (n=1). One volunteer had fever after receiving the vaccine; however, it is unclear if the fever was related to TSI-GSD-200. All reactions were self-limited and no permanent sequelae were documented. Severity and duration of symptoms varied from those who required no treatment and lasted 2 to 3 hours to those who required bedrest, analgesics, and lasted for 2 to 3 days. First boost reactions were mild and included induration (n=6), erythema (n=5) and arthralgia (n=1). Adverse events did not increase as boosts increased (Pittman et al., 1999).
-
Mosquito avoidance:
-
Description:
A person's chances of becoming infected can be reduced by taking measures to decrease contact with mosquitoes and other bloodsucking insects through the use of mosquito repellents and bednets (Website 2).
-
Avoidance of exposure to blood or tissues of animals:
-
Description:
Avoiding exposure to blood or tissues of animals that may potentially be infected is an important protective measure for persons working with animals in RVF-endemic areas (Website 2).
-
Control of Vertebrate Hosts:
-
Description:
Immunization of susceptible animals is the most effective means for control of RVF (Meegan and Bailey, 1989). Two types of vaccine are currently used to immunize sheep and cattle in Africa. The attenuated live virus vaccine (Smithburn strain) is highly effective, but causes a small number of sheep to abort after immunization. It is relatively inexpensive and has been extensively used in endemic areas. Since there is a theoretical potential for reversion of the vaccine to virulence, it is not recommended for nonendemic areas or for animals being exported from endemic areas (Meegan and Bailey, 1989).
Formalin-inactivated vaccines have been used for many years in southern Africa, and recently in Egypt and Israel. These are safe and effective, but require multiple inoculations. This type of vaccine is recommended for nonendemic areas or for animals being exported from endemic areas (Meegan and Bailey, 1989).
Since enforcement of quarantine of animals is difficult in Africa, it is not generally an effective control measure. However, to whatever extent possible, movement of animals from epizootic situations should be restricted to prevent the further spread of RVF (Meegan and Bailey, 1989).
-
Model System:
-
Rat:
-
Model Host:
Website 16.
Rat, Rattus norvegicus (Ritter et al., 2000)
-
Model Pathogens:
-
Description:
Laboratory rats have frequently been used as an animal model for studying the pathogenesis of Rift Valley fever. It is shown here that Lewis rats (LEW/mol) are susceptible to infection with RVFV, whereas Wistar-Furth (WF/mol) rats are resistant to RVFV infection (Ritter et al., 2000).
-
Gerbil:
-
Model Host:
Gerbil, Meriones unguiculatus (Anderson et al., 1988)
-
Model Pathogens:
-
Description:
The gerbil, Meriones unguiculatus, was investigated as a model for the encephalitic form of Rift Valley fever. Resistance to necrotizing encephalitis was age-dependent with 100% mortality at 3 weeks, decreasing to approximately 20% by 10 weeks of age in outbred gerbils inoculated subcutaneously (Anderson et al., 1988).
-
Rhesus monkeys:
-
Model Host:
Rhesus monkeys (Morrill et al., 1989)
-
Model Pathogens:
-
Description:
Rhesus monkeys inoculated with Rift Valley fever (RVF) virus provide a model in which serial observations of serum viral antigen and antibodies can be made (Morrill et al., 1989).
-
Swiss-Webster mice:
-
Model Host:
Swiss-Webster mice (Kende et al., 1987)
-
Model Pathogens:
-
Description:
The prophylactic efficacy of poly (ICLC) (stabilized, synthetic, double-stranded polyriboinosinic-polyribocytidylic acid) against Rift Valley fever virus infection in Swiss-Webster mice was dependent on the treatment schedule (Kende et al., 1987).
-
Artiodactyls:
-
Taxonomy Information:
-
Species:
-
Bovine, domestic cow, domestic cattle, cattle
(Website 5):
-
GenBank Taxonomy No.:
9913
-
Scientific Name:
Bos taurus (Website 5)
-
Description:
Rift Valley fever virus produces severe disease in domestic animals, sheep being more susceptible than cattle, whereas goats are the least susceptible (Gonzales-Scarano and Nathanson, 1996).
-
Domestic goat, goat
(Website 6):
-
GenBank Taxonomy No.:
9925
-
Scientific Name:
Capra hircus (Website 6)
-
Description:
Rift Valley fever virus produces severe disease in domestic animals, sheep being more susceptible than cattle, whereas goats are the least susceptible (Gonzales-Scarano and Nathanson, 1996).
-
Sheep, domestic sheep, wild sheep, lambs
(Website 7):
-
GenBank Taxonomy No.:
9940
-
Scientific Name:
Ovis aries (Website 7)
-
Description:
Rift Valley fever virus produces severe disease in domestic animals, sheep being more susceptible than cattle, whereas goats are the least susceptible. Lambs experience over 90% mortality, adult sheep about 25%, and pregnant ewes usually abort (Gonzales-Scarano and Nathanson, 1996).
-
Infection Process:
No infection process information is currently available here.
-
Disease Information:
No disease information is currently available here.
-
Prevention:
No prevention information is currently available here.
-
Model System:
No model system information is currently available here.
