Rabies

I. Organism Information

A. Taxonomy Information
  1. Species:
    1. Rabies virus :
      1. Ontology: UMLS:C0034497
      2. GenBank Taxonomy No.: 11292
      3. Description: Rabies viruses belong to the Rhabdoviridae family, a constituent of the order Mononegavirales in which the viruses are characterized by a non-segmented negative-sense genome. The family is divided into two serologically distinct genera, Vesiculovirus and Lyssavirus. The Vesiculovirus genus includes the viruses causing vesicular stomatitis and antigenically related viruses and the Lyssavirus genus includes rabies, the rabies-related viruses, and many others which share only a distant relationship to rabies (King, 1998). The Lyssavirus genus includes seven genotypes: rabies virus (RABV, genotype 1), Lagos bat virus (genotype 2), Mokola virus (genotype 3), Duvenhage virus (genotype 4), European bat lyssavirus 1 (EBLV-1, genotype 5), European bat lyssavirus 2 (EBLV-2, genotype 6), and Australian bat lyssavirus (ABLV, genotype 7) (Arai et al., 2003). In addition to the rabies virus (RABV, genotype 1), Mokola virus (genotype 3), Duvenhage virus (genotype 4) , European bat lyssavirus 1 (genotype 5), European bat lyssavirus 2 (genotype 6), and Australian bat lyssavirus (genotype 7) have been associated with cases of human rabies (Jackson, 2002). Within each genotype, sublineages correspond to variants circulating in specific geographical regions and/or animal hosts. The genotypes further segregate in two phylogroups including genotypes 1, 4, 5, 6 and 7 (phylogroup I); and 2 and 3 (phylogroup II). Viruses of each phylogroup differ in their biological properties (pathogenicity, induction of apoptosis, cell receptor recognition, etc.). This classification will evolve, particularly as surveillance for bat lyssaviruses is reinforced. Four recent isolates of bat lyssavirus in Central Asia (Aravan virus (ARAV), Khujand virus (KHUV), East Siberia (Irkut virus (IRKV) and the Caucasian region (West Caucasian bat virus (WCBV) need to be characterized as new genotypes (WHO, 2002). Genotypes 2 - 4 have a wide geographical distribution in Africa, while genotypes 5 and 6 have a western and eastern Europe distribution, respectively (Heaton et al., 1999).
      4. Variant(s):
        • Rabies virus (strain AVO1) :
          • GenBank Taxonomy No.: 11293
          • Description: Strain AVO1 is the avirulent mutant of the CVS strain of rabies virus carrying a mutation in position 333 of the glycoprotein (Lafay et al., 1991).
        • Rabies virus (strain CVS-11) :
          • GenBank Taxonomy No.: 11294
          • Description: Challenge virus standard (CVS) is the mouse-brain strain of fixed rabies virus (WHO, 1973). CVS was first isolated in1882 from cow in France (Heaton et al., 1999). Highly neurovirulent strains such as the challenge virus standard (CVS) are highly neurotropic (Thoulouze et al., 1997).
        • Rabies virus (strain ERA) :
          • GenBank Taxonomy No.: 11295
          • Description: ERA strain of SAD virus (35-45 passages), porcine cell culture (WHO, 1973). Oral vaccination of foxes with the attenuated live virus Street Alabama Dufferin (SAD) strain of rabies virus which has been designated ERA, has been shown to be effective in the laboratory and has been used in field trials. Vaccination by the parenteral route with the ERA strain of rabies vaccine, produces a long duration of immunity, at least 4 years in cattle and 5 and 4 years, respectively, in dogs and cats. Foxes consuming a single bait containing the ERA strain of rabies virus were protected after 48 months against challenge with virulent virus (Lawson et al., 1997).
        • Rabies virus (strain HEP-FLURY) :
          • GenBank Taxonomy No.: 11296
          • Description: HEP Flury (227-230 passages) chick embryo-adapted rabies virus (WHO, 1973). Flury high egg passage (Flury-HEP) or Flury low egg passage (Flury-LEP) rabies virus strain used to produce two different types of purified chick embryo cell rabies vaccine (PCECV) (Moore et al., 2002).
        • Rabies virus (strain Nishigahara RCEH) :
          • GenBank Taxonomy No.: 11298
          • Description: The Nishigahara strain of rabies virus, a seed strain used for animal vaccine production in Japan, is believed to have been derived from the original Pasteur strain obtained from Paris in or before 1915. In Japan, the virus was serially passaged through several kinds of animals and cell cultures (Sakamoto et al., 1994). The virulent Nishigahara strain, kills adult mice after intracerebral inoculation (Takayama-Ito et al., 2006).
        • Rabies virus (strain Ontario fox) :
          • GenBank Taxonomy No.: 37132
          • Description: During the 1940s rabies in foxes spread into the Canadian provinces from the Artic regions and although in most of these regions it later died out, the disease has persisted in foxes in Ontario (King, 1998).
        • Rabies virus (strain ontario skunk) :
          • GenBank Taxonomy No.: 39005
          • Description: Although rabies outbreaks in most parts of the world tend to be host species-specific the rabies currently enzootic in the Canadian province of Ontario is hosted by two wildlife species, the red fox and the striped skunk (Nadin-Davis et al., 1993). Rabies in skunks spread from North Dakota into the prairie provinces during the late 1959s and 1960s (King, 1998).
        • Rabies virus (strain Pasteur / PV) :
          • GenBank Taxonomy No.: 103929
          • Description: Paris Pasteur strain of rabbit fixed rabies virus (WHO, 1973).
        • Rabies virus (strain PM) :
          • GenBank Taxonomy No.: 11297
          • Description: The PM (Pittman Moore) and Kissling rabies virus strains originated from the brain of a rabid cow in France in 1882. PM rabies virus strain used to produce human diploid cell rabies vaccine (HDCV), purified Vero cell rabies vaccine (PVRV) and purified duck embryo cell rabies vaccine (PDEV) (Moore et al., 2002). The Pitman-Moore (PM) strain is also designated as the PV-11 strain of Pasteur rabbit fixed rabies virus (WHO, 1973).
        • Rabies virus (strain SAD B19) :
          • GenBank Taxonomy No.: 11300
          • Description: The SAD strain (Street Alabama Dufferin) was originally isolated from a dog in Alabama, the USA, in 1935. Different variants, used for production of oral vaccines, were derived from that strain: SAD-Bern, SAD-B19, ERA, SAG, SAG2, Vnukovo-32 (Ondrejka et al., 2001).
        • Rabies virus (strain Street) :
          • GenBank Taxonomy No.: 31613
          • Description: When first isolated from natural human or animal hosts, rabies virus preserves its natural properties and is referred to as street virus. After adaptation to experimental animals by prolonged serial intracranial passage, a virus strain with altered properties is produced, and is referred to as fixed virus (Cohen, 1969). Most of the street virus isolates generally cause a lethal CNS infection (Tsiang, 1988).
        • Rabies virus (strain vnukovo-32) :
          • GenBank Taxonomy No.: 45418
          • Description: The vnukovo-32 strain of SAD virus (90-100 passages at 32 C), in primary hamster kidney-cell cultures, for live and killed-virus vaccine (WHO, 1973). The SAD strain (Street Alabama Dufferin) was originally isolated from a dog in Alabama, the USA, in 1935. Different variants, used for production of oral vaccines, were derived from that strain: SAD-Bern, SAD-B19, ERA, SAG, SAG2, Vnukovo-32. The Vnukovo-32/107 vaccination strain has been used to produce oral rabies vaccine Kamark for immunization of free living carnivores (Ondrejka et al., 2001).
        • Rabies virus Eth2003 :
          • GenBank Taxonomy No.: 265000
          • Description: Rabies virus Eth2003 was identified as the causative agent in the outbreak of rabies in the world's rarest canid, the endangered Ethiopian wolf (Canis simensis) in the Bale Mountains, Ethiopia, in 2003 and 2004 (Randall et al., 2004).
        • Thailand genotype 1 dog lyssavirus :
          • GenBank Taxonomy No.: 274042
          • Description: Rabies virus isolated in two dog-faced fruit bats (Cyanopterus brachyotis) in Thailand (Smith et al., 1967).
        • Rabies virus (strain RC-HL) :
          • GenBank Taxonomy No.: 11292
          • Description: RC-HL is an attenuated strain of Nishigahara strain of the rabies virus. It is used for the production of animal vaccine in Japan (Ito et al., 2001). The RC-HL strain was established from the Nishigahara strain, which had been maintained by rabbit brain passages, after 294 passages in chicken embryos, 8 passages in chicken embryo fibroblast cells, 5 passages in Vero cells, and 23 passages in hamster lung cells (Ito et al., 2001).
        • Rabies virus serotype 1 :
          • GenBank Taxonomy No.: 11292
          • Description: Rabies virus serotype 1, genotype 1, of the genus Lyssavirus, is an assembly of virus variants or genetic lineages each closely allied to a single speies of mammal. These rabies variants can be defferentiated by their antigenic makeup, as well as by characteristic patterns of nucleotide substitution in their RNA genome. This molecular variation has permitted identification of primary reservoir hosts for virus variants, detailed descriptions of the geographic destribution of variants, and identification of virus spillover into animals and humans (Childs, 2002).
        • Rabies virus strain SHBRV-18 :
          • GenBank Taxonomy No.: 11292
          • Description: Rabies virus SHBRV-18 is a highly neurotropic strain (Dietschold et al., 2005). The silver-haired bat variant of rabies virus (SHBRV) has been identified as the etiological agent of a number of recent human rabies cases in the United States without a history of conventional exposure (Morimoto et al., 1996).
        • Rabies virus strain SRV9 :
          • GenBank Taxonomy No.: 11292
          • Description: Oral vaccine candidate of Rabies virus, strain SRV9 is an intermediate plaque subclone of SAD B19 and has been used in the field with good safety and immunogenicity (Yuan et al., 2003).
        • Rabies virus strain:Ni-CE :
          • GenBank Taxonomy No.: 11292
          • Description: The attenuated Ni-CE strain causes nonlethal infection in adult mice after intracerebral inoculation (NCBI Entrez).
        • Rabies virus strain Flury-LEP :
          • Description: The Flury-LEP strain originated from a human patient in the USA who died of rabies in 1939 (Moore et al., 2002). LEP Flury (40-50 passages) chick embryo-adapted rabies virus (WHO, 1973).
        • Kissling rabies virus strain :
          • Description: The PM and Kissling rabies virus strains originated from the brain of a rabid cow in France in 1882. Kissling rabies virus strain of Challenge Virus Standard (CVS) is used to produce rabies vaccine adsorbed (RVA) (Moore et al., 2002).
    2. Lagos bat virus :
      1. Ontology: UMLS:C0318815
      2. GenBank Taxonomy No.: 38766
      3. Description: Lagos bat virus was isolated from frugivorous bats (Eidolon helvum) in Nigeria in 1956 and in 1974 from another bat (Micropterus pusillus) in the Central Africa Republic (Arai et al., 2003). It was later isolated from other bat species in Senegal and South Africa (WHO, 2002).
    3. Mokola lyssavirus :
      1. Ontology: UMLS:C0238283
      2. GenBank Taxonomy No.: 12538
      3. Description: Mokola virus was first isolated from shrews (Crocidura sp.) and a child in Nigeria in 1968, a girl in Nigeria in 1971, and cats in Zimbabwe (Arai et al., 2003). Since then isolations of this virus have been reported from shrews in Nigeria and Cameroon, humans in Nigeria, domestic cats in Zimbabwe, Ethiopia and South Africa, a domestic dog from Zimbabwe and a rodent, Lophuromys sikapusi, from the Central African Republic (Nel et al., 2000). Mokola virus is among the most genetically distant from rabies virus (genotype 1), and modern anti-rabies vaccines fail to protect against Mokola virus infection. Mokola virus has been responsible for a few cases of human and animal encephalomyelitis, largely dispersed throughout sub-saharian Africa (Le Mercier et al., 1997).
    4. Duvenhage virus :
      1. Ontology: UMLS:C0318813
      2. GenBank Taxonomy No.: 38767
      3. Description: Duvenhage virus was originally isolated from a human who died after being bitten by a bat in South Africa in 1970 and from Miniopterus sp. bats in 1981 (Arai et al., 2003).
    5. European bat Lyssavirus 1 :
      1. Ontology: UMLS:C1020183
      2. GenBank Taxonomy No.: 57482
      3. Description: EBLV-1 was isolated from bats (Eptesicus serotinus) in Germany in 1968, in Poland in 1985, in Denmark, Holland, and Spain in 1987, and in France in 1989. Some isolates of EBLV-1 were obtained from bats in Ukraine and from one human case of bat origin in Russia in 1985 (Arai et al., 2003). In 1985, an 11-year-old from Belgorod, Russia, was bitten on the lower lip by an unidentified bat and died with signs of rabies. The virus isolate was called Yuli virus and classified as European bat Lyssaviruses type 1 (genotype 5) (Jackson, 2002).
    6. European bat Lyssavirus 2 :
      1. Ontology: UMLS:C1020184
      2. GenBank Taxonomy No.: 57483
      3. Description: EBLV-2 was isolated from a human in Finland in 1985, and from bats in Holland, the Netherlands, Switzerland, and the United Kingdom. EBLV-2 is mainly carried by bats of the Myotis genus (Myotis dasycneme and M. daubentonii). ABLV was isolated from five species of flying fox bats, one species of an insectivorous bat, and two infected humans in 1996 (Arai et al., 2003).
    7. Australian bat Lyssavirus (ABLV) :
      1. Ontology: UMLS:C0949533
      2. GenBank Taxonomy No.: 90961
      3. Description: The Australian bat lyssavirus (ABLV) is a new lyssavirus closely related to classical rabies virus (Mackenzie, 2005). Rabies-related viruses in Australia have been identified as Australian bat lyssavirus (ABLV), found to date only in bats and following two fatal human cases. ABLV circulates as two variants, isolated respectively from flying foxes (Pteropus alecto) and an insectivorous bat species (Saccolaimus flaviventris), both assigned to genotype 7 (Lunt, 2006). Seemingly, these bat lyssaviruses are distributed throughout New South Wales, Queensland, Victoria and the Northern Territory, have been documented since at least 1995 (Niezgoda et al., 2002).
B. Lifecycle Information :
  1. Virion :
    1. Size: Approximately 100 to 430 nm long and 45 to 100 nm in diameter, when mature. Animal rhabdoviruses are usually less than 180 nm, but those isolated from plants may be longer (de Mattos et al., 2001).
    2. Shape: Rhabdoviruses are enveloped, rod-shaped particles. Typically, mature virions appear either as bullet-shaped particles with one rounded and one flattened end, or as bacilliform particles that appear hemispherical at both ends (de Mattos et al., 2001).
    3. Picture(s):
      1. Rabies virion: Basic structure and composition



        Description: Rabies virions are bullet-shaped with 10-nm spike-like glycoprotein peplomers covering the surface. The ribonucleoprotein is composed of RNA encased in nucleoprotein, phosphorylated or phosphoprotein (CDC(a)).
      2. Rabies virion: Cross-section



        Description: The cross-sectional diagram below demonstrates the concentric layers: envelope membrane bilayer, M protein, and tightly coiled encased genomic RNA (CDC(a)).
      3. Cycle of Infection and Replication



        Description: Cycle of Infection and Replication of the human rabies virus (copyright: CDC) (CDC(a)).
    4. Other:
      1. Stages of Replication The replication and assembly of members of the Rhabdoviridae family can be divided into distinct stages. Although many of these events occur simultaneously in an infected cell, it is convenient to consider the process of infection as a linear series of events that proceeds in the following order: adsorption, entry and uncoating, transcription, replication, assembly and binding (Rose and Whitt, 2001). Rhabdoviral infection is initiated by attachment of virus to a receptor on the host cell surface. The receptor for rabies virus has been controversial, and recent evidence indicates that several different receptors can be used After binding, the virions are endocytosed through a clathrin-depended pathway typical of receptor-mediated endocytosis. A membrane fusion reaction between the envelope of the endocytosed virion and the endosomal membrane catalyzed by the G protein results in the release of ribonucleoprotein (RNP) core into the host cell cytoplasm. Either concomitant with membrane fusion or immediately after, M protein dissociates from the RNP core. The combined processes of membrane fusion and M protein dissociation constitute the uncoating event for rhabdoviruses The first synthetic event that occurs after uncoating of RNPs is transcription of viral-specific mRNAs by the L-P3 polymerase complex brought into the cell by the virion. Primary transcription occurs in the absence of protein synthesis, unlike genome replication, which requires newly synthesized N and P proteins and ongoing translation During transcription, the polymerase responds to signals that result in the synthesis of the leader RNA and individual mRNAs. In contrast, during replication, the polymerase must ignore these signals and synthesize genome-length positive stranded RNA. This RNA is then replicated to form the genomic negative-stranded RNA. Encapsidation of the genome and antigenome by N protein is intimately tied to and essential for virus replication. Encapsidation occurs as the genomic RNA is synthesized rather than after the synthesis is complete. For rabies virus, leader encapsidation may also be regulated by the phosphorylation status of N protein The process of rhabdovirus assembly can be divided into three distinct phases: (a) encapsidation of newly replicated genomic RNA by N protein, (b) simultaneous condensation of the ribonucleocapsid core by M protein and association with the plasma membrane, and (c) particle development and release. The first step, encapsidation, occurs in the cytoplasm and results when nascent genomic RNA associates with newly synthesized N, P, and L proteins to form RNP complexes. These are often referred to as nucleocapsids or RNP cores. After encapsidation, the RNP complex associates with the plasma membrane and condense into a tightly coiled structure called a skeleton before release from the cell. Numerous studies have demonstrated that the matrix protein is responsible for both of these events. After RNP condensation, rhabdovirus particles are released from infected cells by budding from the cell surface. During budding, the condensed core becomes enclosed within a membrane envelope that, have molecules of virally encoded G protein and smaller amounts of normal cellular membrane proteins. G protein, however, is not needed for rabies budding, although it greatly enhances budding efficiency. The assembly of glycoproteins into rabies appears highly dependent on the rabies G cytoplasmic tail, although infectious rabies virus can be recovered when the entire cytoplasmic domain is deleted. The final step in virus budding requires a membrane fission event that results in release of the virus from the host cell. Little is know about how this occurs, but it has been suggested that the PPxY motif in M protein facilitates virus release through the recruitment of host factors that contain WW domains (Rose and Whitt, 2001).
C. Genome Summary:
  1. Genome of Rabies virus
    1. Description: Rabies virus, complete genome (NCBI Entrez)
    2. Chromosome:
      1. GenBank Accession Number: NC_001542
      2. Size: 11932 bp ss-RNA (NCBI Entrez)
      3. Gene Count: 5 (NCBI Entrez)
      4. Description: The rabies virus has a single non-segmented negative strand RNA genome. The genetic information is present in the form of a helical ribonucleoprotein complex (RNP), in which the linear RNA is tightly associated with the viral nucleoprotein. The genome of RV and VSV comprises only five genes encoding viral proteins, namely nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G) and the viral RNA polymerase (L). The order of the genes, namely 3'-N-P-M-G-L-5', is highly conserved (Finke and Conzelmann, 2005). From the 3' to the 5' end the genomic RNA encodes a leader RNA of about 50 nucleotides, followed by the genes N,P, M, G, and L. Each gene is composed of an internal protein-coding region flanked by non-translated regions. Genes are also separated by non-transcribed intergenic regions.The latter are generally short (less than 5 nucleotides) and are bordered by the start and stop signals consisting of nine-nucleotide consensus sequences that govern gene transcription. Despite the considerable length (450 nucleotides) of the G-L intergenic region, it encodes no substantial polypeptide and thus has been proposed to correspond to a remnant gene (pseudogene) (King, 1998). The P protein is an essential co-factor of the L polymerase and is required for RNA encapsidation. Both P and L are associated with the helical RNP. During budding of the virus, such RNPs are enwrapped into an envelope containing an inner layer of M protein and the transmembrane spike proteins. The G spikes are required for virus entry into cells, by interacting with cell receptors and promoting virus and cell membrane fusion. They are also the major antigens stimulating production of virus-neutralizing and protective antibodies (Finke and Conzelmann, 2005).
      5. Picture(s):
        1. Rabies Genome



          Description: The rabies virus genome is single-stranded, antisense, nonsegmented, RNA of approximately 12 kb. There is a leader-sequence (LDR) of approximately 50 nucleotides, followed by N, P, M, G, and L genes (Copyright: CDC) (CDC(a)).

  2. Genome of Mokola lyssavirus
    1. Description: Mokola virus, complete genome (NCBI Entrez)
    2. Chromosome:
      1. GenBank Accession Number: NC_006429
      2. Size: 11940 bp ss-RNA
      3. Gene Count: 5 genes
      4. Description: The Mokola virus genome is the third lyssavirus genome to be completely sequenced. Its 11939 nucleotides (nt) are extensively used for coding purposes since 90.3% (10782 nt) code for the N, P, M, G and L proteins, and only 7.3% (941 nt) are neither protein nor known signal-coding sequences (Le Mercier et al., 1997). The nucleotides of the rabies related Mokola virus (MOKV) genome are less well conserved than the PV and SAD-B19 rabies virus genomes in many regions throughout the genome, particularly in the noncoding regions and in the coding sequences of the P and G proteins (Wunner, 2002). We learn from the sequences of Pasteur Virus (PV) strain, Street Alabama Dufferin (SAD)-B19 strain, Australian bat Lyssavirus and the Mokola (MOKV) viral genomes that even for the most divergent rabies related lyssavirus (MOKV), the general organization of the genome is the same and that only slight differences are observed in the length of the genome and in the intergenic sequences between rabies and the rabies-related viruses. For example, the 3" half of the Mokola virus genome, which includes the first four nonoverlapping ORFs that code for the structural viral proteins (N, P, M, and G), is slightly longer than the PV and SAD-B19 genomes by 25 and 29 nucleotides, respectively. Both the second ORF (P gene) and the fourth ORF (G gene) of the Mokola virus genome encode proteins that are six amino acids longer and three amino acids shorter, respectively, than the corresponding ORFs in the rabies virus genome (Wunner, 2002).

  3. Genome of Australian bat Lyssavirus (ABLV)
    1. Description: Australian bat lyssavirus, complete genome (NCBI Taxonomy)
    2. Chromosome:
      1. GenBank Accession Number: NC_003243
      2. Size: 11,822 bp ss-RNA
      3. Gene Count: 5 genes
      4. Description: The nucleocapsid protein (N), matrix protein (M), phosphoprotein (P), glycoprotein (G) and polymerase (L) genes of the Australian bat lyssavirus (ABL) insectivorous isolate were compared with that previously described from a frugivorous bat (Pteropus sp.), and showed sequence divergence at both the nucleotide and amino acid sequence level of 20% and 4-12%, respectively. Comparison of deduced protein sequences of ABL isolates from Pteropus and insectivorous bats, showed that viral isolates were homologous and varied by only a few percent. However, these viruses separated into two distinct clades; those isolated from Pteropus or those from Saccolaimus flaviventris bats, when comparisons were made at the nucleotide level. Nucleoprotein sequence comparisons also showed insectivorous isolates to be of the same putative genotype (genotype 7) as that isolated from frugivorous bats (Gould et al., 2002).

II. Epidemiology Information

Rabies is an enzootic disease widespread throughout the world and is a serious problem in developing countries. Human infections and deaths are an unfortunate consequence of biologic processes of virus maintenance in which humans play no significant role. Rabies virus and the other six recognized members of the Lyssavirus genus, some of which cause diseases indistinguishable from rabies in humans, are adapted to various animals species on which they depend for their existence (Childs, 2002). Rabies is still present in Europe in 2005. Its incidence in humans remains limited (fewer than 5 human cases per year) through the application of strict prophylactic measures (anti-rabies treatment) and by means of veterinary rabies control measures in the domesticated and wild animal populations. The main indigenous animal reservoirs are: the dog in eastern European countries and on the borders with the Middle East; the fox in central and eastern Europe; the racoon dog in northeastern Europe; and the insectivorous bat throughout the entire territory (Bourhy et al., 2005). Rabies viruses have been reported in Kazakhstan, central Asia. Field rabies viruses have been isolated and characterized in Asia, specifically Pakistan, China, Indonesia, Thailand, the Philippines, Malaysia, India, and Sri Lanka. Isolation of lyssaviruses from bats has been reported only in India and Thailand; however, these viruses were reported as RABV. Recently, Arguin et al. detected neutralizing antibodies against ABLV in the serum of six bat species (Mineopterus schreibersi, Taphozous melanopogan, Philetor brachypteus, Scotophilus kuhli, Pteropus hypomelanus, and Rousettus amplexicaudatus) in the Philippines (Arai et al., 2003). The wolf still plays an important role as vector along with the dog in some regions of Iraq, Iran, Afghanistan and some republlics of the Soviet Union. In recent decades the raccoon dog, transported westwards from Siberia for fur and hunting purposes, has become a prolific vector of the disease in the western Soviet Union and Poland. The rabies type currently prevalent in Africa is canine, but in southern Africa sylvatic rabies independent of the canine cycle is found in the yellow mongoose and in the herbivorous kudu antelope. Antelope rabies became established in Namibia in 1977 and claimed the lives of 50,000 antelope annually until 1983, since when the epidemic has spontaneously regressed (Gardner and King, 1991). In central and South America, canine rabies is the cuase of many human deaths and vampire bats rabies is responsible for severe economic losses in cattle. In North America, 40 years of vaccination and pet animal control has greatly reduced canine rabies, but the disease is enzootic in foxes, skunks and raccoons. Within these species, compartmentation occurs; that is, the disease is reported in one major host species in certain geographical areas while it is reported much less frequently in the same species in other areas of endemic rabies. Rabies in insectovorous bats account for some 15% of all rabies cases in the USA ans Smith and Baer have also shown that spillover of disease from bats to terrestrial animals occurs rather more frequently than was at one time thought, although there is no suggestion that at present these bat rabies viruses cause cycles of disease in terrestrial animals (Gardner and King, 1991). Despite its relative rarity in industrialized countries, rabies continues to cause significant mortality worldwide with annual deaths estimated at over a hundred thousand. Recent epizootics in wild animals in the United States have renewed fears of rabies in this country (Wilkerson, 2000). Thirty-eight cases of human rabies occurred in the United States and its territories from 1960 to 1979. The major source of exposure to rabies has changed from indigenous dogs and cats in the 1940s and 1950s to wild carnivores and bats (11 of the 27 cases with known exposures); unusual exposures (3 cases) and exposures in a foreign country (7 cases) have also become more important. No exposure could be identified for 6 of the 38 cases (Anderson et al., 1984).

A. Outbreak Locations:
  1. Zimbabwe, Africa: During an outbreak of rabies in Zimbabwe from 1980 to 1983, the majority of the documented animal cases occured in jackals (74.3% of 404 cases; Canis mesomelus and C. adustus), but dogs were the most serious threat to humans (Childs, 2002).
  2. Canada: The first case of raccoon strain rabies in New Brunswick, reported on 12 September 2000, was retrieved from the town of Heathland in Charlotte county which lies on the US border with Maine. Between the autumn of 2000 and May 2002 many additional cases were reported from this same area; the epizootic appeared to be confined to St Stephen, the major town of the area which is in close proximity to a bridge connecting Canada with the United States, and neighbouring communities within 20 km radius of St Stephen (Nadin-Davis et al., 2006).
  3. Flores, Indonesia: Flores is an isolated previously rabies-free Indonesian island which has been experiencing a canine rabies outbreak which resulted in at least 113 human deaths. It started with the importation of three dogs from rabies endemic Sulawesi in September of 1997. Local authorities responded with massive killing of dogs starting in early 1998. Approximately 70% of the dogs, in the district where rabies had been introduced, were killed during that year, yet canine rabies still exists on Flores at this time (June 2004) (Windiyaningsih et al., 2004).
  4. Finland: Between 1988 and 1989, wildlife rabies re-appeared in Finland after 29 years of freedom from the disease. The only exception to this was a single case of human rabies which was considered to be of bat origin and was subsequently shown to be caused by European bat lyssavirus type 2 (EBLV-2). The first cases of the outbreak were recorded in April 1988 in the province of Kymi on the coast by the Gulf of Finland. Rabies was diagnosed in a dog (Canis familiaris) and a red fox (Vulpes vulpes). However, as the epizootic developed, the principal species involved was the raccoon dog (Nyctereutes procyonoides), a species introduced into the country in the 1930s (John and Fooks, 2005).
  5. Las Cruces, New Mexico: Between May 1967 and February 1968 an unusual outbreak of rabies was observed in the wild carnivore colony at the Public Health Service's Southwest Rabies Investigation Station in Las Cruces, New Mexico. Sixty-four animals died of rabies, including 39 which had no known exposure history. Investigation confirmed that direct contact transmission did not occur and suggested that airborne dissemination of virus may have been responsible for the outbreak. Probable predisposing factors included experimentation with aerosol rabies transmission and extensive use of bat rabies isolates from which a strain may have been selected which was well adapted for non-bite transmission (Winkler et al., 1972).
B. Transmission Information:
  1. From: Animal To: Animal/Human
    Mechanism: The most common mode of rabies virus transmission is through the bite and virus-containing saliva of an infected host (CDC(c)). Rabies cases are almost attributable to the bite of a rabid animal. For example, animal bites were the cause of 99.8% of 3,920 human rabies cases examined at various Pasteur Institutes between 1927 and 1946 (de Mattos et al., 2001).

  2. From: Animal To: Human
    Mechanism: Aerosol transmission of rabies can occur under some field conditions, but these involve unusual circumstances. Aerosol infection has been suggested as a result of laboratory accidents, in an unusual cave setting involving millions of Mexican free-tailed bats, and in experimental studies with a unique bat rabies virus variant (Niezgoda et al., 2002). Viral entry by the olfactory and oral routes is much less common than by bites. Relatively little experimental work has been done with routes of viral entry other than one stimulating a bite exposure (using inoculation techniques). The nasal mucosa has been shown to act as a site of viral entry by suckling guinea pigs that have inhaled street rabies virus (Jackson, 2002).

  3. From: Animal To: Animal/Human
    Mechanism: Oral exposure may result in infection, albeit with relatively low efficiency (Niezgoda et al., 2002). Handling and skinning of infected carcasses and perhaps consumption of raw infected meat have resulted in transmission of rabies (Jackson, 2002). Consumption of infected carcasses by carnivores may be the most relevant example of this scenario. For example, transmission could be enhanced through penetration of the oral or esophageal mucosa by bone fragments contaminated with highly infectious material, such as brain and salivary gland tissue. The mechanism has been hypothesized to contribute to the maintenance of artic fox rabies, where contact between potential hosts is minimal but where transmission may be facilitated due to the preservation of virus in carcasses under polar conditions. Infectious virus may be recovered months later in a frozen fox carcass during winter but could be inactivated within hours during the summer within the decomposing tissues of a road-killed raccoon in the Florida sun (Niezgoda et al., 2002).

  4. From: Human To: Human
    Mechanism: Human-to-human transmission of the rabies virus occurred in at least 8 patients worldwide who received corneal transplants from individuals who died from rabies that was undiagnosed at the time of transplant ( AHFS, 2005b). In July 2004, the Centers for Disease Control and Prevention (CDC) reported on a rabies-virus infections in four transplant patients in the USA. These patients received various organs (lung, liver, kidney) from the same donor who was not diagnosed with rabies before death. However, post-mortem diagnosis of rabies infection of the donor and of the four organ recipients was later confirmed at CDC (Dietzschold and Koprowski, 2004). Contamination of other mucous membranes, such as eyes and nose, is considered a potential exposure to rabies. However, this is largely based on human infection following corneal transplantation (Niezgoda et al., 2002). Most other reported cases of human-to-human transmission have not been well documented. Two patients with rabies from Ethiopia were described, and their only known exposure was contact with family members who died of rabies. In another incidence, A 41-year-old woman died of rabies 33 days after her 5-year-old son died of rabies; he had bitten his mother on her little finger. A 5-year-old boy presented with rabies 36 days after his mother died of rabies; he had repeatedly received kisses form his mother on his mouth during her illness. Sexual transmission of rabies is not well documented. Although natural human-to-human transmission of rabies likely occurs very rarely, anyone in direct contact with rabies patients, including family members and healthcare workers, should employ strict isolation precautions in order to minimize the risk of transmission of the virus via saliva or other secretions. Evidence of transplancental transmission of rabies virus exists from a single report from Turkey (Jackson, 2002). In the US, stringent guidelines for acceptance of donor corneas have been implemented to reduce this risk. Transmission of rabies virus from the bite of a human with rabies or a non-bite exposure to individuals infected with rabies is theoretically possible ( AHFS, 2005b).