-
Mosquito:
-
Taxonomy Information:
-
Species:
-
Mosquitoes
(Website 8):
-
GenBank Taxonomy No.:
7157
-
Scientific Name:
Culicidae (Website 8)
-
Description:
Rift valley fever virus can be transmitted by a rather wide variety of mosquito species and infects many large domestic animals. As a result, epizootics can occur in diverse ecological settings. Outbreaks are characteristically sporadic in any one area, and interepizootic intervals may last many years. Epizootic are usually associated with a particularly wet rainy season and high mosquito density and terminate with the end of the rains (Gonzales-Scarano and Nathanson, 1996).
-
House mosquito
(Website 9):
-
GenBank Taxonomy No.:
7175
-
Scientific Name:
Culex pipiens (Website 9)
-
Description:
Rift valley fever virus can be transmitted by a rather wide variety of mosquito species and infects many large domestic animals. As a result, epizootics can occur in diverse ecological settings. Outbreaks are characteristically sporadic in any one area, and interepizootic intervals may last many years. Epizootic are usually associated with a particularly wet rainy season and high mosquito density and terminate with the end of the rains. In Egypt Culex pipiens, in South Africa Culex theileri, and in East Africa Aedes species appear to be the major vectors (Gonzales-Scarano and Nathanson, 1996).
-
Mosquito
(Website 10):
-
GenBank Taxonomy No.:
7158
-
Scientific Name:
Aedes (Website 10)
-
Description:
Rift valley fever virus can be transmitted by a rather wide variety of mosquito species and infects many large domestic animals. As a result, epizootics can occur in diverse ecological settings. Outbreaks are characteristically sporadic in any one area, and interepizootic intervals may last many years. Epizootic are usually associated with a particularly wet rainy season and high mosquito density and terminate with the end of the rains. In Egypt Culex pipiens, in South Africa Culex theileri, and in East Africa Aedes species appear to be the major vectors (Gonzales-Scarano and Nathanson, 1996).
-
Infection Process:
No infection process information is currently available here.
-
Disease Information:
No disease information is currently available here.
-
Prevention:
No prevention information is currently available here.
-
Model System:
No model system information is currently available here.
IV. Labwork Information
A. Biosafety Information:
-
Biosafety information for
:
Rift Valley fever virus
:
-
Biosafety Level:
SALS recommends that work with this agent be conducted only in Biosafety Level 3 facilities which provide for HEPA filtration of all exhaust air prior to discharge from the laboratory (Website 17).
-
Precautions:
-
Clearly, RVF presents a hazard to all laboratory workers engaged in its study, and appropriate precautions should be taken to prevent infection. These include wearing protective clothing including, at the minimum, goggles, mask, waterproof apron, and gloves. The handling of the virus should be carried out under a hood so designed that the air flows away from the worker to the exhaust, and on the way passes through a battery of ultraviolet lights and a heated chimney. Laminar-flow hoods which achieve the same purpose are standard equipment in most laboratories (Gear, 1988).
-
Disposal:
B. Culturing Information:
-
Cell Culture Infomation
:
-
Description:
Rift Valley fever virus replicated readily in most common cell cultures; the virus is cytopathic and forms plaques (Gonzales-Scarano and Nathanson, 1996). Eleven human sera from known cases of Rift Valley fever (RVF) were obtained from the 1987 epidemic in Mauritania and served as the source of virus for these studies. Sera were inoculated directly into cell cultures (Vero, C6/36 and DBS-FRhL-2) and animals (ICR suckling mice, Lak:LVG(SYR) hamsters and WF rats) concurrently. The cell lines provided a quick method to propagate, quantitate and identify these specimens without prior adaptation. The isolates were highly virulent for suckling mice and hamsters, but not for WF rats, even after cell culture passage (Anderson et al., 1989). Vero cells are routinely used at the USAMRIID laboratory to produce RVF viral pools and titrate strains from various regions of Africa (Anderson et al., 1989).
Although isolation and titration of RVFV in suckling mice has been considered the traditional and most sensitive method, standard laboratory cell lines would appear to be a more practical and efficient alternative. In this study, cell lines allowed rapid titration of clinical specimens by an easily read plaque assay, produced virus seed stocks in certified cells acceptable for vaccine production and allowed a rapid preliminary viral identification by indirect immunofluorescence. This was possible with clinical specimens without prior adaptation of the viral isolate in tissue culture or animal systems (Anderson et al., 1989).
-
Medium:
-
The C6/36 subclone of Aedes albopictus cells was grown at 25 degrees C in HMEM medium supplemented with 5% fetal bovine sera and antibiotics. DBS-FRhL-2 and Vero cells were maintained in EMEN supplemented with non-essential amino acids, glutamine, antibiotics, and 10% heat inactivated fetal bovine serum (Anderson et al., 1989).
-
Note:
Diagnosis by viral cultivation and identification for the VHF-causing agents requires 3 to 10 days for most (longer for the hantaviruses); and, with the exception of dengue, specialized microbiologic containment is required for safe handling of these viruses (Website 14).
For isolation of VHF viruses from fatal cases, post-mortem tissues are homogenized to a concentration of 10 to 20% in sterile buffer containing antibiotics and clarified by centrifugation. Stool suspensions and urine are also centrifuged at 10,000 x g for 30 min to remove gross bacterial contamination. Attempts to isolate virus from clinical specimens should proceed using laboratory animals or cell cultures. In all cases cell culture should be used in conjunction with animal inoculation for virus isolation. Inoculated animals are examined daily for illness or death and guinea pig rectal temperatures recorded. Both CCHF and Rift Valley fever viruses produce fatal illness in suckling mice (Shepherd, 1988).