C. Environmental Reservoir:
  1. Dog :
    1. Description: On a global basis, the domestic dog remains the most important reservoir of rabies in overall case numbers and with regard to transmission to humans. In regions where strict control of free-ranging dogs and mandatory perenteral rabies vaccination are enforced, canine rabies virus variants have been eliminated successfully. Examples of such areas include Great Britain, Japan, Canada, and the United States. Recently numerous countries in Latin America have made tremendous progressin the application of stray dog control and mass vaccination with consequent control of canine rabies and markedly reduced human rabies over large geographic areas. Although rabies has been eliminated in most European countries, canine rabies remains largely uncontrolled throughout most of Asia and Africa (Niezgoda et al., 2002). Dogs in Asia and Africa remain the main reservoir and transmitter of rabies to humans (Arai, 2005). In the Philippines, dogs (99%) are the main reservoirs of RABV, and this reflects the urban epidemiological cycle of rabies transmission, mainly from dog to dog with occasional spillover to man (Fooks et al., 2003).
    2. Survival Information: The incubation period of rabies in dogs may be as short as 10 days or as long as several months (Niezgoda et al., 2002).
  2. Fox :
    1. Description: Predominant wild reservoirs belong to the family Carnivora and include foxes in the Artic (Alopex lagopus), Canada, central and western Europe (Vulpes vulpes), and scattered foci elsewhere throughout North America (e.g., Urocyon cinereoargenteus) (de Mattos et al., 2001). Foxes in the Middle East form a wildlife reservoir (King, 1998). With its occurrence in Eurasia, North America, and northern Africa and introduction to Australia, the red fox (Vulpes vulpes) is one of the most widely distributed and abundant wild carnivores in the world. Perhaps more is known about rabies in this fox than any other wild mammal, not only related to its significance as a mojor reservoir but also due to the influence of directed research during the past 30 years, coordinated by the World Health Organization (WHO) (Niezgoda et al., 2002).
    2. Survival Information:
  3. Raccoon :
    1. Description: The common racoon (Procyon lotor) is widely distributed from Canada through Central America and was introduced into Russia and Western Europe as well as onto a number of islands, including Japan. Over the past 50 years, racoons have become recognized as a significant host of wildlife rabies in North America. Despite its relevance as a reservoir, rabies pathogenesis in raccons is neither well understood nor well described experimentally. Most published responses of racoons to rabies virus infection have been conductednusing a number of other isolates, including a fox, a bat, a skunk, and a dog (Niezgoda et al., 2002).
    2. Survival Information:
  4. Skunk :
    1. Description: Today in North America, reports of rabies in skunks occur mainly in four geographic regions: (1) the eastern United States, (2) the north central United States and the Canadian provinces of Manitoba, Saskatchewan, and Alberta, (3) California, and (4) the south central United States and Mexico. Rabies in these areas (in skunks and, to a large extent, in other terrestrial mammals) is caused mailnly by four different street virus variants. In the eastern United States, cases are primarily related to spillover from infected racoons, whereas in the other three, the viruses are adapted to skunks as the primary reservoir (Niezgoda et al., 2002).
    2. Survival Information:
  5. Coyote :
    1. Description: There are other important reservoirs, including coyotes in Asia, Africa and North America (Fu, 1997).
    2. Survival Information:
  6. Bat :
    1. Description: Recently, bat rabies has emerged as an important epidemiologic reservoir in some parts of the world (i.e. the Americas and Australia). In North America, most documented human rabies deaths occurred as a result of infection from the silver haired bat rabies virus variant and in Australia at least two human deaths have occurred from exposure to a previously unrecognized rabies virus. In South America, wildlife rabies, especially bat rabies is increasing. For the first time in 2003, more people died from rabies following bites from wildlife than from dogs in South America (WHO Fact Sheet N 99, September 2005). It has been known for many years that the vampire bat species Desmodus rotundus is a rabies reservoir and frequently transmits the disease to terrestrial animals, especially livestock species, upon feeding. Vampire bat populations appear to be on the increase in many parts of Latin America, probably as a direct consequence of human settlement and agricultural practices in areas of suitable vampire bat habitat, with inevitable significant increases in the economic and public health impacts of vampire bat rabies. In Mexico, human rabies cases due to bat reservoirs now comprise a significant proportion of all cases; it was reported that of four human deaths in 2000 two were due to unidentified bats and in 2002 all three Mexican cases were associated with bat contact (Nadin-Davis and Loza-Rubio, 2006). Prior to May 1996, Australia had been considered free of rabies and rabies-like viruses. This status was challenged, however, when a virus with a high degree of antigenic and genetic similarity to rabies virus (RV), subsequently named Australian bat lyssavirus (ABL), was isolated from a juvenile black flying fox. Since that time, all four common species of Australian flying fox (Pteropus alecto, P. poliocephalus, P. scapulatus and P. conspicullatus) and an insectivorous bat species, Saccolaimus flaviventris (the yellow-bellied sheath-tailed bat), have been found to be reservoirs of ABL in Australia (Guyatt et al., 2003). In the Americas, the bat species Desmodus rotundus (vampire bat), Tadarida brasiliensis (Brazilian free-tailed bat), Eptesicus fuscus (big brown bat), Lasiurus species (L. borealiz, L. cinereus), Lasionycteris noctivagans (silver-haired bat), Pipistrellus subflavus (eastern pipistrelle) and Myotis species (M. lucifugus; M. yumanensis, M. californicus; M. evotis) have all been identified as rabies virus reservoirs that harbour distinct RV variants. These RV variants generally separate into phylogenetic divisions that represent the lifestyle of their chiropteran hosts, i.e. migratory versus non-migratory, colonial versus solitary, insectivorous versus haematophagus. While most of these variants co-segregate only with their specific host reservoirs making spillover events to terrestrial animals uncommon, some have been associated with infection of non-chiropteran species, especially humans and domestic animals (Guyatt et al., 2003).
    2. Survival Information:
  7. Jackal (Arai, 2005):
    1. Description: Since 1956, red foxes (Vulpes vulpes) and, to a lesser extent, golden jackals (Canis aureus), have been the primary vectors maintaining endemic wildlife rabies in Israel (Yakobson et al., 2006).
    2. Survival Information:
  8. Mongoose (Arai, 2005):
    1. Description: Important reservoirs include mongoose in Asia, Africa and the Caribbean islands (Fu, 1997).
    2. Survival Information:
  9. Wolve (Arai, 2005):
    1. Description: Dogs in Asia and Africa remain the main reservoir and transmitter of rabies to humans. The others are mainly coyotes, foxes, jackals, mongooses, raccoons, skunks, wolves and bats (Arai, 2005).
    2. Survival Information:
D. Intentional Releases:
  1. Intentional Release information :
    1. Description:
    2. Emergency contact: Prompt consultation with public health officials is advised, as this decision is based on the current incidence of rabies in the animal species involved in the exposure. The most recent report of the Immunization Practices Advisory Committee is also an important source of information. The CDC manages a 24-hour telephone system with rabies information (404-332-4555) (Bleck and Rupprecht, 2000).

III. Infected Hosts

  1. Homo sapiens:
    1. Taxonomy Information:
      1. Species:
        1. Human (NCBI Taxonomy):
          • Ontology: UMLS:C0020114
          • GenBank Taxonomy No.: 9606
          • Scientific Name: Homo sapiens (NCBI Taxonomy)
          • Description: Human infections and deaths are an unfortunate consequence of biologic processes of virus maintenance in which humans play no significant role. Rabies virus and the other six recognized members of the Lyssavirus genus, some of which cause diseases indistinguishable from rabies in humans, are adapted to various animals species on which they depend for their existence (Childs, 2002).

    2. Infection Process:
      1. Description: Following primary infection, the virus enters an eclipse phase in which it cannot be easily detected within the host. This phase may last for several days or months. Investigations have shown both direct entry of virus into peripheral nerves at the site of infection and indirect entry after viral replication in nonnervous tissue (i.e., muscle cells). During the eclipse phase, the host immune defenses may confer cell-mediated immunity against viral infection because rabies virus is a good antigen. The uptake of virus into peripheral nerves is important for progressive infection to occur. After uptake into peripheral nerves, rabies virus is transported to the central nervous system (CNS) via retrograde axoplasmic flow. Typically this occurs via sensory and motor nerves at the initial site of infection. The incubation period may vary from a few days to several years, but is typically 1 to 3 months. Dissemination of virus within the CNS is rapid, and includes early involvement of limbic system neurons. Active cerebral infection is followed by passive centrifugal spread of virus to peripheral nerves. The amplification of infection within the CNS occurs through cycles of viral replication and cell-to-cell transfer of progeny virus. Centrifugal spread of virus may lead to the invasion of highly innervated sites of various tissues, including the salivary glands. During this period of cerebral infection, the classic behavioral changes associated with rabies develop (CDC(c)).
        • Infectious path of rabies virus (CDC(a)):



          Description: The infectious path of rabies virus: (1): Raccoon is bitten by a rabid animal. (2): Rabies virus enters the raccoon through infected saliva. (3): Rabies virus spreads through the nerves to the spinal cord and brain. (4): The virus incubates in the raccoon's body for approximately 3-12 weeks. The raccoon has no signs of illness during this time. (5): When it reaches the brain, the virus multiplies rapidly, passes to the salivary glands, and the raccoon begins to show signs of disease. (6): The infected animal usually dies within 7 days of becoming sick (copyright: CDC)

    3. Disease Information:
      1. Rabies (i.e., Rabies) :
        1. Pathogenesis Mechanism: Bites by rabid animals generally inoculate virus-laden saliva through the skin into muscle and subcutaneous tissues. Other routes of infection are rare. During the incubation period the virus can replicate locally in muscle cells or attach directly to nerve endings. Having gained access to peripheral nerves, it travels in a retrograde direction within the axoplasm. When the virus reaches the central nervous system, there is massive replication on membranes within neurons. Direct transmission of virus occurs from cell to cell across synaptic junctions. At the onset of illness when evidence of neuronal dysfunction appears, there is little or no apparent histopathological change. Centrifugal spread of virus from the central nervous system in somatic and autonomic nerves deposits virus in many tissues, including skeletal and cardiac muscle, adrenal glands, kidney, retina, cornea, pancreas, and nerves around hair follicles. Productive viral replication with budding from plasma membranes takes place predominantly in the salivary glands, excreting virus that is transmissible to other mammals (Warrell and Warrell, 2004). The first clinical symptom is usually neuropathic pain at the wound site. This is caused by viral replication at the dorsal root ganglia and ganglionitis. Major clinical signs are related to the virus-induced encephalomyeloradiculitis. Two major clinical presentations are observed: furious and paralytic forms that cannot be correlated with any specific anatomical lacalization of rabies virus in the CNS. Nontheless, peripiheral nerve dysfunction is responsible for weakness in paralytic rabies. In furious rabies electrophysiological studies indicate that anterior horn cell dysfunction even in the absence of clinical weakness. Without intensive care, death occurs within a few days (1-5 days) of the development of neurological signs. Rabies is inevitably fatal (WHO, 2002). In human beings, the symptoms of encephalitis and even death can occur with only minor histopathological changes. Rabies virus must have some profound effects on the functions of infected and some uninfected neurons. Few abnormalities of organelle structure are seen on electron microscopy in neurons infected with street virus. Minor electroencephalographic changes during animal infection indicate neuronal dysfunction. Although MRI shows a range of abnormalities as the human encephalitis progresses, no consistent pattern has yet emerged. Abnormalities of neurotransmitter functions affecting serotonin, opioid, GABA, and muscarinic acetylcholine transmission have been found experimentally, in some cases in specific brain areas, and not always associated with the presence of virus. Results show no clear explanation of the limbic-system dysfunction suggested by the classic clinical features. Changes in neurotransmitter functions could lead to failure of brain networking and regulation of responses. The involvement of excitatory aminoacids in neuronal toxicity is a possibility. Many non-competitive antagonists of N-methyl-D-aspartate have an antiviral effect on viral replication. Surprisingly, one of these, ketamine, specifically inhibits transcription of the rabies virus genome. The effect of infection on the function of neuronal membrane ion channels could be reduction of normal inhibitory events. Apoptosis could contribute to pathogenesis since fatal infection of mice is associated with apoptosis of T cells invading the brain and neuronal preservation. By contrast, neuronal apoptosis occurs in non-lethal infection, with development of an immune response. The role of nitric oxide toxicity in neuronal dysfunction in rabies is not clear, but it could be related to the LC8 inhibition of neuronal nitric oxide synthase, through interaction with the viral phosphoprotein. Although rabies infection progressively decreases host gene expression overall, a few genes are upregulated, some associated with the interferon response, host-cell protein synthesis, synaptic vesicle function, and neuron growth and spread, even in some uninfected or nonneuronal cells. One hypothesis on the cause of death is therefore that short-circuiting of normal neural pathways results from the formation of new interneuronal connections. Another hypothesis is that disruption of neuronal metabolism ends in the exhaustion of metabolic pools (Warrell and Warrell, 2004).


        2. Incubation Period: The wide variability of the incubation period of rabies in man was noted in early literature. In modern times the incubation period in man, as defined by the interval between exposure and the first symptoms in the prodromal stage, is more variable than in any other acute infection. Fishbein has cited extremes from as short as 4 days to as long as 14 to 19 years, although in cases with long incubation periods the possibility of an intervening second exposure often could not be ruled out. There is little doubt, however, that extraordinarily long incubation periods do occur: in a virological examination of unexplained rabies in three United States immigrants, the isolates were variants with distinctive antigenic or genetic characteristics which matched those found in specimens of rabid animals from or near the country in which the patient had lived prior to emigration; the migrants had not returned to their country of origin with 4 years, 6 years and 11 months, respectively (King, 1998). Analysis of the incubation periods of 1555 patients revealed that although none was shorter than 10 days, 29.8 per cent were of 10-30 days'. 54.4 per cent were of 31-90 days', 14.6 per cent were of 91-365 days' and 1.2 per cent were of >365 days' duration. Factors which may influence the length of incubation period include the site of the bite (in general, the nearer the head, the shorter the period) and its severity, the degree of innervation of the bite site (bites on the face, neck, and hands are more dangerous, presumably beacause of their rich nerve supply), the quantity of virus 'inoculated' and the age and immune status of the host. The incubation period in children is purported to be shorter than that in adults and is probably assaociated with their infant stature and unusually severe or multiple bites on the face, head, and neck (King, 1998). Long incubation periods are also known for naturally infected animals and provide a mechanism for global spread of rabies variants along migratory routes and through human transport (Smith, 2002).


        3. Prognosis: Rabies is a uniformly fatal illness once symptoms begin. For cases where prompt and correct postexposure treatment is administered, no documented failures exist and patients do not develop rabies. The key to successful treatment of rabies is timing. An infected person must begin a series of immunizations as soon as possible after being bitten. If immunizations begin within two days of the bite, chances of survival are very good. Even if the immunizations do not begin until later, there is a chance that the patient can survive. The longer the delay in starting immunizations, however, the less hopeful the prognosis for recovery is. Without immunizations, a patient will almost certainly die of the disease In Wisconsin, a teenager contracted rabies from a bat bite and became the first known person to survive rabies despite not having received rabies vaccine prior to symptom onset (Krebs et al., 2005).


        4. Diagnosis Overview: Clinical Diagnosis in Humans: Diagonosis of rabies based on clinical grounds is difficult and unreliable except when specific clinical signs of hydro- or aerophobia are present. Some patients present with a paralytic or Guillain-Barre-like sybdrome or other atypical clinical features. Classical signs of brain involvement include spasms in response to tactile, auditory, visual or olfactory stimuli(e.g. aerophobia and hydrophobia) alternating with periods of lucidity agitation, confusion, and signs of autonomic dysfunction. These spasms occur at some time in almost all rabid patients in whom excitation is prominent. However, spontaneous inspiratory spasms usually occur continuously until death and their presence often facilitates clinical diagnosis. Excitation is less evident in paralytic rabies, and phobic spasms appear in only 50% of these patients. During the early stages of paralytic rabies, notable signs include myoedema at percission sites, usually in the region of the chest, deltoid muscle and thigh, and piloerection. Atypical non-classic rabies is being increasingly recognized and may be responsible for underreporting (WHO, 2002). Clinical diagnosis can be made with confidence only in cases of furious rabies where there are three major signs: fluctuating consciousness, phobic spasms, and autonomic dysfunctions. Dumb rabies is often mistaken for Guillain-Barre syndrome (Wacharapluesadee and Hemachudha, 2001). Magnetic resonance imaging performed with adequate precautions suitable for potentially infectionus patients, can be helpful in diagnosis. Abnormal, ill-defined, mildly hypersignal T2 images involving brainstem, hippocampus, hypothalamus, deep and subcortical white matter, and deep and cortical grey matter are indicative of rabies, when present, regardless of clinical types. Gadolinium enhancement is clearly shown only in later stages when patient lapse into a coma. Such a pattern differentiates rabies from other viral encephalitides, not in terms of location, but in the T2 image appearance and in the pattern of contrast enhancement when compared according to consciousness status.. Computerized tomography of the brain is of no diagnostic value (WHO, 2002). Laboratory Diagnosis: Definite diagnosis of rabies can only be made by laboratory investigations. Rabies diagnosis can be performed on fresh specimens from several diffrerent tissue sources or on appropriate specimens stored at proper temperatures, preferably refridgerated. The choice of specimens depends on the test to be performed and the stage of the disease in humans. Secretions of biological fluids (saliva, spinal fluid, and tears, can be used to diagnose rebis during life (intra vitam). Brain tissue is the prefered specimen for postmortem diagnosis in both humans and animals (WHO, 2002). The diagnosis of animal and human rabies can be made by 4 methods: (1) histopathology (2) virus cultivation (3) Serology (4) virus antigen detection. Although each of the first 3 methods have distinct advantages, none provide a rapid definitive diagnosis (WHO, 2002). (1): Histopathology - Negri bodies are pathognomonic of rabies. However, Negri bodies are only present in 71% of cases (WHO, 2002). (2): Virus cultivation - The most definitive means of diagnosis is by virus cultivation from infected tissue. Tissue culture lines, such as WI-38, BHK-21, or CER. Since rabiesvirus induce minimal CPE, IF is routinely used to detect the presence of rabies virus Ag in the tissue culture. The more commonly used method for virus isolation is by the inoculation of saliva, salivary gland tissue and brain tissue intracerebrally into infant mice. The mice should develop paralysis and death within 28 days. Upon death, the brains are examined for the presence of the virus by immunofluorescence (WHO, 2002). (3): Serology - circulating antibodies appear slowly in the course of infection but they are usually present by the time of onset of clinical symptoms. The most commonly used serological tests were the mouse infection neutralization test (MNT) or the rapid fluorescent focus inhibition test (RFFIT). These tests have now been largely superseded by EIAs. Serology had been reported to be the most useful method for the diagnosis of rabies (WHO, 2002). (4): Rapid virus antigen detection - in recent years, virus antigen detection by IF had become widely used. The potentially infected tissue is incubated with fluorescein-labeled antibody. The cells are examined by fluorescent microscopy for the presence of fluorescent intracytoplasmic inclusions. The specimens which are usually used are corneal impressions (obtained by gently abrading the cornea with a microscopic slide) or neck skin biopsy (the cells examined are the sensory nerves). In an American series, IF of corneal impressions or neck skin impressions was diagnostic only in 50% of cases early in the course of the clinical illness (WHO, 2002). Clinical diagnosis is not difficult if there is a documented history of exposure and subsequent compatible clinical signs or symptoms. However, because an exposure history may be lacking, rabies should be considered in any acute, unexplained neurological disease of suspected viral origin that rapidly progresses to coma and death. Routine diagnosis is established by standard laboratory tests for specific virus isolates, antigens, nucleic acids or VNA. Postmortem diagnosis should be performed on CNS specimens, especially the brainstem, hippocampus, and cerebellum. The fluorescent antibody test and the avidin-biotin immunohistochemical technique are sensitive and specific methods for detecting virus antigen. Antibodies, particularly those that recognize particular epitopes of the N protein, are useful because they provide consistently reliable results, even if the tissues have been fixed with formalin or embedded in paraffin. Examination of skin biopsies from the face or hair covered occipital portions of the neck for virus antigen is a rapid method to diagnose human rabies before death. Rabies virus can be isolated from saliva by direct intracerebral inoculation into mice or by infection of neuroblastoma cells. Fluorescent antibody examinations of corneal impressions may also occasionally lead to the diagnosis of human rabies. The reverse transcription-polymerase chain reaction assay (RT-PCR) has been used to amplify and sequence parts of the lyssavirus genome directly from brain, saliva, and other affected tissues. This not only allows detection of rabies virus-specific RNA but also permits insights into the identity of the virus variant by genetic sequencing. Detection of VNA in serum late in clinical course can be diagnostic for rabies, if the patient has not been previously vaccinated. Except for certain cases of postvaccinal encephalomyelitis, CSF antibodies are produced only in rabies-infected, not in vaccinated individuals (de Mattos et al., 2001).


        5. Symptom Information :
          • General Description: In general, the clinical disease can be divided into three phases: (1) Prodromal phase, (2) Excitation phase, furious rabies or acute neurologic phase, and (3) Paralytic phase, dumb rabies or coma preceding death. However, these phases may not be distinct, as some of the early phases are not always apparent (Woldehiwet, 2005).
          • Syndrome -- Prodromal Phase:
            • Description: During the prodromal period, lasting 2 to 10 days, symptoms are usually mild and almost entirely nonspecific and include general malaise, chills, fever, headache, photophobia, anorexia, nausea, vomiting, diarrhea, sore throat, cough, and musculoskeletal pain. One specific early symptom is abnormal sensation around the bite site, such as itching, burning, numbness, or paresthesia (de Mattos et al., 2001) The prodromal stage is often characterized by a marked change of behaviour in dogs, cats and other pets, which normally are friendly and exhibit predictable behavioural patterns. This is also true with free living animals, which may loose their natural instinct to be afraid of man and to be less visible. The clinical signs of rabies in other animals are not always as distinct as in dogs, but in general, the disease is characterized by a progressive dysfunction of the CNS. However, the clinical signs can be easily mistaken with those of other infections that cause encephalomyelitis or other neurological manifestations and from poisoning or toxicoses with neurological syndromes. In man, the early (prodromal) stages of the disease may be characterized by loss of appetite, headache, general aches and pains and other influenza-like symptoms. These early symptoms are difficult to differentiate from other causes, but the history of exposure to a rabid animal is an important consideration. Often overt clinical signs of rabies start by itching or stabbing pains or abnormal sensations at the site of the bite. Local neuropathic pains at the bite site described as burning, numbness, tingling or itching are reported to be more common in bat-related infections. Victims may also suffer from insomnia and anxiety, the fear of death exasperating the situation (Woldehiwet, 2005).


            • Symptoms Shown in the Syndrome:

            • Abnormal sensation (de Mattos et al., 2001):
              • Ontology: UMLS:C0423571
              • Description: One specific early symptom is abnormal sensation around the bite site, such as itching, burning, numbness, or paresthesia (de Mattos et al., 2001).
            • Anorexia (de Mattos et al., 2001):
              • Ontology: UMLS:C0003123
            • Anxiety (Hattwick and Gregg, 1975):
              • Ontology: UMLS:C0003467
            • Chills (de Mattos et al., 2001):
              • Ontology: UMLS:C0085593
            • Cough (de Mattos et al., 2001):
              • Ontology: UMLS:C0010200
            • Diarrhea (de Mattos et al., 2001):
              • Ontology: UMLS:C0011991
            • Dilated pupils:
              • Ontology: UMLS:C0026961
            • Depression (Hattwick and Gregg, 1975):
              • Ontology: UMLS:C0344315
            • Excessive salivation (Wiktor and Hattwick, 1977):
              • Ontology: UMLS:C0037036
            • Fever (de Mattos et al., 2001):
              • Ontology: UMLS:C0015967
              • Description: A low fever, malaise, headache, anorexia, nausea and sore throat are common
            • Headache:
              • Ontology: UMLS:C0018681
              • Description: In man, the early (prodromal) stages of the disease may be characterized by loss of appetite, headache, general aches and pains and other influenza-like symptoms (Woldehiwet, 2005).
            • Hyperesthesia:
              • Ontology: UMLS:C0020453
              • Description: Hyperesthesia, an increased sensitivity to bright light and loud noise, excessive salivation, lacrimation and perspiration have been noted. The general muscle tone may be increased, and facial expression can be overactive
            • Irritability (Hattwick and Gregg, 1975):
              • Ontology: UMLS:C0022107
            • Lacrimation ():
              • Ontology: UMLS:C0423153
            • Malaise (de Mattos et al., 2001):
              • Ontology: UMLS:C0231218
            • Melancholia ():
              • Ontology: UMLS:C0025193
            • Nausea (de Mattos et al., 2001):
              • Ontology: UMLS:C0027497
            • Nervousness:
              • Ontology: UMLS:C0027769
              • Description: There may be increasing nervousness, anxiety, irritability, depression, melancholia, with or without a sense of impending death (Hattwick and Gregg, 1975).
            • Perspiration (Wiktor and Hattwick, 1977):
              • Ontology: UMLS:C0038990
            • Photophobia (de Mattos et al., 2001):
              • Ontology: UMLS:C0085636
            • Shallow respiration (Wiktor and Hattwick, 1977):
              • Ontology: UMLS:C0221161
            • Sore throat (de Mattos et al., 2001):
              • Ontology: UMLS:C0242429
            • Vomiting (de Mattos et al., 2001):
              • Ontology: UMLS:C0042963
          • Syndrome -- Excitation phase, Furious rabies or Acute neurologic phase:
            • Description: During the acute neurologic phase, patients exhibit signs of nervous dysfunction such as anxiety, agitation, dysphagia, hypersalivation, paralysis and episodes of delirium. Occasionally, priapism or increased libido may be observed. Cases in which hyperactivity is predominant are classified as "furious" rabies. In furious rabies, the neurologic period ends in 2 to 7 days with coma or sudden death from respiratory of cardiac arrest (de Mattos et al., 2001). During this stage, the victim may develop the classical signs of hydrophobia, aerophagia and general irritability (Woldehiwet, 2005). Cardinal features of furious rabies, fluctuating consciousness, hydro- or aerophobia and inspiratory spasms, signs of autonomic dysfunction, were seen in all Thai furious rabies patients. In noncanine rabies endemic areas, such as in North America, where bats are the principle vector of rabies, clinical expression may be variable (Hemachudha et al., 2005).


            • Symptoms Shown in the Syndrome:

            • Bradycardia:
              • Ontology: UMLS:C0428977
            • Seizures (Hattwick and Gregg, 1975):
              • Ontology: UMLS:C0036572
            • Constipation:
              • Ontology: UMLS:C0009806
            • Constriction of the pupils:
              • Ontology: UMLS:C0728710
            • Dilation of the pupils:
              • Ontology: UMLS:C0026961
              • Description: Dilation or constriction of the pupils that may be asymmetric and associated with: (1) Hippus (abnormal exaggeration of the rhythmic contraction and dilation of the pupil, independent of changes in illumination or in fixation of the eyes). (2) Nystagmus (continuous rolling of eyeball). (3) Diplopia
            • Hoarseness (Burton et al., 2005):
              • Ontology: UMLS:C0019825
            • Hydrophobia:
              • Ontology: UMLS:C1609481
              • Description: Hydrophobia or the fear of water appears to develop in most cases of human rabies. Attempts to drink water or eat may produce severe painful spasms of the pharynx and larynx and precipitate an episode of hyperactivity which seems to be extremely frightening to the patient. Once experienced, the sight, sound or smell of liquids may provoke the syndrome. The ensuing choking may cause severe apnea (temporary cessation of breathing) and cyanosis. Death frequently occurs during the course of such a convulsive attack. Dehydration is a common consequence (Wiktor and Hattwick, 1977).
            • Papilledema (Hattwick and Gregg, 1975):
              • Ontology: UMLS:C0030353
            • Strabismus:
              • Ontology: UMLS:C0038379
              • Description: Strabismus - failure of the eyes to follow one another in any movement. This is due to incoordination of the extra-ocular muscles (Hattwick and Gregg, 1975).
            • Tachycardia (Hattwick and Gregg, 1975):
              • Ontology: UMLS:C0039231
            • Urinary Retention:
              • Ontology: UMLS:C0080274
            • Weakness of facial muscles (Burton et al., 2005):
              • Ontology: UMLS:C0427055
          • Syndrome -- Paralytic phase, Dumb rabies or Coma preceding death:
            • Description: When paralysis dominates, it is classified as paralytic or "dumb" rabies. Paralytic rabies can occur in about 20% of patients and may occur more frequently in persons exposed to certain variants, such as vampire bat rabies virus strains. In marked contrast to furious rabies, the sensorium is largely spared. Patients initially develop paresthesia and weakness, and finally flaccid paralysis, usually in the bitten extremity. Paralysis progresses to paraplegia and quadriplegia. In paralytic rabies, the course is usually less progressive, with some patients living up to 30 days without intensive care. The final stage of the disease is coma, which lasts 3 to 7 days and results in death. In patients receiving respiratory assistance, survival may be prolonged for weeks, with death caused by other complications (de Mattos et al., 2001). Only one or two classical signs of rabies, or even none, may be seen during the whole clinical course in paralytic rabies. Consciousness was preserved until the preterminal phase. Hemachudha and Wacharapluesadee reported phobic spasms in only half of 35 confirmed paralytic rabies patients between 1988 and 2004. Weakness was the initial manifestation in paralytic rabies, whereas this was noted only when furious rabies patient approached coma (Hemachudha et al., 2005). The paralytic form of the disease, without the classical signs of hydrophobia, is more common and needs to be differentiated from other conditions. For example, some patients may present with paralytic or Guillain-Barre-like syndrome, without the typical excitation, spontaneous inspiratory spasms and hydrophobia (Woldehiwet, 2005).


            • Symptoms Shown in the Syndrome:

            • Hydrophobia:
              • Ontology: UMLS:C1609481
              • Description: Hydrophobia, if present, disappears and swallowing becomes possible, although difficult, as the paralytic phase sets in. A progressive, general, flaccid paralysis develops. Apathy shades into stupor, progressing to coma. There is urinary incontinence. Peripheral vascular collapse ensues and death follows (Wiktor and Hattwick, 1977).

        6. Treatment Information:
          • Rabies Immune Globulin (RIG): Rabies immune globulin is a sterile, concentrated nonpyrogenic solution containing antirabies antibodies prepared from plasma of adults immunized with rabies vaccine. The manufacturers and the US Public Health Service Advisory Committee on Immunization Practices (ACIP) currently recommend that post exposure prophylaxis following rabies exposure include immediate and thorough wound treatment (e.g. cleansing all bite wounds and scratches with soap and water and irrigation with a virucidal agent such a providence iodine solution) and, for previously unvaccinated individuals, passive immunization with RIG combined with active immunization with rabies vaccine. RIG is commercially available in the US as BayRab and Imogam Rabies-HT, and the ACIP states that both preparations of RIG are considered equally effective when used as recommended ( AHFS, 2005a).
            • Applicable: Rabies immune globulin (RIG) is used to provide passive immunity to rabies as part of a post exposure prophylaxis regimen in individuals exposed to the disease or virus who previously have not been vaccinated against rabies ( AHFS, 2005a).
            • Contraindicator: Repeated doses of RIG are contraindicatedonce active immunization with rabies vaccine has been initiated since repeating the dose of RIG may partially suppress active production of antibody and interfere with maximum production of immunologic response to the vaccine. The manufacturers state that serious systemic reactions to preparations may occur following inadvertent IV administration of RIG. Although systemic reactions to preparation containing immunoglobulins are rare, epinephrine should be available for treatment of acute anaphylaxis if it occurs. RIG should be administered with caution to individuals with a history of prior systemic allergic reactions to human immune globulin preparations. In addition RIG should be administered cautiously to individuals with a specific IgA deficiency, since these individuals may have serum antibodies to IgA ( or develop antibodies following administration of RIG) and anaphylaxis could result following administration of RIG or other blood products containing IgA. RIG should be used with caution in individuals with thrombocytopenia or bleeding disorders, since bleeding may occur following IM administration of the drug ( AHFS, 2005a).
            • Complication: Rabies immune globulin (RIG) has been reported to partially supress the active antibody response to rabies vaccine. When anatomically feasible, the full dose of RIG should be thoroughly infiltrated in the area around and into the wound(s) and the remaining volume should be administered IM at a site distant from vaccine administration. Antibodies contained in RIG may interfere with the immune response to certain live virus vaccines, including measles virus vaccine live, mumps virus vaccine live, rubella virus vaccine live and varicella virus vaccine, and these vaccines should not be administered simultaneously with or for a specified interval before or after administration of RIG. Through an antigen-antibody antagonism, RIG may diminish antibody response to measles/mumps/rubella vaccine; administer live virus vaccines 14-30 d before or 6-12 wk after immunoglobulin administration; antibody response to rabies vaccine may be delayed if administered simultaneously with rabies Ig ( AHFS, 2005a).
            • Success Rate: The key to successful treatment of rabies is timing. An infected person must begin a series of immunizations as soon as possible after being bitten. If immunizations begin within two days of the bite, chances of survival are very good. Even if the immunizations do not begin until later, there is a chance that the patient can survive. The longer the delay in starting immunizations, however, the less hopeful the prognosis for recovery is. Without immunizations, a patient will almost certainly die of the disease. Since the availability and routine use of cell culture-derived rabies vaccine began in the US in 1990, there have been no reported cases of postexposure prophylaxis failures in the US when recommended procedures, including active and passive immunization and wound management were followed. Although prophylaxis failures have been reported rarely in other countries, in all cases there was a deviation from the recommended procedures, such as failure to cleanse wounds adequately, IM injection of the vaccine gluteal rather than the deltoid region, failure to passively immunize with RIG (or antirabies serum [equine]) into the wound site, or infiltration of less than the recommended dose of RIG at the exposure site ( AHFS, 2005a).
          • Rabies Vaccine: There are currently 2 types of rabies vaccine commercially available in the US; human diploid-cell rabies vaccine (HDCV) and the purified chick embryo cell culture (PCEC) rabies vaccine. Until several years ago, rabies vaccine adsorbed (RVA) also was commercially available in the US; this vaccine was a fetal rhesus lung diploid-cell rabies vaccine. While experience in the HDCV is more extensive than that with PCEC or RVA rabies vaccines, clinical trals have demonstrated that the immunogenicity of PCEC and RVA are equivalent to that of HDCV ( AHFS, 2005b).
            • Applicable: Rabies vaccine is used for preexposure vaccination in individuals at high risk of exposure to the disease or virus and also is used as part of a postexposure prophylaxis regimen that includes local wound treatment and active immnization with rabies vaccine and may also include passive immunization with rabies immune globulin (RIG) in certain patients. Rabies vaccine stimulates the production of rabies antibody; evidence indicates that rabies antibody neutralizes rabies virus so that the spread of the virus is retarded and its infective or pathogenic properties are inhibited ( AHFS, 2005b).
            • Contraindicator: Because of the almost invariably fatal outcome of rabies, there are no known contraindications to postexposure rabies vaccination when such prophylaxis is indicated. There are also no known contraindications to preexposure rabies vaccination other than situations such as moderate or severe acute illness. Local or mild systemic adverse reaction to HDCV or PCEC do not contraindicate continuing rabies vaccination and, once initiated, rabies postexposure prophylaxis should not be interrupted or discontinued because of such reactions. These reactions usually can be managed with non-steroidal anti-inflammatory agents or antipyretic agents (e.g. ibuprofen, acetaminophen). However, serious systemic, neurologic, or anaphylactic adverse effects during rabies vaccination pose a serious therapeutic delimma for the clinician, and the individual's risk of acquiring rabies must be weighed carefully before deciding to discontinue vaccination. In addition, all such serious reactions should be reported promptly to the manufacturer and the US Vaccine Adverse Event Reporting System (VAERS) at 800-822-7967 ( AHFS, 2005b).
            • Complication: Serious systemic, neurologic, or anaphylactic adverse effects during rabies vaccination. Following IM administration of HDCV, local reactions (e.g. pain, swelling, erythema) occur at the site of injection in about 25% of individuals. Following IM administration of PCEC rabies vaccine, local reactions such as induration, swelling, and erythema have been reported more frequently than systemic adverse effects. Systemic reactions to HDCV occur in about 5-45% of individuals receiving the vaccine and include mild to moderate constitutional manisfestations such as nausea, vomiting, abdominal pain, diarrhea, headache, fatigue, soat throat, low grade fever (up to 38.3 C) chills muscle aches, arthralgia. myalgia, fainting, diziness, and malaise. The most common adverse systemic effects reported with PCEC rabies vaccine are mild to moderate myalgia (53%), malaise (15-20%), headache (10-15%), and dizziness (15%). Localized lymphadenopathy has been reported in 15%. In addtion, fever (greater than 38 C), GI complaint, severe headche, fatigue, circulatory reactions, sweating, chills, monoarthritis, and urticaria pigmentosa have been reported rarely ( AHFS, 2005b).
            • Success Rate: Since the availability of cell culture-derived rabies vaccines, there have been no reported cases of postexposure prophylaxis failures in the US when recommended procedures, including immunization and wound management, were followed. While postexposure prophylaxis failures have been reporeted rarely in other countries, in all cases there was some deviation from recommended procedures, such as failure to cleanse wound adequately, IM injection of the vaccine into the gluteal rather than the deltoid region, failure to passively immunize with RIG by infiltrating the wound site, or use of less than the recommended dose of RIG ( AHFS, 2005b).
          • Postexposure treatment: The cornerstone of rabies prevention is wound care, potentially reducing the risk of rabies by 90%. Thorough washing with a 20% soap solution is as effective as the formerly recommended quaternary ammonium compounds. Irrigation with a virucidal agent such as providone-iodine is advisable. After wound care, the clinician must decide whether to institute passive or active immunization (Bleck and Rupprecht, 2000). The FDA has approved several injectable products that are effective in preventing rabies in people who have been exposed to the virus. This post-exposure treatment consists of one injection of proteins that fight the infection (rabies immune globulin) and five injections of rabies vaccine over a 28-day period. The vaccine works by stimulating a person's immune system to produce antibodies that neutralize the virus. "The person develops a protective immune response before the virus reaches the brain and begins to actively replicate. Rabies immune globulin contains antibodies from blood donors who were given rabies vaccine. The antibodies provide interim protection until an exposed person's own antibodies develop in response to the vaccine. In addition, injecting rabies immune globulin at the site of injury reduces the amount of virus that is able to enter the nerve cells and potentially initiate an active infection (FDA Consumer magazine July-August 2005 Issue).
            • Contraindicator: Rabies immunoglobulin does not interfere with vaccine-induced antibody formation. Its use is not recommended beyond 8 days after initiation of the vaccine series nor in persons previously immunized to rabies, however (Bertino and Hayney, 2002). (Corticosteroids should be given only to patients experiencing a life-threatening vaccine reaction, because they interfere with the development of immunity) (Bleck and Rupprecht, 2000).
            • Complication: Local reactions (pain, swelling, or induration) are common, but systemic complaints (fever, headache, malaise, nausea, abdominal pain, or adenopathy) occur in only a minority of patients. Serious reactions have been exceedingly rare, with the Guillain-Barre syndrome reported very rarely. Corticosteroids should be given only to patients experiencing a life-threatening vaccine reaction, because they interfere with the development of immunity (Bleck and Rupprecht, 2000)
            • Success Rate: In situations in which the vaccine has been used alone, mortality rates of 50% to 60% have been observed. Mortality after the combination vaccine and rabies immunoglobulin regimens is an exceedingly rare event; however, failures have been reported when the wound was not infiltrated with rabies immunoglobulin (Bertino and Hayney, 2002).