C. Diagnostic Tests
:
-
Organism Detection Tests:
-
Electron Microscopy:
-
Description:
RVF virus attained an extracellular titer of at least 3.6 logs/ml 4 hours post infection in CV-1, Vero and BHK-21 cells. At 22 hours post infection, a peak titer of 7.7 logs/ml was reached in CV-1 cells, where 50% of the cells showed cytopathic effect. The same degree of cytopathic effect was only observed 45 hour post infection in the other cell lines tested. At 22 hours post infection, RVF viral antigens were detected by indirect immunofluorescence in the three culture systems; however, the degree of fluorescence and the number of fluorescent cells were much greater in CV-1 than in either Vero or BHK-21 cells. Virus particles were detected by EM 22 hours post infection in CV-1 cells, but in Vero and BHK-21 cell only at 45 hours post infection (Mekki and Van Der Groen, 1981).
RVF virions have been visualized in post-mortem liver by electron microscopy (Shepherd, 1988).
-
Electron Microscopy and Immunofluorescence:
-
Description:
RVF virus attained an extracellular titer of at least 3.6 logs/ml 4 hours post infection in CV-1, Vero and BHK-21 cells. At 22 hours post infection, a peak titer of 7.7 logs/ml was reached in CV-1 cells, where 50% of the cells showed cytopathic effect. The same degree of cytopathic effect was only observed 45 hour post infection in the other cell lines tested. At 22 hours post infection, RVF viral antigens were detected by indirect immunofluorescence in the three culture systems; however, the degree of fluorescence and the number of fluorescent cells were much greater in CV-1 than in either Vero or BHK-21 cells. Virus particles were detected by EM 22 hours post infection in CV-1 cells, but in Vero and BHK-21 cell only at 45 hours post infection (Mekki and Van Der Groen, 1981).
Specific identification of RVF antigen has been achieved in post-mortem human liver by immunodiffusion and in animal tissues by immunofluorescence (Shepherd, 1988).
-
Rhesus monkeys inoculated with Rift Valley fever:
-
Description:
Rhesus monkeys inoculated with Rift Valley fever (RVF) virus provide a model in which serial observations of serum viral antigen and antibodies can be made. In 9 non-fatal and 3 fatal infections, either antigen or IgM enzyme-linked immunosorbent assay (ELISA) antibodies were detected in every serum sample during the acute phase. Furthermore, viral nucleic acid could be detected by filter hybridization in most samples taken on days 1 to 3. Circulation of significant quantities of viral RNA provides an additional approach to the diagnosis and study of RVF (Morrill et al., 1989).
-
Immunoassay Tests:
-
Haemagglutination:
-
Description:
A total of 76 sera from 21 individuals immunized with RVF vaccine were tested by plaque reduction neutralization test (PRNT) and ELISA IgG. Of the 76 sera, 70 were also tested by the hemagglutination inhibition (HI) and complement fixation (CF) tests. Sera from day 0 (n equals 21) and days 6 to 8 (n equals 23) were found to be negative by all methods (ELISA IgG, PRNT, HI, and CF). When bled on days 32 to 34 all had developed antibodies by PRNT (Niklasson et al., 1984).
The ELISA IgG was almost as sensitive as the PRNT, missing only one positive serum with a PRNT titer of 1:80. Of the 32 sera with PRNT titers of greater than or equal to 1:10, 26 were also tested by the HI and CF tests. HI was less sensitive than PRNT, detecting only 4 positive sera out of 11 sera with PRNT titers of 1:160. When tested by CF, all 26 sera were found to be negative, except one which had a CF titer of 4 and a PRNT titer of 1:640. All sera with negative PRNT results were negative in other tests (Niklasson et al., 1984).
The HI and IFA (IgG and IgM) tests are the most rapid and commonly used tests for serological diagnosis of RVF infection, antibodies generally appearing in the serum 4 to 10 days after the onset of symptoms. The reversed passive hemagglutination and inhibition (RPHI) test appears to be similar in most respects to the HI (Shepherd, 1988).
-
False Negative:
HI was less sensitive than PRNT, detecting only 4 positive sera out of 11 sera with PRNT titers of 1:160 (Niklasson et al., 1984).
-
Complement Fixation:
-
Description:
A total of 76 sera from 21 individuals immunized with RVF vaccine were tested by plaque reduction neutralization test (PRNT) and ELISA IgG. Of the 76 sera, 70 were also tested by the hemagglutination inhibition (HI) and complement fixation (CF) tests. Sera from day 0 (n equals 21) and days 6 to 8 (n equals 23) were found to be negative by all methods (ELISA IgG, PRNT, HI, and CF). When bled on days 32 to 34 all had developed antibodies by PRNT (Niklasson et al., 1984). The ELISA IgG was almost as sensitive as the PRNT, missing only one positive serum with a PRNT titer of 1:80. Of the 32 sera with PRNT titers of greater than or equal to 1:10, 26 were also tested by the HI and CF tests. HI was less sensitive than PRNT, detecting only 4 positive sera out of 11 sera with PRNT titers of 1:160. When tested by CF, all 26 sera were found to be negative, except one which had a CF titer of 4 and a PRNT titer of 1:640. All sera with negative PRNT results were negative in other tests (Niklasson et al., 1984).