        7. Other Information:
          • Treatment: There is no established treatment for rabies once symptoms have begun. Despite excellent intensive care, almost all patients succumb to the disease or its complications within a few weeks of onset (Bleck and Rupprecht, 2000). No successful treatment of clinical rabies is available. The disease is fatal with few exceptions, and no spontaneous recovery are reported. Sedation and life support measures have been used to prolong life but not to prevent death (de Mattos et al., 2001). The three patients in the 1970s who survived, two of whom made apparently complete recoveries, represent very unusual occurrences. Each of these patients had undergone some form of PET (postexposure therapy), and it seems likely that these treatment modified their course. Another case with partial recovery was reported in 1994 in a child who received rabies vaccine without immunoglobulin. Trials of many agents have been undertaken in clinical rabies, including interferons-inducing agents, ribavirin, and cytosine arabinoside, without beneficial effects (Bleck and Rupprecht, 2000). Thus, rabies treatment is a misnomer and usually refers to the medical aid related to animal bite and disease prevention by post exposure prophylaxis (de Mattos et al., 2001).

    4. Prevention:
      1. Preexposure Prophylaxis:
        • Description: Although control of animal rabies is central to prevention of human disease, few nations have eliminated it, and those that have been successful usually maintain quarantine procedures lest the disease reappear. Therefore prophylactic procedures (for domestic animals and selected humans) and PET for humans remain essential. Prophylaxis for cats and dogs in many countries is required by law; in the United States, the use of 1- or 3-year vaccines is permitted, although only the 3-year vaccine is recommended. Vaccination should be performed or supervised by a veterinarian; improper administration can lead to lack of immunity. Measurement of animal seroconversion rates may be considered to ensure protection, and immunization of livestock is recommended in areas of increasing rabies prevalence. Vaccination of wild animals is an effective public health measure. The use of vaccines effective after ingestion allows the immunization of wild animals. Preexposure prophylaxis is confined to people with relatively high risk of rabies exposure, such as veterinarians, laboratory workers using rabies virus, spelunkers, and people planning to visit countries of high dog rabies prevalence where access to appropriate medical care is limited. A series of three intramuscular or intradermal injections (days 0, 7, and 21 or 28) is sufficient; antibody response determination is not required in normal hosts. An adequate antibody response is generally considered to be complete neutralization at 1:5 level by RFFIT (rapid fluorescent focus inhibition test), which is equivalent to 0.5IU/mL concentration suggested by the WHO (Bleck and Rupprecht, 2000).
        • Efficacy:
          • Rate: Antibody conversion occurs in virtually 100% of HDCV or RVA recipients by 7 to 10 days following immunization. The CDC considers titers of 1:5 by RFFIT testing as being protective. The World Health Organization (WHO) uses a value of 0.5 IU/mL as evidence of protective antibody (Bertino and Hayney, 2002). An intensive 4-year campaign in Belgium nearly eliminated rabies from the fox population (Bleck and Rupprecht, 2000). Five 'full' campaigns of fox vaccination, carried out from 1989 until 1991, induced a drastic decrease in the incidence of rabies. The disease has disappeared from the major part of the initial infected area. In 1992 and 1993, three 'defence' campaigns, carried out along international borders, completely eliminated rabies virus infection from the fox population in 1993 (Brochier et al., 1994).
          • Duration: Booster doses every 2 to 3 years are usually recommended for individuals frequently at risk of exposure (Bleck and Rupprecht, 2000).
        • Complication: Life-threathening allergic reaction to components of the vaccine
      2. Rabies control in Animals:
        • Ontology: UMLS:XXX
        • Description: The idea of wildlife vaccination was conceived during the 1960s, and modified-live rabies viruses were used for the experimental oral vaccination of carnivores by the 1970s. The development of safe and effective rabies virus vaccines applied in attractive baits resulted in the first field trials in Switzerland in 1978. Thereafter, technical improvements occurred in vaccine quality and production, including the design of recombinant viruses, as well as in the ease of mass distribution of millions of edible baits over large geographical areas (Rupprecht et al., 2004). Oral rabies vaccination (ORV) targeting specific Carnivora species has emerged as an integral adjunct to conventional rabies control strategies to protect humans and domestic animals. ORV has been applied with progress toward eliminating rabies in red foxes (Vulpes vulpes) in western Europe and southern Ontario, Canada. More recently since 1995, coordinated ORV was implemented among eastern states in the U.S.A. to prevent spread of raccoon (Procyon lotor) rabies and to contain and eliminate variants of rabies virus in the gray fox (Urocyon cinereoargenteus) and coyote (Canis latrans) in Texas (Slate et al., 2005).
        • Efficacy:
          • Rate: Over the past few decades, extensive oral vaccination programmes focusing upon the red fox, using hand and aerial distribution of vaccine-laden baits, have resulted in the virtual disappearance of rabies in Western Europe. The same dramatic observation held true for southern Ontario. During the 1990s in the United States, oral vaccination programmes concentrated upon raccoons, grey foxes, and coyotes, with similar success. For example, raccoon rabies has not spread west of the current focus in the eastern states, grey fox rabies is contained in west central Texas, and no recent cases of rabies have been reported from coyotes away from the Mexican border for several years (Rupprecht et al., 2004).
          • Duration:

    5. Model System:
      1. Mice:
        1. Ontology: UMLS:C0025929
        2. Model Host: Mice (Jackson and Reid, 1998)
        3. Model Pathogens:
        4. Description: A fatal encephalomyelitis developed after intracerebral inoculation of 6-day-old ICR mice with the challenge virus standard (CVS) strain of fixed rabies virus. The brains of CVS-infected mice showed widespread morphologic changes of apoptosis, which were particularly prominent in pyramidal neurons of the hippocampus and in the cerebral cortex. Evidence of oligonucleosomal DNA fragmentation was sought in situ using the TUNEL method. TUNEL staining was observed in many neurons, and rabies virus antigen was usually demonstrated with immunoperoxidase staining in similar regions. Neurons in the dentate gyrus of the hippocampus demonstrated expression of viral antigen, apoptotic changes, and positive TUNEL staining. This region normally demonstrates little infection in CVS-infected adult mice. Double labeling of neurons with TUNEL and viral antigen indicated that infected neurons actually underwent apoptosis. Increased immunoreactivity against the Bax protein was demonstrated compared to uninfected mice. Purkinje cells expressed viral antigen, but did not show significant morphologic changes of apoptosis or TUNEL staining. In contrast, neurons in the external granular layer of the cerebellum did not express viral antigen, but demonstrated greater morphologic changes of apoptosis and positive TUNEL staining than uninfected controls. Apoptotic cell death likely plays an important role in the pathogenesis of rabies virus infection in suckling mice. There was evidence of more apoptosis in the brains of suckling mice than in those of adult mice and this finding explains the greater neurovirulence of rabies virus in younger mice. Rabies virus likely induces apoptosis in vivo by both direct and indirect mechanisms (Jackson and Reid, 1998).
      2. Bats:
        1. Ontology: UMLS:C0999479
        2. Model Host: Fruit-eating bat (Reid and Jackson, 2001)
        3. Model Pathogens:
        4. Description: An experimental model of rabies was established in the fruit-eating bat species Artibeus jamaicensis. The infections caused by CVS-N2c and CVS-B2c, which are both stable variants of CVS-24, were compared after inoculation of adult bats in the right masseter muscle. CVS-N2c produced neurologic signs of rabies with paresis, ataxia, and inability to fly, while CVS-B2c did not produce neurologic signs. Bats were sacrificed and the distribution of rabies virus antigen was assessed in tissue sections with immunoperoxidase staining. Both viruses spread to the brain stem and bilaterally to the trigeminal ganglia by days 2 to 3. CVS-N2c had disseminated widely in the central nervous system (CNS) by day 4 and had involved the spinal cord, thalamus, cerebellum, and cerebral cortex. CVS-B2c had infected neurons in the spinal cord on day 5 and in the cerebellum, thalamus, and cerebral cortex on day 6. Infected pyramidal neurons of the hippocampus were observed on day 5 in CVS-N2c infection, but infected neurons were never noted in the hippocampus in CVS-B2c infection. CVS-N2c infected many more neurons and more prominently involved neuronal processes than CVS-B2c. CVS-N2c spread more efficiently in the CNS than CVS-B2c. Morphologic changes of apoptosis or biochemical evidence of DNA fragmentation were not observed in neurons with either virus after this route of inoculation. The different neurovirulent properties of these CVS variants in this model were not related to their in vivo ability to induce apoptosis (Reid and Jackson, 2001).
      3. Hamsters:
        1. Ontology: UMLS:C0018557
        2. Model Host: Hamsters (Alves et al., 2003)
        3. Model Pathogens:
        4. Description: Hamsters orally inoculated with ERA and PV strains of rabies virus were sacrificed at 24, 48, 72 hours, 21 and 30 days after inoculation. Brain fragments were examined by Fluorescent Antibody test (FAT) and heminested PCR (hn-PCR). Fragments from stomach, blood, heart, and lung were examined only by hn-PCR. Sera of other hamsters, similarly inoculated, obtained at 30th day after inoculation were submitted to mouse neutralization test. The hamsters were challenged intracerebrally with CVS strain with 102.7mouse LD50/0.03mL, 45 days after inoculation. Brains examined by FAT were negative. The hn-PCR detected the presence of rabies virus RNA in the lung of one animal inoculated with ERA, and in the brain, stomach, blood, and lung of PV-infected animals. The orally inoculated virus was capable to infect and replicate in several organs and tissues; however, none of the challenged hamsters did survive after challenge (Alves et al., 2003).
      4. Mice:
        1. Ontology: UMLS:C0025929
        2. Model Host: Mice (Jackson et al., 2006)
        3. Model Pathogens:
        4. Description: A comparative study was performed in two-day-old ICR mice inoculated in a hindlimb thigh muscle with recombinant rabies virus vaccine strain SAD-L16 (L16) or SAD-D29 (D29), which contains an attenuating substitution of Arg333 in the rabies virus glycoprotein. Mortality with L16 was 100% at day 7 post-inoculation (p.i.) and 75% at 17 days p.i. for D29. L16 spread to the brain more quickly than D29. There was more disseminated involvement of the brain and many more infected neurons in L16 infection, particularly in the neostriatum, hippocampus, and cerebral cortex. Both viruses induced neuronal apoptosis, which was most marked in the brainstem tegmentum and internal granular layer of the cerebellum. In light of the lower burden of infection and smaller number of neurons infected with D29, this less virulent virus was a stronger inducer of neuronal apoptosis than the more virulent L16. These findings support previous in vitro studies indicating that there is an inverse relationship between pathogenicity and apoptosis. Induction of apoptosis, which is an innate mechanism in which the host restricts viral spread, may contribute to severe clinical neurological disease when there is viral invasion into the central nervous system (Jackson et al., 2006).
      5. Mice:
        1. Ontology: UMLS:C0025929
        2. Model Host: Mice (Johnson et al., 2006)
        3. Model Pathogens:
        4. Description: In this study, the hypothesis that lyssaviruses, particularly RABV and the bat variant EBLV-2, might be transmitted via the airborne route was tested. Mice were challenged via direct introduction of lyssavirus into the nasal passages. Two hours after intranasal challenge with a mouse-adapted strain of RABV (Challenge Virus Standard), viral RNA was detectable in the tongue, lungs and stomach. All of the mice challenged by direct intranasal inoculation developed disease signs by 7 days post-infection. Two out of five mice challenged by direct intranasal inoculation of EBLV-2 developed disease between 16 and 19 days post-infection. In addition, a simple apparatus was evaluated in which mice could be exposed experimentally to infectious doses of lyssavirus from an aerosol. Using this approach, mice challenged with RABV, but not those challenged with EBLV-2, were highly susceptible to infection by inhalation. These data support the hypothesis that lyssaviruses, and RABV in particular, can be spread by airborne transmission in a dose-dependent manner. This could present a particular hazard to personnel exposed to aerosols of infectious RABV following accidental release in a laboratory environment (Johnson et al., 2006).
  2. Mammals:
    1. Taxonomy Information:
      1. Species:
        1. Mammals (NCBI Taxonomy):
          • Ontology: UMLS:C0024660
          • GenBank Taxonomy No.: 40674
          • Scientific Name: Mammalia (NCBI Taxonomy)
          • Description: Rabies is a viral disease which can affect all warm-blooded animals. Dogs, in addition to a variety of wild species, are important reservoirs of the rabies virus and vectors of the disease, notably in developing countries where rabies is most widespread. Indeed, an epidemiological study for 1991 shows that the dog is the most important rabies reservoir (63% of countries are concerned about dog rabies) and that humans are most likely to be infected by dogs (93% of human cases for Africa; 72% for Asia) (Perrin et al., 1995). In the US, animal carriers may vary by region or state. Also, animal carriers vary around the world; mongooses and antelope are commomn sources in Africa, for instance (Hankins and Rosekrans, 2004) All mammals are probably susceptible to some degree, but experimental results suggest a hierarchy of species susceptibility. Very susceptible species include foxes, coyotes, jackals, and wolves. Cats (known as vectors but not as reservoirs), and some wifelife species, such as raccons, are moderately susceptible to infection. The opossum (Didelphis virginiana) appears especially resistant (de Mattos et al., 2001). Since Pasteur's experimental inoculation of dogs and rabbits, many other species have been experimentally infected with RABV, including birds. No lyssavirus have been isolated from cold-blooded vertebrates. Laboratory rodents, such as mice, have been extensively used for rabies diagnosis, vaccine potency testing, and pathogenic studies, although these taxa are epidemiologically insignificant as lyssavirus vectors or reservoirs, compared to the Carnivora and Chiroptera (de Mattos et al., 2001).
          • Variant(s):
            • Homo sapiens (NCBI Taxonomy):
              • GenBank Taxonomy No.: 9606
              • Scientific Name: Homo sapiens (NCBI Taxonomy)
              • Common Name: Human (NCBI Taxonomy)
              • Description: Human infections and deaths are an unfortunate consequence of biologic processes of virus maintenance in which humans play no significant role. Rabies virus and the other six recognized members of the Lyssavirus genus, some of which cause diseases indistinguishable from rabies in humans, are adapted to various animals species on which they depend for their existence (Childs, 2002).

    2. Infection Process:

      No infection process information is currently available here.

    3. Disease Information:

      No disease information is currently available here.

    4. Prevention:

      No prevention information is currently available here.

    5. Model System:

      No model system information is currently available here.


IV. Labwork Information

A. Biosafety Information:
  1. Biosafety information for : Rabies virus :
    • Biosafety Level: In general biosafety level 2 safety practices are adequate for routine laboratory activities such as diagnosis and animal handling. Besides basic facility design, precautions should also include personal protection equipment (e.g. clothing) and pre-exposure vaccination. Certain situations may entail consideration of a biosafety level 3 classification, including production of large quantities of concentrated virus, conducting procedures that may generate aerosol and when working with lyssaviruses for which the effectiveness of current prophylaxis is not known. All national safety guidelines for working with infectious agents should be followed (WHO, 2002).
    • Precautions:
      • Any laboratory work with rabies virus should be considered as highly dangerous and all specimens suspected of being infected with rabies must be handled with care and under appropriate safety conditions specified by the World Health Organization. It is also recommended that all personnel working in a rabies diagnosis laboratory and those performing necropsy procedures should be preimmunized against rabies and their immunological status checked regularly. Preexposure vaccination should also be given to professionals such as veterinarians likely to come into contact with rabid animals and to medical staff attending to potential rabies cases, and persons who had intimate contact with rabid patients should be offered PET (Woldehiwet, 2005). Those assisting in the removal of the brain from an animal suspected of having rabies should wear heavy rubber gloves, a face shield, and protective clothing ( Smith, 2003a).
B. Culturing Information:
  1. Serum free culture :
    1. Description: Rabies virus suspensions were obtained from VERO cells cultivated on solid microcarriers in a bioreactor after infection with the Pasteur rabies virus strain (PV). Virus production-serum free medium (VP-SFM) or Leibovitz 15 (L15) medium supplemented or not with fetal calf serum (FCS) were used to cultivate the VERO cells, before and after virus infection. The cell growth was shown to reach higher densities (1.6x10(6) cells mol-l), when VP-SFM supplemented with 1% of FCS was used during the cell growth phase of culture, and then replaced by VP-SFM alone for the virus multiplication phase (Frazzati-Gallina et al., 2001).

    2. Medium:
      1. VP-SFM, supplemented only in the initial cell growth phase by 1% FCS (Frazzati-Gallina et al., 2001).
    3. Optimal Temperature: 34 C (Frazzati-Gallina et al., 2001)
    4. Optimal pH: 7.15 (Frazzati-Gallina et al., 2001)
    5. Note: In the cultures performed from the beginning with VP-SFM, lower densities accompanied by an altered cell morphology and detachment from the microcarriers were always observed. In rabies virus infected cultures, kinetic studies showed that higher virus yields (10(4.7) FFD(50) per 0.05 ml) were always obtained in cultures performed initially on VP-SFM supplemented with 1% FCS and after infection on VP-SFM alone. In agreement with that, rabies virus production, as measured by the average of virus titers in harvests obtained at different times after infection were shown to be 5.5 times higher in the cell cultures using initially VP-SFM+1%FCS and, following infection, VP-SFM alone (Frazzati-Gallina et al., 2001).
  2. Continuous cell culture :
    1. Description: The unpredictable and problematic delay associated with in vivo isolation (i.e. MIT) can be reduced greatly by inoculation and detection of virus in continuous cell culture. Cell culture medium is used as the diluent for the tissue suspension preparation. After clarification of the suspension medium by light centrifugation, the sample is inoculated onto cell monolayers or added to cells in suspension. A murine neuroblastoma cell line that is susceptible to rabies virus infection is generally selected. Tissue culture flasks or 96- well plates are seeded with host cells, and the cells are incubated from one to several days before they are examied by DFA for evidence of rabies virus infection. Evidence of infection is found with appearance of intracytoplasmic inclusions in clusters of infected cells (fluorescent foci) in the monolayer (Niezgoda et al., 2002).