-
False Negative:
When tested by CF, all 26 sera were found to be negative, except one which had a CF titer of 4 and a PRNT titer of 1:640 (Niklasson et al., 1984).
-
Sandwich and Capture ELISA:
-
Description:
We report on the development and validation of sandwich and capture ELISAs (both based on inactivated antigen) for detection of IgG and IgM antibody to Rift Valley fever virus in bovine, caprine and ovine sera. Compared to virus neutralisation and haemagglutination-inhibition tests, the IgG sandwich ELISA was more sensitive in detection of the earliest immunological responses to infection or vaccination with Rift Valley fever virus. Its sensitivity and specificity derived from field data sets ranged in different ruminant species from 99.05 to 100% and from 99.1 to 99.9%, respectively. The specificity of IgM-capture ELISA varied between different species from 97.4 to 99.4%; its sensitivity was 100% in sheep tested 5-42 days post-infection. Our results in field-collected, experimental and post-vaccination sera demonstrate that these assays will be useful for epidemiological surveillance and control programmes, import/export veterinary certification, early diagnosis of infection, and for monitoring of immune response in vaccinated animals. As highly accurate and safe tests, they have the potential to replace traditional diagnostic methods, which pose biohazard risks limiting their use outside of endemic areas to high containment facilities (Paweska et al., 2003).
-
ELISA:
-
Description:
An ascitic fluid containing a mixture of mouse monoclonal antibodies, or a control of normal mouse ascitic fluid, were diluted 1/2,000 in PBS and coated to alternate rows of the plate and incubated for 14-16 hours at 4 degrees C. After incubation, then washing, the mixture of monoclonal anti-RVFV antibodies which had been labeled with biotin was diluted 1/500 and added to all wells. Following incubation and washing, peroxidase-conjugated avidin diluted 1/2,000 was added. The plates were incubated, then washed, and substrate was added and the OD read after 60 min incubation at 37 degrees C (Meegan et al., 1989).
-
False Negative:
Eighty-two sera were positive for isolation by at least one of the three standard virus isolation techniques. When tested in the antigen detection ELISA which employed biotin-labeled monoclonal antibodies, 24 of these 82 sera (29.3%) were positive (Meegan et al., 1989). Considering the high viremia reported for patients infected with RVFV, the ELISA sensitivity of 29.3% appears low. It appears that titers of infectious virus generally must exceed 10 to the third PFU/ml of sera before the ELISA could detect antigen (Meegan et al., 1989).
-
PRNT and ELISA:
-
Description:
A total of 76 sera from 21 individuals immunized with RVF vaccine were tested by plaque reduction neutralization test (PRNT) and ELISA IgG. Of the 76 sera, 70 were also tested by the hemagglutination inhibition (HI) and complement fixation (CF) tests. Sera from day 0 (n equals 21) and days 6 to 8 (n equals 23) were found to be negative by all methods (ELISA IgG, PRNT, HI, and CF). When bled on days 32 to 34 all had developed antibodies by PRNT (Niklasson et al., 1984).
The ELISA IgG was almost as sensitive as the PRNT, missing only one positive serum with a PRNT titer of 1:80. Of the 32 sera with PRNT titers of greater than or equal to 1:10, 26 were also tested by the HI and CF tests. HI was less sensitive than PRNT, detecting only 4 positive sera out of 11 sera with PRNT titers of 1:160. When tested by CF, all 26 sera were found to be negative, except one which had a CF titer of 4 and a PRNT titer of 1:640. All sera with negative PRNT results were negative in other tests (Niklasson et al., 1984).
-
False Negative:
The ELISA IgG was almost as sensitive as the PRNT, missing only one positive serum with a PRNT titer of 1:80 (Niklasson et al., 1984).
All sera with negative PRNT results were negative in other tests (Niklasson et al., 1984).
-
Nucleic Acid Detection Tests:
:
-
Real Time RT PCR:
-
Description:
Viral hemorrhagic fevers (VHFs) are acute infections with high case fatality rates. Important VHF agents are Ebola and Marburg viruses (MBGV/EBOV), Lassa virus (LASV), Crimean-Congo hemorrhagic fever virus (CCHFV), Rift Valley fever virus (RVFV), dengue virus (DENV), and yellow fever virus (YFV). VHFs are clinically difficult to diagnose and to distinguish; a rapid and reliable laboratory diagnosis is required in suspected cases. We have established six one-step, real-time reverse transcription-PCR assays for these pathogens based on the Superscript reverse transcriptase-Platinum Taq polymerase enzyme mixture. Novel primers and/or 5'-nuclease detection probes were designed for RVFV, DENV, YFV, and CCHFV by using the latest DNA database entries. PCR products were detected in real time on a LightCycler instrument by using 5'-nuclease technology (RVFV, DENV, and YFV) or SybrGreen dye intercalation (MBGV/EBOV, LASV, and CCHFV). The inhibitory effect of SybrGreen on reverse transcription was overcome by initial immobilization of the dye in the reaction capillaries. Universal cycling conditions for SybrGreen and 5'-nuclease probe detection were established. Thus, up to three assays could be performed in parallel, facilitating rapid testing for several pathogens. All assays were thoroughly optimized and validated in terms of analytical sensitivity by using in vitro-transcribed RNA. The 95% detection limits as determined by probit regression analysis ranged from 1,545 to 2,835 viral genome equivalents/ml of serum (8.6 to 16 RNA copies per assay). The suitability of the assays was exemplified by detection and quantification of viral RNA in serum samples of VHF patients (Drosten et al., 2002).