    2. Medium:
      1. Eagle minimum essentail medium supplemented with 10% fetal bovine serum, 10% tryptose phosphate broth, 2.0 mM glutamine, 2.0% sodium carbonate, 200 IU of penicillin, and 0.4 mg of streptomycin per ml (Rudd and Trimarchi, 1987).
    3. Optimal Temperature: 34 C (Niezgoda et al., 2002)
    4. Optimal pH: 7.6 (Niezgoda et al., 2002)
    5. Note: Sensitivity, which can be enhanced by the addition of DEAE-dextran to the cell culture medium, rivals that of the IFA test and the MIT. With result available in a fixed period of only a few days, cell culture isolation has a must greater paractical value than the MIT for prompt initiation of PET in the advent of a wekly positive speciment that was not detected by the original DFA test (Niezgoda et al., 2002).
  3. Cell culture :
    1. Description: For rabies virus production step, pH was maintained at 7.4, pO2 at 30% air-saturation, agitation rate at 100 rpm and temperature at 34 C. Once the temperature reached 34 C, recirculation and agitation were stopped and microcarriers were left to settle down. Cells were then washed twice with M199 + 0.2% BSA and infected at an MOI of 0.3 in 50% of the working volume to increase virus infection efficiency. Two hours after cell infection, the bioreactor volume was adjusted to 4 l and perfusion was restarted at a rate equal to 0.5 reactor volume/day. Samples were taken daily to determine the following parameters: cell density, cell viability, microcarriers load, virus titer, cell infection, glucose, lactate and ammonia levels (Trabelsi et al., 2006).

    2. Medium:
      1. MEM + 10%FCS (Trabelsi et al., 2006) M199 + 5% FCS (Trabelsi et al., 2006)
    3. Optimal Temperature: 34 C (Trabelsi et al., 2006)
    4. Optimal pH: 7.4 (Trabelsi et al., 2006)
  4. Vero cell culture :
    1. Description: Vero cell cultures were infected with a Pasteur strain of rabies virus adapted to Vero cells (PV/Vero) at 0.05 multiplicity of infection (MOI). For virus infection, the cell-loaded MCs were allowed to settle, the supernatants removed, and approximately 50 mL of a virus suspension added. For virus adsorption, the cultures were stirred intermittently (1-min stirring at 20 rpm, 15-min rest) for 1 h, then the volume was brought to 200 mL by adding complete medium and cultures stirred continuously at 60 rpm. Samples were collected daily and the virus titers determined in supernatants by the rapid fluorescent focus inhibition test (RFFIT) on baby hamster kidney (BHK-21) cells (ATCC 10). The test allowed foci of virus-infected cells to be observed by fluorescent antibody staining (Yokomizo et al., 2004).

    2. Medium:
      1. Lebovitz's 15 (L15) medium supplemented with 10% fetal bovine serum (FBS) (Yokomizo et al., 2004).
    3. Optimal Temperature: 37 C (Yokomizo et al., 2004)
    4. Optimal Humidity: 30% air-saturation (Yokomizo et al., 2004)
  5. Serum free culture :
    1. Description: A new serum-free medium (MDSS2) developed for the culture of various cell lines and for the production of several biologicals, was used for cell culture and virus production. The PV-Paris/BHK-21 rabies virus strain (adapted to the BHK-21 grown in monolayer) was adapted to BHK-21 cells cultivated in suspension and in the serum-free medium. High titres of rabies virus were obtained with bioreactors equipped with a perfusion system using BHK-21 cells grown in suspension in MDSS2 (Perrin et al., 1995).

    2. Medium:
      1. Serum-free medium (MDSS2) which does not contain any growth factor was used was used to adapt BHK-21 cells for cultivation in suspension as clumps and for rabies virus production in bioreactors. It contain little protein (less than 40 micrograms per ml), 1.2 g per liter NaHCO3 and 3 grams per liter of glucose (Perrin et al., 1995).
    3. Optimal Temperature: 34 C (Perrin et al., 1995)
    4. Upper Temperature: 36.5 - 37.0 C (Perrin et al., 1995)
    5. Optimal pH: 7.2 (Perrin et al., 1995)
C. Diagnostic Tests :
  1. Organism Detection Tests:
    1. Microscopy:
      1. Ontology: UMLS:C0026018
      2. Time to Perform: unknown
      3. Description: Historically, microscopic examination of histologic preparations was the primary means of identifying evidence of rabies infection in postmortem samples from animals and humans. Fresh brain smears or microtome-cut sections of formalin-fixed, paraffin-embedded tissue were stained with combinations of basic fuchsin and methylin blue or with hematoxylin or eosin. Histopathologic evidence of encephalitis includes signs of inflammatory response, such as perivascular cuffing and cellular infiltrations. The presence of acidophilic intracytoplasmic inclusions, called Negri bodies, found prominently in the Purkinje cells of the cerebellum and the pyramidal cells of the hippocampus, is virtually pathognomonic for the disease. When reported by a an experienced pathologist, this provides a reliable diagnosis of the disease. Negri bodies detected during routine postmortem examinations of tissue following deaths attributed to encephalitis of unknown etiology continue to disclose occasional human rabies cases that were not suspected antemortem or at the time of death. Unfortunately, the presence, distribution, and size of Negri bodies are related to the species of animals, variant of rabies virus, and the duration of the clinical period prior to death. The sensitivity and reliability of the method are poor, with numerous surveys indicating that 25% or more of animals have no demonstrable Negri bodies. The method is therefore of limited value for public health purposes (Niezgoda et al., 2002).
      4. Picture(s):
        • Rabies Ultrastructure



          Description: Negatively stained Rhabdovirus as seen through an electron microscope. When viewed with an electron microscope Rhabdoviruses are seen as bullet-shaped particles. (A): Notice the bullet shape of the virus. (B): See the "bee hive" like striations of the RNP (ribonucleoprotein). (C): Notice the glycoprotein spikes in the outer membrane bilayer. (copyright: CDC)
        • Rabies virus budding



          Description: Rabies virus budding from an inclusion (Negri body) into the endoplasmic reticulum in a nerve cell. (A): Negri body. (B): Notice the abundant RNP (ribonucleoprotein) in the inclusion. (C): Budding rabies virus (copyright: CDC)
        • Ribonucleoprotein



          Description: Notice the abundant strands of coiled RNP (almost everything in the image is RNP (copyright: CDC))

  2. Immunoassay Tests:
    1. Fluorescent antibody test (FA) (WHO, 2002):
      1. Ontology: UMLS:C0016318
      2. Time to Perform: unknown
      3. Description: The fluorescent antibody (FA) technique is a rapid and sensitive method for diagnosing rabies infection in animals and humans. It is the gold standard for rabies diagnosis; however, the accuracy of this test depends upon the expertise of the examiner, and the quality of the anti-rabies conjugate and the fluorescence microscope. The test is based uponmicroscopic examination under ultraviolet light of impressions, smears or frozen sections of tissue after they have been treated with anti-rabies serum or globulin conjugated with fluorescein isothiocyanate. The diagonostic conjugate should be of high quality and the appropriate working dilutions must be determined in order to detect the different genotypes of lyssavirus. Impressions (or smears) of tissue samples from brainstem, thalamus, cerebellum and the hippocampus (Ammon's horns) are recommended for increased sensitivity of the test (WHO, 2002). Since the decision to withhold rabies postexposure vaccination following an animal bite is frequently based upon the results of laboratory diagnosis, the procedures used must be fast, specific, and very sensitive. The fluorescent-antibody test (FAT) has proven to be such a procedure when performed by an experienced laboratory with high-quality reagents. Because of the high medical significance of these examination results, virus isolation is commonly used as a back-up procedure to the FAT in rabies diagnosis (Rudd and Trimarchi, 1987).
      4. False Negative: False-negative FAT results are not common but can occur (Rudd and Trimarchi, 1987).
    2. Fluorescent antibody test (FAT) (Woldehiwet, 2005):
      1. Ontology: UMLS:C0016318
      2. Time to Perform: 1-hour-to-1-day
      3. Description: Over the last 30 years, the demonstration of Negri bodies has been progressively replaced by the detection of specific antigens by the direct or indirect FAT. The test was first used in 1958, and it became a routine diagnostic method in the 1970s. It is the test currently recommended by the WHO Expert Committee on Rabies. In most laboratories, the direct FAT in fresh or frozen sections of the brain or corneal impression smears or on skin biopsies is an integral part of the diagnosis of rabies. This test is now the most widely used test for the detection of rabies antigens, and compared to the histological demonstration of Negri bodies, it has a high degree of sensitivity. The test is particularly sensitive with fresh specimens, but it can also be used in fixed tissues after treatment with trypsin or other enzymes. However, it is reported to be less sensitive and less specific than the mouse inoculation test (MIT). The use of monoclonal antibodies is reported to increase the degree of specificity of the FAT and to differentiate rabies-related Lyssaviruses. The main advantage of this test is that results can be obtained within 2 h, but the test requires a UV microscope, fluorescein isothiocyanate-conjugated antirabies antibodies and well-trained personnel (Woldehiwet, 2005).
    3. Immunohistochemistry (Woldehiwet, 2005):
      1. Time to Perform: 1-hour-to-1-day
      2. Description: Over the last 20 years, various immunochemical methods of detecting rabies antigen in formalin-fixed sections have been described in studies designed to study the pathogenesis of the virus and the diagnosis of the disease in humans and animals. Rabies-specific monoclonal or polyclonal antibodies are used as primary antibodies and species-specific antibodies conjugated with peroxidase or avidin-biotin as secondary antibodies. These studies indicate that the detection of rabies viral antigens using peroxidase-labelled antibodies is more sensitive than the detection of Negri bodies and as sensitive as the FAT. Others reported that the peroxidase method gives superior results. Even higher sensitivities were reported by using the avidin-biotin complex (ABC) and the peroxidase-antiperoxidase (PAP) procedures, two methods that enhance the enzymatic reaction. The direct immunoperoxidase or the ABC and PAP systems have the advantage of being relatively simple, with less risk to those handling the material, and they can be used in formalin-fixed archived material. However, the immunoperoxidase, ABC and PAP have not been widely used because the procedures are relatively long, the reagents and the equipment required are relatively expensive, and some of the reagents are considered to be toxic or carcinogenic (Woldehiwet, 2005).
    4. Enzyme Linked Immunosorbent Assay (ELISA) (WHO, 2002):
      1. Ontology: UMLS:C0014441
      2. Time to Perform: unknown
      3. Description: Detection of lyssavirus nucleocapsid antigen by enzyme-linked immunosorbent assay (ELISA) has been described and used for many years in some laboratories. It is rapid and can be useful for epidemiological surveys. However, at present this test is not commercially available (WHO, 2002). Serological Tests (ELISA), virus neutralization, and indirect immunofluorescence are of no use in the diagnosis because antibody appears only late during the course of the disease, not earlier. Also, specimens from vaccinated persons yield a positive reaction. Antibody in the CSF is diagnostic, provided it is not the result of a post vaccinal neurological reaction ( Kraus et al., 2003). Enzyme-linked immunosorbent assays (ELISA) are showing promise of improved sensitivity as a result of avidin-biotin amplification and are employed for rapid and simple diagnosis of other viral infections. A similar method have been developed for the detection of rabies antigen. The method offers the benefit of sensitivity when applied to poorly preserved specimens and manual or automated reading, making them well suited for use in field condotions. While these methods can be used for confirmatory testing to back the DFA test, they are not used widely in public health laboratories for primary diagnosis. Delays in shipping to the few laboratories that perform these tests and in the processing of the samples presently limit their applications for decisions of post exposure management (Niezgoda et al., 2002).
    5. Enzyme Immunoassay:
      1. Ontology: UMLS:C0086231
      2. Time to Perform: unknown
      3. Description: We have developed and evaluated a simple enzyme immuno-assay (EIA) to detect rabies antigen in the brain specimens of animals and humans. We have also evaluated the utility of this test in ante mortem diagnosis of human rabies. The brain homogenates of suspected rabid animals (n=250), humans (n=16) and clinical samples like saliva (n=16) and cerebrospinal fluid (CSF, n=16) applied on to ELISA plates coated with rabies antinucleoprotein antibody and the absorbed rabies nucleoprotein antigen was detected using biotinylated anti-nucleoprotein antibody followed by treatment with streptavidin peroxidase conjugate and colour development with OPD. Rabies infected and normal mouse brain homogenates were used as positive and negative controls respectively. The results of this test was evaluated with fluorescent antibody technique (for brain samples) and mice inoculation test (for saliva and CSF samples). A distinct dark brown color was seen in positive control and all positive samples and there was no color development in negative control and samples. The concordance between FAT and EIA was 98.4% with brain samples, 83.3% with saliva and 91.6% with CSF samples. The specificity of the test was found to be 100%. It can be concluded that the EIA described here is a sensitive, specific and rapid test for post mortem diagnosis of rabies in animals and humans (Vasanth et al., 2004).
    6. Enzyme-Linked Immunosorbent Assay:
      1. Ontology: UMLS:C0014441
      2. Time to Perform: unknown
      3. Description: The enzyme-linked immunosorbent assay (ELISA) was first developed for the titration of antirabies antibodies in vaccinated animals or human beings but later modified for the detection of antigens in brain tissue. Further studies led to the development of a rapid-ELISA method based on the detection of the nucleocapsid of rabies virus in the brains of infected animals. In this method, antinucleocapsid rabbit IgG immobilized in microplates is used to capture rabies antigens followed by the same antibody conjugated with peroxidase to demonstrate specific binding. Comparative studies on the sensitivity and specificity of rapid-ELISA and that of the FAT for the detection of rabies antigen showed agreements of 96% or higher, but the former was less sensitive. However, rapid-ELISA is more sensitive in detecting antigens in decomposed specimens, which are not suitable for immunofluorescence. Furthermore, running the test does not require a UV microscope. A modified version of rapid-ELISA was reported to increase the rate of detection of rabies and rabies-related Lyssaviruses. This method, which is based on the immunocapture of rabies nucleoprotein by rabies-specific polyclonal antibodies (PAb), broadens detection by incorporating to the ELISA capture system PAb against Serotype 1 (PV strain), Serotype 3 (Mokola strain) and European Bat Lyssavirus type 1 (EBL1). ELISA-based methods have the advantage of automation, but they suffer from the need to use expensive equipment and expensive and often toxic or carcinogenic reagents (Woldehiwet, 2005).
    7. Rapid Immunohistochemical Test:
      1. Time to Perform: minutes-to-1-hour
      2. Description: A rapid immunohistochemical test (RIT) to detect rabies virus (RABV) antigen has been developed in the Rabies Section of the Centers for Disease Control and Prevention (CDC) by incorporating various components of existing immunoperoxidase techniques. Like the DFA, the RIT is performed on brain touch impressions, but the product of the reaction can be observed by light microscopy, and RABV antigen appears as magenta inclusions against a blue neuronal background. The test recognizes all genotype 1 variants of RABV examined to date and all representative lyssaviruses. Modifications of a former indirect test have led to a direct test (dRIT) that uses a cocktail of highly concentrated and purified biotinylated anti-nucleocapsid monoclonal antibodies produced in vitro in a direct staining approach and allows a diagnosis to be made in <1 hour. For the routine diagnosis of rabies, glycerol saline is a convenient preservative in situations in which refrigeration or freezing facilities are not promptly available (Lembo et al., 2006).