-
Primers:
-
RVS and RVAs
-
Forward:
RVS AAAGGAACAATGGACTCTGGTCA [349-371]
-
Reverse:
RVAs CACTTCT TACTACCATGTCCTCCAAT [443-417]
-
Product
-
False Positive:
There are presently no data available on viral RNA concentrations in patients with VHF. Using the established assays, we have analyzed a few sera of patients with VHF. The RNA concentrations in all patients were orders of magnitudes above the detection limits, suggesting that the assays are sufficiently sensitive to diagnose VHF during the acute febrile phase. To define the clinical sensitivity of the assays more precisely would require testing of well-characterized serum panels from patients with different courses of VHF and in different stages of the disease. However, such panels are not available. The possibility of quantifying viral RNA may prove to be useful in therapy monitoring and to estimate the prognosis (Drosten et al., 2002).
-
False Negative:
There are presently no data available on viral RNA concentrations in patients with VHF. Using the established assays, we have analyzed a few sera of patients with VHF. The RNA concentrations in all patients were orders of magnitudes above the detection limits, suggesting that the assays are sufficiently sensitive to diagnose VHF during the acute febrile phase. To define the clinical sensitivity of the assays more precisely would require testing of well-characterized serum panels from patients with different courses of VHF and in different stages of the disease. However, such panels are not available. The possibility of quantifying viral RNA may prove to be useful in therapy monitoring and to estimate the prognosis (Drosten et al., 2002).
-
RT PCR:
-
Description:
A single tube or a nested reverse transcriptase polymerase chain reaction (RT-PCR) method focusing on the NSs coding region of the S segment was developed and used to detect the RVF virus (RVFV) genome, resulting respectively in the synthesis of 810 and 662 bp DNA amplimers. The assay was specific for RVFV and did not amplify any other phleboviruses known to circulate in sub-Saharan Africa. When serial dilutions of RVFV were artificially mixed with human normal serum, the minimal detection limits were 50 and 0.5 plaque forming units respectively using the simple and the nested RT-PCR. The RT-PCR method was efficient for the detection of RVFV RNA in the blood from experimentally RVFV-infected mice and lamb and the nested RT PCR was found more sensitive than the virus isolation method. Additionally, this detection method was applied successfully for the diagnosis of human cases during the 1998 Mauritanian outbreak (Sall et al., 2001).
-
Primers:
-
NSca and NSng
-
Forward:
NSca primer 5'-CCTTAACCTCTAATCAAC-3'
-
Reverse:
NSng 5'-TATCATGGATTACTTTCC-3'
-
NS3a and NS2g
-
Forward:
NS3a 5'-ATGCTGGGAAGTGATGAGCG-3'
-
Reverse:
NS2g 5'-GATTTGCAGAGTGGTCGTC-3'
-
Product
-
False Positive:
If we consider VI to be the gold standard method, 12 samples were positive by RT-PCR and 17 were positive by VI, indicating that the sensitivity of RT-PCR is 70.6% (12 of 17 samples). The value of 97.1% (268 of 276 samples) was obtained for the specificity, taking into account the 268 sera which tested negative by RT-PCR out of a total of 276 negative samples. While the specificity of RT-PCR appeared to be high enough for diagnostic purposes, the sensitivity, even though acceptable, would need to be improved because of the explosive nature of RVF emergence. However, the apparent low value obtained for sensitivity may be due to the choice of VI as the gold standard. Indeed, among the 293 samples analyzed, if we consider any sample testing positive by VI and/or RT-PCR as indicative of RVF, we can consider 25 samples to be positive. Therefore, the sensitivity would be 80% (20 of 25 samples) for RT-PCR and 68% (17 of 25 samples) for VI (Sall et al., 2002).
-
False Negative:
If we consider VI to be the gold standard method, 12 samples were positive by RT-PCR and 17 were positive by VI, indicating that the sensitivity of RT-PCR is 70.6% (12 of 17 samples). The value of 97.1% (268 of 276 samples) was obtained for the specificity, taking into account the 268 sera which tested negative by RT-PCR out of a total of 276 negative samples. While the specificity of RT-PCR appeared to be high enough for diagnostic purposes, the sensitivity, even though acceptable, would need to be improved because of the explosive nature of RVF emergence. However, the apparent low value obtained for sensitivity may be due to the choice of VI as the gold standard. Indeed, among the 293 samples analyzed, if we consider any sample testing positive by VI and/or RT-PCR as indicative of RVF, we can consider 25 samples to be positive. Therefore, the sensitivity would be 80% (20 of 25 samples) for RT-PCR and 68% (17 of 25 samples) for VI (Sall et al., 2002).
-
PCR to identify the S RNA Segment:
-
Description:
A method for quantifying the small RNA segment by a real-time detection reverse transcription (RT)-PCR using TaqMan technology and targeting the nonstructural protein-coding region was developed, and primers and a probe were designed. After optimization of the amplification reaction and establishment of a calibration curve with synthetic RNA transcribed in vitro from a plasmid containing the gene of interest, real-time RT-PCR was assessed with samples consisting of RVFV from infected Vero cells. The method was found to be specific for RVFV, and it was successfully applied to the detection of the RVFV genome in animal sera infected with RVFV as well as to the assessment of the efficiency of various drugs (ribavirin, alpha interferon, 6-azauridine, and glycyrrhizin) for antiviral activity. Altogether, the results indicated a strong correlation between the infectious virus titer and the amount of viral genome assayed by real time RT-PCR. This novel method could be of great interest for the rapid diagnosis and screening of new antiviral compounds, as it is sensitive and time saving and does not require manipulation of infectious material (Garcia et al., 2001).