  3. Nucleic Acid Detection Tests: :
    1. Reverse Transcriptase-PCR (Crepin et al., 1998):
      1. Ontology: UMLS:C0599161
      2. Time to Perform: unknown
      3. Description: An optimized reverse transcription (RT)-PCR protocol for the intravitam detection of rabies virus genomic RNA was tested with clinical samples obtained from 28 patients suspected of having rabies, 9 of whom were confirmed to have had rabies by postmortem examination. RT-PCR using saliva combined with an immunofluorescence assay performed with skin biopsy samples allowed detection of rabies in the nine patients (Crepin et al., 1998).
      4. Primers:
        • N12, N40
          • Forward: N12 (5' GTAACACCTCTACAATGG 3'), positions 57 - 74 (Crepin et al., 1998)
          • Reverse: N40 (5' GCTTGATGATTGGAACTG 3'), positions 1368 - 1349) (Crepin et al., 1998)
          • Real-time-probe: Primer set N3 (5' GTCTCTTTGAAGCCTGAG 3', positions 113 to 130)-N23 (5' GGTCTCTCGTCAGTTCCAT 3', positions 464 to 446) and primer set N17 (5' TTCTTCCACAAGAACTTTG 3', positions 848 to 866)-N2 (5' CCCATATAGCATCCTAC 3', positions 1030 to 1013) were used to generate two digoxigenin-labelled probes by PCR. Hybridization with the two complementary digoxigenin-labelled probes and detection by chemiluminescence were performed by using a nonradioactive DNA labelling and detection kit. [Note: All the positions of the primers are given based on the PV strain sequence] (Crepin et al., 1998).
    2. Hemi-Nested Reverse Transcriptase Polymerase Chain Reaction (hn-RT-PCR):
      1. Time to Perform: unknown
      2. Description: [A heminested reverse transcriptase PCR (hnRT-PCR) protocol which is rapid and sensitive for the detection of rabies virus and rabies-related viruses is described. Sixty isolates from six of the seven genotypes of rabies and rabies-related viruses were screened successfully by hnRT-PCR and Southern blot hybridization. Of the 60 isolates, 93% (56 of 60) were positive by external PCR, while all isolates were detected by heminested PCR and Southern blot hybridization. Results of a comparison of the sensitivity of the standard fluorescent-antibody test (FAT) for rabies antigen and that of hnRT-PCR for rabies viral RNA with degraded tissue infected with a genotype 1 virus indicated that FAT failed to detect viral antigen in brain tissue that was incubated at 37 C for greater than 72 h, while hnRT-PCR detected viral RNA in brain tissue that was incubated at 37 C for 360 h.] (Heaton et al., 1997) Rabies-specific polymerase chain reaction (PCR) amplification was carried out using the method described by Heaton et al. Briefly, this amplifies a 606-bp region of the nucleoprotein with the primerJW12 and a cocktail of three primers, JW6 (DPL, E and M), that amplify all known Lyssaviruses. The hemi-nested amplification was performed as described by Heaton et al., using JW12 and a cocktail of the internal primers JW10 (P, ME1, and DLE2). A standard reaction with these primers results in a 586-bp PCR product (Smith et al., 2003b). In 2001, the UK had two confirmed human rabies cases, imported from the Philippines and Nigeria, respectively. In case one, hemi-nested reverse transcriptase polymerase chain reaction (hn-RT-PCR) and automated sequencing confirmed the presence of rabies virus (RABV) within both the saliva and skin specimens within 36 h of sample submission. Subsequent phylogenetic analysis using a partial sequence of the nucleoprotein (N-) gene segment demonstrated that the virus was closely related to that of canine variants currently circulating in the Philippines. In the second case, the fluorescent antibody test and reverse transcriptase polymerase chain reaction (RT-PCR) confirmed the diagnosis on post-mortem tissue. Phylogenetic analysis of two genomic segments of this isolate confirmed that it was a classical RABV (genotype 1) of the Africa 2 subgroup. These cases have highlighted the capability of molecular diagnostic tests for the rapid identification and subsequent genotyping of RABV to host and geographical location. In the first instance, rabies diagnosis often rests on clinical and epidemiological grounds. Negative tests, even late in the illness, do not exclude the diagnosis as these tests are never optimal and are entirely dependent on the nature and quality of the sample supplied. For this reason, rapid molecular detection and virus typing will be essential in considering the appropriate medical treatment regimen for a patient. In addition, an early diagnosis may decrease the number of unnecessary contacts with the patient and reduce the requirement for invasive and costly interventions. Rabies should form part of a differential diagnosis for any patient presenting with a history of travel to a rabies endemic country and displaying an undiagnosed encephalopathy (Fooks et al., 2003).
      3. Primers:
    3. Hemi-Nested Reverse Transcriptase Polymerase Chain Reaction (hn-RT-PCR) (Heaton et al., 1997):
      1. Time to Perform: unknown
      2. Description: Heaton and co-workers described the development of a heminested reverse transcriptase PCR (hnRT-PCR) protocol which is rapid and sensitive for the detection of rabies virus (RV) and rabies-related viruses (RRVs). The hnRT-PCR assay, which uses a cocktail of primers capable of detecting six genotypes of RV and RRVs. The resultant method offers a higher level of sensitivity than FAT for normal and decomposed tissues. Sixty isolates from six of the seven genotypes of rabies and rabies-related viruses were screened successfully by hnRT-PCR and Southern blot hybridization. Of the 60 isolates, 93% (56 of 60) were positive by external PCR, while all isolates were detected by heminested PCR and Southern blot hybridization. A comparison of the sensitivity of the standard fluorescent antibody test (FAT) for rabies antigen and that of hnRT-PCR for rabies viral RNA with degraded tissue infected with a genotype 1 virus, indicated that FAT failed to detect viral antigen in brain tissue that was incubated at 37 C for greater than 72 h, while hnRT-PCR detected viral RNA in brain tissue that was incubated at 37 C for 360 h. [NOTE: The letters in parentheses refer to the genotypes on which the primer design was based: DPL, Duvenhage virus, PV, and Lagos bat virus; E, EBLs 1 and 2; M, Mokola virus; DLE2, represents Duvenhage virus, Lagos bat virus, and EBL 2; ME1, Mokola virus and EBL 1; P, PV. Nucleotide positions are numbered according to the PV sequence] (Heaton et al., 1997).
      3. Primers:
        • External primers: JW12, JW6
          • Forward: JW6 (DPL) 5' CAATTCGCACACATTTTGTG 3' [660-641] (Heaton et al., 1997) JW6 (E) 5' CAGTTGGCACACATCTTGTG 3' [660-641] (Heaton et al., 1997) JW6 (M) 5' CAGTTAGCGCACATCTTATG 3' [660-641] (Heaton et al., 1997)
          • Reverse: JW12 5' ATGTAACACC(C/T)CTACAATTG 3' [55-73] (Heaton et al., 1997)
          • Real-time-probe: Confirmatory Southern blot hybridization with nonradioactive labelling with digoxigenin (DIG) dUTP was performed with the primary and heminested amplification products according to the manufacturer's instructions. A cocktail of internal probes (probes SB1 and SB2) were labelled with DIG by using a 3'-end-labelling kit, and the probes were quantified according to the manufacturer's instructions (Heaton et al., 1997). SB1 (140-165): 5'-GATCA(A:G)TATGAGTACAAGTACCCTGC-3' (Heaton et al., 1997) SB2 (140-165): 5'-GATCAATATGAATATAAATATCCCGC-3' (Heaton et al., 1997)
          • Product
        • Hemi-nested primers JW10, JW12
          • Forward: JW10 (DLE2) 5' GTCATCAAAGTGTG(A/G)TGCTC 3' [636-617] (Heaton et al., 1997) JW10 (ME1) 5' GTCATCAATGTGTG(A/G)TGTTC 3' [636-617] (Heaton et al., 1997) JW10 (P) 5' GTCATTAGAGTATGGTGTTC 3' [636-617] (Heaton et al., 1997)
          • Reverse: JW12 5' ATGTAACACC(C/T)CTACAATTG 3' [55-73] (Heaton et al., 1997)
          • Real-time-probe: Confirmatory Southern blot hybridization with nonradioactive labelling with digoxigenin (DIG) dUTP was performed with the primary and heminested amplification products according to the manufacturer's instructions. A cocktail of internal probes (probes SB1 and SB2) were labelled with DIG by using a 3'-end-labelling kit, and the probes were quantified according to the manufacturer's instructions (Heaton et al., 1997). SB1 (140-165): 5'-GATCA(A:G)TATGAGTACAAGTACCCTGC-3' (Heaton et al., 1997) SB2 (140-165): 5'-GATCAATATGAATATAAATATCCCGC-3' (Heaton et al., 1997)
          • Product
    4. Polymerase Chain Reaction (Sacramento et al., 1991):
      1. Ontology: UMLS:C0032520
      2. Time to Perform: 1-to-2-days
      3. Description: Sacramento et al. have investigated the PCR amplification technique of viral nucleic acids as an alternative protocol for diagnosis and epidemiological studies of rabies virus. A primer set mapping in the nucleoprotein cistron allowed a specific and sensitive amplification of infected brain material. One hundred samples checked by Southern or dot-blot analysis using both radioactive and non-radioactive probes showed identical results in parallel with routine techniques (Sacramento et al., 1991).
      4. Primers:
        • N1, N2
          • Forward: N1 (587-605): 5'-TTTGAGACTGCTCCTTTTG-3' (Sacramento et al., 1991)
          • Reverse: N2 (1029-1013): 5'-CCCATATAGCATCCTAC-3' (Sacramento et al., 1991)
          • Real-time-probe: To obtain specific probes, DNA fragments internal to the amplified segments were prepared from previously described plasmids containing rabies or Mokola gene insertions. The N probe was a Rsa-Pvu II fragment in position 665-908 in the PV strain rabies genome. The probes were either P(32)-labelled or non radioactively labelled with digoxigenin-dUTP (Sacramento et al., 1991).
          • Product
    5. Nucleic-Acid Sequence Based Amplification (NASBA):
      1. Ontology: UMLS:C0887816
      2. Time to Perform: 1-hour-to-1-day
      3. Description: Wacharapluesadee and Hemachudha described a technique based on amplification of nucleic-acid sequences to detect rabies-specific RNA in the saliva and cerebrospinal fluid (CSF) of four living patients with rabies. Rabies RNA could be detected in either saliva or CSF, or both, in all patients and as early as day 2 after onset of symptoms. By using an appropriate pair of primers, one of which contains the T7 RNA polymerase binding site to the target RNA, a large number of RNA copies can be generated and detected by an automated reader, provided that an electrochemiluminescence (ECL) detection region is attached to the 5' end of the other primer. Both saliva and CSF should be serially tested because not every sample can be expected to be positive. The whole process, including automated extraction, isothermal amplification, and detection can be done within 4 h. Amplification products were detected using an ECL-based probe hybridisation NucliSens system. The captured (antisense) probe used (5'-ACTGTGCCCACTCTGATTGCTG AAT-3'; 756-732) was chosen because it was close to the N2 primer region (Wacharapluesadee and Hemachudha, 2001).
      4. Primers:
    6. Real time PCR (Heaton et al., 1999):
      1. Time to Perform: 1-hour-to-1-day
      2. Description: Both conventional RT-PCR and Real time PCR (TaqMan) have been described for the detection of rabies virus RNA from saliva and tissue respectively, however to date, there have been no studies comparing conventional and real time PCR assays for detection of rabies virus nucleic acid using saliva samples for ante mortem diagnosis. Nagara and co-workers evaluated the utility of conventional RT-PCR and SYBR Green I Real time PCR in the ante mortem diagnosis of rabies using saliva samples. Saliva samples collected from twenty-four patients presenting with typical clinical manifestations of rabies were tested in the two assays. Amongst the 24 samples tested, 21 samples (87.5%) were positive by either of the two molecular methods. Of these 21, rabies virus RNA was detected in 6/21 in the conventional RT-PCR assay while SYBR Green I Real time PCR could detect RNA in 18/21 samples. Real time PCR assay was more sensitive than conventional RT-PCR assay (sensitivity 75% versus 37%, p=0.0189) (Nagaraj et al., 2006).
      3. Primers:
        • O1, R6
          • Forward: O1(66-82): 5'-CTACAATGGATGCCGAC-3' (Nagaraj et al., 2006)
          • Reverse: R6 (201-183): 5'-CCTAGAGTTATACAGGGCT-3' (Nagaraj et al., 2006)
          • Real-time-probe: SYBR Green I: SYBR Green I molecules bind to all double stranded DNA molecules emitting a fluorescent signal on binding proportional to the amplicon synthesis during the PCR reaction. This property enabled an accurate analysis of the melting temperature curve of the amplified fragments generated by real time PCR to determine the detection of specific products. Real time target amplification profile demonstrated a specific main peak with a melting temperature Tm at 78 C and sometimes a second weak peak at 70 C representing non-specific products (primer dimers) (Nagaraj et al., 2006).
    7. RT-PCR-ELISA (Whitby et al., 1997):
      1. Time to Perform: 1-hour-to-1-day
      2. Description: A rapid detection method for the six established genotypes of rabies and rabies-related viral RNA using RT-PCR-ELISA is described. The detection of digoxigenin-labelled amplified products is performed by solution hybridization to two specific, biotin-labelled, capture probes, which are complementary to the inner region of the amplification products. The capture probe and amplified product hybrid are then immobilised on a streptavidin-coated microtitre plate, bound products are detected by an anti-DIG Fab fragment conjugated to peroxidase, and colorimetric reaction automatically measured. This method was up to 100-fold more sensitive than Southern blot hybridization, detecting 0.00002 TCID(50)/ml of a genotype 1, classical rabies virus strain. The complete detection methodology from RT-PCR to PCR-ELISA detection could be completed within 10 h. Using this procedure, we were 100% successful in detecting 60 isolates from a representative selection of the six established genotypes from all over the world. This test is a useful additional tool for the detection of the rabies and rabies-related viruses, which is easy to perform, rapid and highly sensitive (Whitby et al., 1997).
      3. Primers:
        • JW6 (DPL, E, M), JW12
        • Hemi-nested primers JW10, JW12
          • Forward: JW10 (DLE2) 5' GTCATCAAAGTGTG(A/G)TGCTC 3' [636-617] (Whitby et al., 1997) JW10 (ME1) 5' GTCATCAATGTGTG(A/G)TGTTC 3' [636-617] (Whitby et al., 1997) JW10 (P) 5' GTCATTAGAGTATGGTGTTC 3' [636-617] (Whitby et al., 1997)
          • Reverse: JW12 5' ATGTAACACC(C/T)CTACAATTG 3' [55-74] (Whitby et al., 1997)
          • Real-time-probe: Confirmatory Southern blot hybridization, using non-radioactive labelling with (digoxigenin) DIG-11-dUTP was performed on the primary and (heminested) hnRT-PCR amplification products according to the manufacturer's instructions. A cocktail of internal probes, SB1 and SB2 were DIG-labelled using a 3' end labelling kit, and quantified according to the manufacturer's instructions (Whitby et al., 1997). Capture probe: BP4 (141-169): 5'-GATCA(A/G) TATGAGTACAAGTACCCTGC-3' (Whitby et al., 1997) Capture probe: BP5 (141-169): 5'-GATCAATATGAATATAAATATCCCGC-3' (Heaton et al., 1999) Southern blot hybridization probe: SB1 (140-165): 5'-GATCA(A:G)TATGAGTACAAGTACCCTGC-3' (Whitby et al., 1997) Southern blot hybridization probe: SB2 (140-165): 5'-GATCAATATGAATATAAATATCCCGC-3' (Whitby et al., 1997)
          • Product
    8. High speed air thermo-cycler PCR (Heaton et al., 1999):
      1. Time to Perform: 1-hour-to-1-day
      2. Description: The rapid identification of suspect rabies infection is essential in human cases, to ensure appropriate post-exposure treatment of contacts, and in animal cases to allow specific control strategies to be decided and implemented. Heaton et al. described the use of high speed air thermo-cycler PCR as a diagnostic tool for the detection of rabies and rabies-related viruses. Using this technique they were able to diagnose rabies in a human within 5 h. Furthermore, the application of automated sequencing of the resultant product enabled a definitive characterisation of classical rabies within 16 h. The utility of this assay was confirmed further by the successful detection of representatives of the six lyssavirus genotypes. [NOTE: Nucleotide positions are numbered according to the PV sequence] (Heaton et al., 1999).
      3. Primers:
        • External primers: JW12, JW6
          • Forward: JW6 (DPL) 5' CAATTCGCACACATTTTGTG 3' [660-641] (Heaton et al., 1999) JW6 (E) 5' CAGTTGGCACACATCTTGTG 3' [660-641] (Heaton et al., 1999) JW6 (M) 5' CAGTTAGCGCACATCTTATG 3' [660-641] (Heaton et al., 1999)
          • Reverse: JW12 5' ATGTAACACC(C/T)CTACAATTG 3' [55-74] (Heaton et al., 1999)
          • Real-time-probe: Confirmatory Southern blot hybridization with nonradioactive labelling with digoxigenin (DIG) dUTP was performed with the primary and heminested amplification products according to the manufacturer's instructions. A cocktail of internal probes, SB1 and SB2 were labelled with DIG by using a 3'-end-labelling kit, and quantified according to the manufacturer's instructions (Heaton et al., 1999). SB1 (140-165): 5'-GATCA(A:G)TATGAGTACAAGTACCCTGC-3' (Heaton et al., 1999) SB2 (140-165): 5'-GATCAATATGAATATAAATATCCCGC-3' (Heaton et al., 1999)
          • Product
        • Hemi-nested primers JW10, JW12
          • Forward: JW10 (DLE2) 5' GTCATCAAAGTGTG(A/G)TGCTC 3' [636-617] (Heaton et al., 1999) JW10 (ME1) 5' GTCATCAATGTGTG(A/G)TGTTC 3' [636-617] (Heaton et al., 1999) JW10 (P) 5' GTCATTAGAGTATGGTGTTC 3' [636-617] (Heaton et al., 1999)
          • Reverse: JW12 5' ATGTAACACC(C/T)CTACAATTG 3' [55-74] (Heaton et al., 1999)
          • Real-time-probe: Confirmatory Southern blot hybridization with nonradioactive labelling with digoxigenin (DIG) dUTP was performed with the primary and heminested amplification products according to the manufacturer's instructions. A cocktail of internal probes, SB1 and SB2 were labelled with DIG by using a 3'-end-labelling kit, and quantified according to the manufacturer's instructions (Heaton et al., 1999). SB1 (140-165): 5'-GATCA(A:G)TATGAGTACAAGTACCCTGC-3' (Heaton et al., 1999) SB2 (140-165): 5'-GATCAATATGAATATAAATATCCCGC-3' (Heaton et al., 1999)
          • Product
    9. Hemi- and fully nested RT-PCR and TaqMan assay as molecular diagnostic tests for the detection of lyssaviruses (Foord et al., 2006):
      1. Time to Perform: 1-hour-to-1-day
      2. Description: To evaluate and implement molecular diagnostic tests for the detection of lyssaviruses in Australia. A published hemi-nested reverse transcriptase polymerase chain reaction (RT-PCR) for the detection of all lyssavirus genotypes was modified to a fully nested RT-PCR format and compared with the original assay. TaqMan assays for the detection of Australian bat lyssavirus (ABLV) were compared with both the nested and hemi-nested RT-PCR assays. The sequences of RT-PCR products were determined to assess sequence variations of the target region (nucleocapsid gene) in samples of ABLV originating from different regions. The nested RT-PCR assay was highly analytically specific, and at least as analytically sensitive as the hemi-nested assay. The TaqMan assays were highly analytically specific and more analytically sensitive than either RT-PCR assay, with a detection level of approximately 10 genome equivalents per microl. Sequence of the first 544 nucleotides of the nucleocapsid protein coding sequence was obtained from all samples of ABLV received at Australian Animal Health Laboratory during the study period. The nested RT-PCR provided a means for molecular diagnosis of all tested genotypes of lyssavirus including classical rabies virus and Australian bat lyssavirus. The published TaqMan assay proved to be superior to the RT-PCR assays for the detection of ABLV in terms of analytical sensitivity. The TaqMan assay would also be faster and cross contamination is less likely. Nucleotide sequence analyses of samples of ABLV from a wide geographical range in Australia demonstrated the conserved nature of this region of the genome and therefore the suitability of this region for molecular diagnosis. Note: (a) Primer name in bracket according to Heaton et al., 1997. (b) Key: R = A or G; Y = C or T. (c) Nucleotide positions are numbered according to Rabies Virus sequence (PV strain, Tordo et al., 1986, GenBank: X03673) (Foord et al., 2006).
      3. Primers:
        • External primers: D007[JW12], D008, D009, D010 [JW6], D017
        • Hemi-nested primers: D011, D012, D013 [JW10], D007 [JW12]
        • Fully-nested primers: D011, D012, D013 [JW10], D007 [JW12]
        • TaqMan PCR (Insectivorous ABLV): LYSF-YB, LYSR-YB
          • Forward: LYSF-YB: 5'-GAACGCCGCGAAGTTGG-3' [191-207] Insectivorous ABLV TaqMan primer (Foord et al., 2006)
          • Reverse: LYSR-YB: 5'-AGATCCCCTCAAATAACTCCATAGC-3' [240-264] (Foord et al., 2006)
          • Real-time-probe: TaqMan probe LYSF-YB-FAM: 6FAM-CGGACGATGTTTGCTCCTACCTAGCTGC-TAMRA [211-238] (Foord et al., 2006)
        • TaqMan PCR (Pteropid ABLV)
          • Forward: LYSF-FF: 5'-TCGGGAATGAATGCTGCAA-3' [183-201] (Foord et al., 2006)
          • Reverse: LYSR-FF: 5'-GGCAGAYCCCCTCAAATAACTC-3' [267-247] (Foord et al., 2006)
          • Real-time-probe: TaqMan probe LYSF-FF-FAM: 6FAM-ACCCCGATGATGTATGTTCTTACTTAGCTGCAG-TAMRA [208-239] (Foord et al., 2006)