-
Primers:
-
S432 and NS3m
-
Forward:
S432 5'-ATG ATG ACA TTA GAA GG GA 3'
-
Reverse:
NS3m 5'ATG CTG GGA AGT GAT GAG 3'
-
False Positive:
The sensitivity of this RVFV assay was evaluated using synthetic and viral RNA and was shown to be less than 100 RNA copies per run or less than 10 TCID50 ml, which is equivalent to the sensitivity of the traditional RT-PCR already described (Garcia et al., 2001).
-
False Negative:
The sensitivity of this RVFV assay was evaluated using synthetic and viral RNA and was shown to be less than 100 RNA copies per run or less than 10 TCID50 ml, which is equivalent to the sensitivity of the traditional RT-PCR already described (Garcia et al., 2001).
-
RT PCR used in Mosquito:
-
Description:
A reverse transcriptase-polymerase chain reaction (RT-PCR) assay to detect Rift Valley fever (RVF) virus RNA in experimentally infected mosquitoes was developed. The specificity of the assay was evaluated with three other phleboviruses; sandfly fever Sicilian (Sabin), sandfly fever Naples (Sabin) and Punta Toro (MSP 3) viruses. The relative sensitivity of the assay, determined by using RVF virus RNA extracted from serial dilutions of virus culture, was approximately 50 plaque forming units. This sensitivity level was 100-fold higher when a nested PCR procedure was used. When the RT-PCR assay was used with coded samples of intrathoracically-infected and uninfected mosquito, the assay detected the virus in all infected mosquitoes. With this assay, it was possible to detect RVF virus RNA in a single infected mosquito in the background of 10, 25 or 50 uninfected mosquitoes (Ibrahim et al., 1997).
-
Primers:
-
RVF1 and RVF2
-
Forward:
RVF1 777/ 5' GAC TAC CAG TCA GCT CAT TAC C 3'/798
-
Reverse:
RVF2 1327/5' TG TGA ACA ATA GGC ATT GG 3'/1309
-
Product
-
RVF3 and RVF4
-
Forward:
RVF3 876/5' CAG ATG ACA GGT GCT AGC 3'/893
-
Reverse:
RVF4 1249/5' CT ACC ATG TCC TCC AAT CTT GG 3'/1228
-
Product
-
Other Types of Diagnostic Tests:
No other tests available here.
V. References
A. Journal References:
Anderson et al., 1988:
Anderson Jr G.W. ,
Slone Jr T.W. ,
Peters C.J. The gerbil, Meriones unguiculatus, a model for Rift Valley fever viral encephalitis .
Arch Virol .
1988 ;
102 ( 3-4 ):
187 -
196 .
[PubMed:
3060046].
Anderson et al., 1989:
Anderson Jr G.W. ,
Saluzzo J.F. ,
Ksiazek T.G. , Smith JF, Ennis W, Thureen D, Peters CJ, Digoutte JP. Comparison of in vitro and in vivo systems for propagation of Rift Valley fever virus from clinical specimens .
Res Virol .
1989 ;
140 ( 2 ):
129 -
138 .
[PubMed:
2756240].
Drosten et al., 2002:
Drosten C. ,
Gottig S. ,
Schilling S. , Asper M, Panning M, Schmitz H, Gunther S. Rapid detection and quantification of RNA of Ebola and Marburg viruses, Lassa virus, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, dengue virus, and yellow fever virus by real-time reverse transcription-PCR .
J Clin Microbiol .
2002 ;
40 ( 7 ):
2323 -
2330 .
[PubMed:
12089242].
Ellis et al., 1988:
Ellis D.S. ,
Shirodaria P.V. ,
Fleming E. , Simpson Morphology and development of Rift Valley fever virus in Vero cell cultures .
J Med Virol .
1988 ;
24 ( 2 ):
161 -
174 .
[PubMed:
3280732].
Franz et al., 1997:
Franz David R. ,
Jahrling Peter B. ,
Friedlander Arthur M. , McClain DJ, Hoover DL, Bryne WR, Pavlin JA, Christopher GW, Eitzen EM Jr. Clinical recognition and management of patients exposed to biological warfare agents .
JAMA .
1997 ;
278 ( 5 ):
399 -
411 .
[PubMed:
9244332].
Garcia et al., 2001:
Garcia S. ,
Crance J.M. ,
Billecocq A. , Peinnequin A, Jouan A, Bouloy M, Garin D. Quantitative real-time PCR detection of Rift Valley fever virus and its application to evaluation of antiviral compounds .
J Clin Microbiol .
2001 ;
39 ( 12 ):
4456 -
4461 .
[PubMed:
11724861].
Giorgi et al., 1991:
Giorgi C. ,
Accardi L. ,
Nicoletti L. , Gro MC, Takehara K, Hilditch C, Morikawa S, Bishop DH. Sequences and coding strategies of the S RNAs of Toscana and Rift Valley fever viruses compared to those of Punta Toro, Sicilian Sandfly fever, and Uukuniemi viruses .
Virology .
1991 ;
180 ( 2 ):
738 -
753 .
[PubMed:
1846496].
Gubler, 2002:
Gubler Duane The Global Emergence/Resurgence of Arboviral Diseases As Public Health Problems .
Archives of Medical Research .
2002 ;
33 ( 4 ):
330 -
342 .
[PubMed:
12234522].
Ibrahim et al., 1997:
Ibrahim M.S. ,
Turell M.J. ,
Knauert F.K. , Lofts RS. Detection of Rift Valley fever virus in mosquitoes by RT-PCR .
Molecular and Cellular Probes .
1997 ;
11 ( 1 ):
49 -
53 .
[PubMed:
9076714].
Isaacson, 2001:
Isaacson Margaretha Viral Hemorrhagic Fever Hazards for Travelers in Africa .
Clinical Infectious Diseases .
2001 ;
33 ( 10 ):
1707 -
1712 .
[PubMed:
11595975].
Kende et al., 1987:
Kende M. ,
Lupton H.W. ,
Rill W.L. , Gibbs P, Levy HB, Canonico PG. Ranking of prophylactic efficacy of poly(ICLC) against Rift Valley fever virus infection in mice by incremental relative risk of death .
Antimicrob Agents Chemother .
1987 ;
31 ( 8 ):
1194 -
1198 .
[PubMed:
3631943].
Lupi and Tyring, 2003:
Lupi O,
Tyring SK. Tropical dermatology: viral tropical diseases..
J Am Acad Dermatol..
2003;
49(6):
979 -
1000.
[PubMed:
14639375].
Madani et al., 2003:
Madani TA,
Al-Mazrou YY,
Al-Jeffri MH, Mishkhas AA, Al-Rabeah AM, Turkistani AM, Al-Sayed MO, Abodahish AA, Khan AS, Ksiazek TG, Shobokshi O.
Rift Valley fever epidemic in Saudi Arabia: epidemiological, clinical, and laboratory characteristics..
Clin Infect Dis.
2003;
37(8):
1084 -
1092.
[PubMed:
14523773].
Meegan et al., 1989:
Meegan J. ,
Le Guenno B. ,
Ksiazek T. , Jouan A, Knauert F, Digoutte JP, Peters CJ. Rapid diagnosis of Rift Valley Fever: A comparison of methods for the direct detection of viral antigen in human sera .
Res Virol .
1989 ;
140 ( 1 ):
59 -
65 .
[PubMed:
2711046].
Mekki and Van Der Groen, 1981:
Mekki A.A. ,
Van Der Groen G. A comparison of indirect immunofluorescence and electron microscopy for the diagnosis of some haemorrhagic viruses in cell cultures .
Journal of Virological Methods .
1981 ;
3 ( 2 ):
61 -
69 .
[PubMed:
7024293].
MMWR, 1988:
Center for Disease Control and Prevention Management of Patients with Suspected Viral Hemorrhagic Fever .
Morb Mortal Weekly Report .
1988 ;
37 ( Supplemental 3 ):
1 -
16 .
[PubMed:
3126390].
Morrill et al., 1989:
Morrill J.C. ,
Knauert F.K. ,
Ksiazek T.G. , Meegan JM, Peters CJ. Rift Valley fever infection of rhesus monkeys: implications for rapid diagnosis of human disease .
Res Virol .
1989 ;
140 ( 2 ):
139 -
146 .
[PubMed:
2756241].
Niklasson et al., 1984:
Niklasson B. ,
Peters C.J. ,
Grandien M. , Wood Detection of human immunoglobulins G and M antibodies to Rift Valley fever virus by enzyme-linked immunosorbent assay .
J Clin Microbiol. .
1984 ;
19 ( 2 ):
225 -
229 .
[PubMed:
6538206].
Paweska et al., 2003:
Paweska JT,
Burt FJ,
Anthony F, Smith SJ, Grobbelaar AA, Croft JE, Ksiazek TG, Swanepoel R. IgG-sandwich and IgM-capture enzyme-linked immunosorbent assay for the detection of antibody to Rift Valley fever virus in domestic ruminants..
J Virol Methods..
2003;
113(2):
103 -
112.
[PubMed:
14553896].
Pittman et al., 1999:
Pittman Phillip R. ,
Liu C.T. ,
Cannon Timothy L. , Makuch RS, Mangiafico JA, Gibbs PH, Peters CJ. Immunogenicity of an inactivated Rift Valley fever vaccine in humans: a 12-year experience .
Vaccine .
1999 ;
18 ( 1-2 ):
181 -
189 .
[PubMed:
10501248].
Ritter et al., 2000:
Ritter M. ,
Bouloy M. ,
Vialat P. , Janzen C, Haller O, Frese M. Resistance to Rift Valley fever virus in Rattus norvegicus: genetic variability within certain 'inbred' strains .
J Gen Virol .
2000 ;
81 ( 11 ):
2683 -
2688 .
[PubMed:
11038380].
Sall et al., 1998:
Sall A.A. ,
Zanotto P. M. ,
Vialat P. , Sene OK, Bouloy M. Molecular epidemiology and emergence of Rift Valley fever .
Mem Inst Oswaldo Cruz .
1998 ;
93 ( 5 ):
609 -
614 .
[PubMed:
9830526].
Sall et al., 2001:
Sall A.A. ,
Thonnon J. ,
Sene O.K. , Fall A, Ndiaye M, Baudez B, Mathiot C, Bouloy M. Single-tube and nested reverse transcriptase-polymerase chain reaction for detection of Rift Valley fever virus in human and animal sera .
Journal of Virological Methods .
2001 ;
91 ( 1 ):
85 -
92 .
[PubMed:
11164489].
Sall et al., 2002:
Sall A.A. ,
Macondo E.A. ,
Sene O.K. , Diagne M, Sylla R, Mondo M, Girault L, Marrama L, Spiegel A, Diallo M, Bouloy M, Mathiot C. Use of reverse transcriptase PCR in early diagnosis of Rift Valley fever .
Clinical and Diagnostic Laboratory Immunology .
2002 ;
9 ( 3 ):
713 -
715 .
[PubMed:
11986283].
Vialat et al., 1997:
Vialat P. ,
Muller R. ,
Vu T.H. , Prehaud C, Bouloy M. Mapping of the mutations present in the genome of the Rift Valley fever virus attenuated MP12 strain and their putative role in attenuation .
Virus Res .
1997 ;
52 ( 1 ):
43 -
50 .
[PubMed:
9453143].
B. Book References:
Gear, 1988:
Gear J.H.S. Rift Valley Fever .
101 -
118 .
In: Gear J.H.S. Handbook of viral and rickettsial hemorrhagic fevers 1988 .
CRC Press Inc ,
Boca Raton, Florida .
Giorgi, 1996:
Giorgi Colomba Molecular Biology of Phleboviruses .
105 -
128 .
In: Elliott Richard M. The Bunyaviridae 1996 .
Plenum Press ,
New York .
Gonzales-Scarano and Nathanson, 1996:
Gonzales-Scarano Francisco ,
Nathanson Neal Bunyaviridae .
1473 -
1504 .
In: Fields Bernard N. ,
Knipe David M. ,
Howley Peter M. Field's Virology Third Edition Volume 1 1996 .
Lippincott-Raven Publishers ,
Philadelphia PA .
Meegan and Bailey, 1989:
Meegan James M. ,
Bailey Charles L. Rift Valley Fever .
51 -
76 .
In: Monath Thomas P. The Arboviruses: Epidemiology and Ecology Volume IV 1989 .
CRC Press ,
Boca Raton, Florida .
Shepherd, 1988:
Shepherd A.J. Viral Hemorrhagic Fevers: Laboratory Diagnosis .
241 -
250 .
In: Gear J.H.S. Handbook of viral and rickettsial hemorrhagic fevers 1988 .
CRC Press Inc ,
Boca Raton, Florida .
C. Website References:
Website 1:
Rift Valley fever virus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=11588&lvl=3&keep=1&srchmode=1&unlock
].
Website 2:
Rift Valley Fever [
http://www.cdc.gov/ncidod/dvrd/spb/mnpages/dispages/rvf.htm
].
Website 3:
Rift valley fever virus (STRAIN ZH-548 M12) [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=11589&lvl=3&keep=1&srchmode=1&unlock
].
Website 4:
Homo sapiens [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Tree&id=9606&lvl=3&keep=1&srchmode=1&unlock
].
Website 5:
Bos taurus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9913&lvl=3&keep=1&srchmode=1&unlock
].
Website 6:
Capra hircus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9925&lvl=3&keep=1&srchmode=1&unlock
].
Website 7:
Ovis aries [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9940&lvl=3&keep=1&srchmode=1&unlock
].
Website 8:
Culicidae [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=7157&lvl=3&keep=1&srchmode=1&unlock
].
Website 9:
Culex pipiens [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=7175&lvl=3&keep=1&srchmode=1&unlock
].
Website 10:
Aedes [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=7158&lvl=3&keep=1&srchmode=1&unlock
].
Website 11:
Rift Valley fever virus S segment, complete sequence [
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_uids=9632365&dopt=GenBank
].
Website 12:
Rift Valley fever virus M segment, complete sequence [
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_uids=9632363&dopt=GenBank
].
Website 13:
Rift Valley fever virus L segment, complete sequence [
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_uids=9632361&dopt=GenBank
].
Website 14:
Viral Hemorrhagic Fevers [
http://www.vnh.org/MedAspChemBioWar/chapters/chapter_29.htm
].
Website 15:
Viral Hemorrhagic Fevers [
http://www.emedicine.com/ped/topic2406.htm
].
Website 16:
Rattus norvegicus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=10116
].
Website 17:
BMBL Section VII. Agent Summary Statements. Section VII: Table 4 - Arboviruses and Certain Other Viruses Assigned to Biosafety Level 3 [
http://www.cdc.gov/od/ohs/biosfty/bmbl4/bmbl4s74.htm
].
Website 18:
Meriones unguiculatus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=10047
].
Website 19:
UCDavis School Of Veterinary Medicine Virus Images [
http://www.vetmed.ucdavis.edu/viruses/download.html
].
D. Thesis References:
No thesis or dissertation references used.
VI. Curation Information
-
Curators:
Rebecca Wattam (wattam@vbi.vt.edu)
-
Date: 05/11/2004
-
Version: 1.0
-
Contact information:
- Email: pathinfo@vbi.vt.edu