  4. Other Types of Diagnostic Tests:
    1. Mouse Inoculation Test (MIT):
      1. Time to Perform: unknown
      2. Description: Since 1935 the intracerebral inoculation of mice (mouse inoculation test) has served to confirm microscopic examination results for rabies diagnosis (Rudd and Trimarchi, 1987). The mice were inoculated intracerebrally with 0.03 ml of each dilution of test specimen and checked daily for 30 days. They were housed in negative-pressure biohazard containment isolators, which we exhausted outdoors through high-efficiency filters. Moribund mice were asphyxiated with C02, and slip smears of brain tissue were examined by the FAT for verification of rabies infection. The highest dilution infecting mice was considered the endpoint of the MIT. Mouse intracerebral 50% lethal doses were calculated by the method of Reed and Muench (Rudd et al., 1980).
    2. Rabies Tissue Culture Infection Test (RTCIT) (Rudd et al., 1980):
      1. Time to Perform: 2-to-7-days
      2. Description: The in vitro isolation of virus (rabies tissue culture infection test [RTCIT]) was performed in eight-well Lab-Tek tissue culture chamber slides or reusable tissue culture growth chambers. The test inoculum and cold cell suspension were added to the growth chambers at a ratio of 4 to 1. The test inoculum was diluted 1:5 or 1:10 with Eagle growth medium before being added to individual wells. One 1:5 well and one 1:10 well were inoculated per suspension. The test slides were incubated for 1 h in a humid chamber (34 C) incubator with a 5% C02 atmosphere. The medium containing DEAE-dextran was removed and replaced with fresh Eagle growth medium. The slides were incubated under the same conditions for 72 h. At this time the medium and chambers were removed from the slides. The slides were washed once by immersion in phosphate-buffered saline (pH 7.6) for 5 min and air dried. The FAT was then performed. Results were determined as negative (no antigen detected) or positive (the presence of one or more positive cells). The percentage of positive cells was estimated (Rudd and Trimarchi, 1987).

V. References

A. Journal References:
Alves et al., 2003: Alves LC, Soares RM, Cortez A, Richtzenhain LJ, Ito FN. Pathogenesis of rabies virus by ERA and PV strains administered orally in hamsters (M. auratus). Braz. J. Vet. Res. Anim. Sci. 2003; 40(1): 79 - 84.
Anderson et al., 1984: Anderson LJ, Nicholson KG, Tauxe RV, Winkler WG. Human rabies in the United States, 1960 to 1979: epidemiology, diagnosis, and prevention. Ann Intern Med. 1984; 100(5): 728 - 735. [PubMed: 6712036].
Arai, 2005: Arai YT. [Epidemiology of rabies virus and other lyssaviruses]. Nippon Rinsho. 2005; 63(12): 2167 - 2172. [PubMed: 16363690].
Arai et al., 2003: Arai YT. , Kuzmin IV, Kameoka Y, Botvinkin AD. New lyssavirus genotype from the Lesser Mouse-eared Bat (Myotis blythi), Kyrghyzstan. Emerg Infect Dis. 2003; 9(3): 333 - 337. [PubMed: 12643828].
Bourhy et al., 2005: Bourhy H, Dacheux L, Strady C, Mailles A. Rabies in Europe in 2005. Euro Surveill. 2005; 10(11): 213 - 216. [PubMed: 16371690].
Brochier et al., 1994: Brochier B, Boulanger D, Costy F, Pastoret PP. Towards rabies elimination in Belgium by fox vaccination using a vaccinia-rabies glycoprotein recombinant virus. Vaccine. 1994; 12(15): 1368 - 1371. [PubMed: 7887012].
Burton et al., 2005: Burton EC, Burns DK, Opatowsky MJ, El-Feky WH, Fischbach B, Melton L, Sanchez E, Randall H, Watkins DL, Chang J, Klintmalm G. Rabies encephalomyelitis: clinical, neuroradiological, and pathological findings in 4 transplant recipients. Arch Neurol. 2005; 62(6): 873 - 882. [PubMed: 15956158].
Calisher et al., 2006: Calisher CH, Childs JE, Field HE, Holmes KV, Schountz T. Bats: important reservoir hosts of emerging viruses. Clin Microbiol Rev. 2006; 19(3): 531 - 545. [PubMed: 16847084].
Conzelmann et al., 1990: Conzelmann KK, Cox JH, Schneider LG, Thiel HJ. Molecular cloning and complete nucleotide sequence of the attenuated rabies virus SAD B19. Virology. 1990; 175(2): 485 - 499. [PubMed: 2139267].
Coulon et al., 1989: Coulon P, Derbin C, Kucera P, Lafay F, Prehaud C, Flamand A. Invasion of the peripheral nervous systems of adult mice by the CVS strain of rabies virus and its avirulent derivative AvO1. J Virol. 1989; 63(8): 3550 - 3554. [PubMed: 2664219].
Crepin et al., 1998: Crepin P, Audry L, Rotivel Y, Gacoin A, Caroff C, Bourhy H. Intravitam diagnosis of human rabies by PCR using saliva and cerebrospinal fluid. J Clin Microbiol. 1998; 36(4): 1117 - 1121. [PubMed: 9542950].
Dietzschold and Koprowski, 2004: Dietzschold B, Koprowski H. Rabies transmission from organ transplants in the USA. Lancet. 2004; 364(9435): 648 - 649. [PubMed: 15325815].
Finke and Conzelmann, 2005: Finke S, Conzelmann KK. Replication strategies of rabies virus. Virus Res. 2005; 111(2): 120 - 131. [PubMed: 15885837].
Fooks et al., 2003: Fooks AR, Johnson N, Brookes SM, Parsons G, McElhinney LM. Risk factors associated with travel to rabies endemic countries. J Appl Microbiol. 2003; 94(Suppl): 31S - 36S. [PubMed: 12675934].
Foord et al., 2006: Foord AJ, Heine HG, Pritchard LI, Lunt RA, Newberry KM, Rootes CL, Boyle DB. Molecular diagnosis of lyssaviruses and sequence comparison of Australian bat lyssavirus samples. Aust Vet J. 2006; 84(7): 225 - 230. [PubMed: 16879123].
Frazzati-Gallina et al., 2001: Frazzati-Gallina NM, Paoli RL, Mourao-Fuches RM, Jorge SA, Pereira CA. Higher production of rabies virus in serum-free medium cell cultures on microcarriers. J Biotechnol. 2001; 92(1): 62 - 72. [PubMed: 1604174].
Fu, 1997: Fu ZF. Rabies and rabies research: past, present and future. Vaccine. 1997; 15(Suppl 1): S20 - S24. [PubMed: 9218287].
Gould et al., 2002: Gould AR, Kattenbelt JA, Gumley SG, Lunt RA. Characterisation of an Australian bat lyssavirus variant isolated from an insectivorous bat. Virus Res. 2002; 89(1): 1 - 28. [PubMed: 12367747].
Guyatt et al., 2003: Guyatt KJ, Twin J, Davis P, Holmes EC, Smith GA, Smith IL, Mackenzie JS, Young PL. A molecular epidemiological study of Australian bat lyssavirus. J Gen Virol. 2003; 84(Pt2): 485 - 496. [PubMed: 12560583].
Hankins and Rosekrans, 2004: Hankins DG, Rosekrans JA. Overview, prevention, and treatment of rabies. Mayo Clin Proc. 2004; 79(5): 671 - 676. [PubMed: 15132411].
Heaton et al., 1997: Heaton PR, Johnstone P, McElhinney LM, Cowley R, O'Sullivan E, Whitby JE. Heminested PCR assay for detection of six genotypes of rabies and rabies-related viruses. J Clin Microbiol.. 1997; 35(11): 2762 - 2766. [PubMed: 9350729].
Heaton et al., 1999: Heaton PR, McElhinney LM, Lowings JP. Detection and identification of rabies and rabies-related viruses using rapid-cycle PCR. J Virol Methods. 1999; 81(1-2): 63 - 69. [PubMed: 10488762].
Hemachudha et al., 2005: Hemachudha T, Wacharapluesadee S, Mitrabhakdi E, Wilde H, Morimoto K, Lewis RA. Pathophysiology of human paralytic rabies. J Neurovirol. 2005; 11(1): 93 - 100. [PubMed: 15804967].
Ito et al., 2001: Ito N, Takayama M, Yamada K, Sugiyama M, Minamoto N. Rescue of rabies virus from cloned cDNA and identification of the pathogenicity-related gene: glycoprotein gene is associated with virulence for adult mice. J Virol. 2001; 75(19): 9121 - 9128. [PubMed: 11533176].
Ito et al., 2001: Ito N, Kakemizu M, Ito KA, Yamamoto A, Yoshida Y, Sugiyama M, Minamoto N. A comparison of complete genome sequences of the attenuated RC-HL strain of rabies virus used for production of animal vaccine in Japan, and the parental Nishigahara strain. Microbiol Immunol. 2001; 45(1): 51 - 58. [PubMed: 11270607].
Jackson and Reid, 1998: Jackson AC, Park H. Apoptotic cell death in experimental rabies in suckling mice. Acta Neuropathol (Berl). 1998; 95(2): 159 - 164. [PubMed: 9498051].
Jackson et al., 2006: Jackson AC, Rasalingam P, Weli SC. Comparative pathogenesis of recombinant rabies vaccine strain SAD-L16 and SAD-D29 with replacement of Arg333 in the glycoprotein after peripheral inoculation of neonatal mice: less neurovirulent strain is a stronger inducer of neuronal apoptosis. Acta Neuropathol (Berl). 2006; 111(4): 372 - 378. [PubMed: 16453143].
John and Fooks, 2005: Johnson N, Fooks AR. Archival study of a Finnish isolate from the 1988/89 rabies outbreak. Arch Virol. 2005; 150(7): 1407 - 1414. [PubMed: 15789260].
Johnson et al., 2006: Johnson N, Phillpotts R, Fooks AR. Airborne transmission of lyssaviruses. J Med Microbiol. 2006; 55(Pt 6): 785 - 790. [PubMed: 16687600].
Kamolvarin et al., 1993: Kamolvarin N, Tirawatnpong T, Rattanasiwamoke R, Tirawatnpong S, Panpanich T, Hemachudha T. Diagnosis of rabies by polymerase chain reaction with nested primers. J Infect Dis. 1993; 167(1): 207 - 210. [PubMed: 8418168].
Krebs et al., 2005: Krebs JW, Mandel EJ, Swerdlow DL, Rupprecht CE. Rabies surveillance in the United States during 2004. J Am Vet Med Assoc. 2005; 227(12): 1912 - 1925. [PubMed: 16379626].
Lafay et al., 1991: Lafay F, Coulon P, Astic L, Saucier D, Riche D, Holley A, Flamand A. Spread of the CVS strain of rabies virus and of the avirulent mutant AvO1 along the olfactory pathways of the mouse after intranasal inoculation. Virology. 1991; 183(1): 320 - 330. [PubMed: 2053286].
Lawson et al., 1997: Lawson KF, Chiu H, Crosgrey SJ, Matson M, Casey GA, Campbell JB. Duration of immunity in foxes vaccinated orally with ERA vaccine in a bait. Can J Vet Res. 1997; 61(1): 39 - 42. [PubMed: 9008799].
Lembo et al., 2006: Lembo T, Niezgoda M, Velasco-Villa A, Cleaveland S, Ernest E, Rupprecht CE. Evaluation of a direct, rapid immunohistochemical test for rabies diagnosis. Emerg Infect Dis. 2006; 12(2): 310 - 313. [PubMed: 16494761].
Le Mercier et al., 1997: Le Mercier P, Jacob Y, Tordo N. The complete Mokola virus genome sequence: structure of the RNA-dependent RNA polymerase. J Gen Virol. 1997; 78(Pt 7): 1571 - 1576. [PubMed: 9225031].
Lunt, 2006: Lunt RA. Rabies and lyssavirus: An Australian diagnostic perspective. Aust J Med Sc. 2006; 27(1): 20 - 25. [PubMed: ].
Mackenzie, 2005: Mackenzie JS. Emerging zoonotic encephalitis viruses: lessons from Southeast Asia and Oceania. J Neurovirol. 2005; 11(5): 434 - 440. [PubMed: 16287684].
Mebatsion et al., 1992: Mebatsion T, Cox JH, Frost JW. Isolation and characterization of 115 street rabies virus isolates from Ethiopia by using monoclonal antibodies: identification of 2 isolates as Mokola and Lagos bat viruses. J Infect Dis. 1992; 166(5): 972 - 977. [PubMed: 1402044].
Moore et al., 2002: Moore SM, Ricke TA, Davis RD, Briggs DJ. The influence of homologous vs. heterologous challenge virus strains on the serological test results of rabies virus neutralizing assays. Biologicals. 2005; 33(4): 269 - 276. [PubMed: 16168666].
Morimoto et al., 1996: Morimoto K, Patel M, Corisdeo S, Hooper DC, Fu ZF, Rupprecht CE, Koprowski H, Dietzschold B. Characterization of a unique variant of bat rabies virus responsible for newly emerging human cases in North America. Proc Natl Acad Sci U S A. 1996; 93(11): 5653 - 5658. [PubMed: 8643632].
Nadin-Davis and Loza-Rubio, 2006: Nadin-Davis SA, Loza-Rubio E. The molecular epidemiology of rabies associated with chiropteran hosts in Mexico. Virus Res. 2006; 117(2): 215 - 226. [PubMed: 16303200].
Nadin-Davis et al., 1993: Nadin-Davis SA, Casey GA, Wandeler A. Identification of regional variants of the rabies virus within the Canadian province of Ontario. J Gen Virol. 1993; 74(Pt 5): 829 - 837. [PubMed: 8492088].
Nadin-Davis et al., 2006: Nadin-Davis SA, Muldoon F, Wandeler AI. A molecular epidemiological analysis of the incursion of the raccoon strain of rabies virus into Canada. . Epidemiol Infect. 2006; 134(3): 543 - 547. [PubMed: 16207385].
Nagaraj et al., 2006: Nagaraj T, Vasanth JP, Desai A, Kamat A, Madhusudana SN, Ravi V. Ante mortem diagnosis of human rabies using saliva samples: Comparison of real time and conventional RT-PCR techniques. J Clin Virol. 2006; 36(1): 17 - 23. [PubMed: 16504574].
Nel et al., 2000: Nel L, Jacobs J, Jaftha J, von Teichman B, Bingham J, Olivier M. New cases of Mokola virus infection in South Africa: a genotypic comparison of Southern African virus isolates. Virus Genes. 2000; 20(2): 103 - 106. [PubMed: 10872870].
Ondrejka et al., 2001: Ondrejka R, Ondrejkova A, Svrcek S, Benisek Z, Suli J, Zavadova J, Madar M, Mojzisova J. Oral Rabies Immunization of Swine: Use of Vnukovo-32/107 Vaccination Strain. Acta Vet. Brno. 2001; 70: 333 - 338.
Park et al., 2006: Park CH, Kondo M, Inoue S, Noguchi A, Oyamada T, Yoshikawa H, Yamada A. The histopathogenesis of paralytic rabies in six-week-old C57BL/6J mice following inoculation of the CVS-11 strain into the right triceps surae muscle. J Vet Med Sci. 2006; 68(6): 589 - 595. [PubMed: 16820716].
Perrin et al., 1995: Perrin P, Madhusudana S, Gontier-Jallet C, Petres S, Tordo N, Merten OW. An experimental rabies vaccine produced with a new BHK-21 suspension cell culture process: use of serum-free medium and perfusion-reactor system. Vaccine. 13; 13(13): 1244 - 1250. [PubMed: 8578811].
Randall et al., 2004: Randall DA, Williams SD, Kuzmin IV, Rupprecht CE, Tallents LA, Tefera Z, Argaw K, Shiferaw F, Knobel DL, Sillero-Zubiri C, Laurenson MK. Rabies in endangered Ethiopian wolves. Rabies in endangered Ethiopian wolves. 2004; 10(12): 2214 - 2217. [PubMed: 15663865].
Reid and Jackson, 2001: Reid JE, Jackson AC. Experimental rabies virus infection in Artibeus jamaicensis bats with CVS-24 variants. J Neurovirol. 2001; 7(6): 511 - 517. [PubMed: 11704883].
Rudd and Trimarchi, 1987: Rudd RJ, Trimarchi CV. Comparison of sensitivity of BHK-21 and murine neuroblastoma cells in the isolation of a street strain rabies virus. J Clin Microbiol. 1987; 25(8): 1456 - 1458. [PubMed: 3305560].
Rudd et al., 1980: Rudd JR, Trimarchi CV, Abelseth MK. Tissue culture technique for routine isolation of street strain rabies virus. J Clin Microbiol. 1980; 12(4): 590 - 593. [PubMed: 6999024].
Rupprecht et al., 2004: Rupprecht CE, Hanlon CA, Slate D. Oral vaccination of wildlife against rabies: opportunities and challenges in prevention and control. Dev Biol (Basel). 2004; 119: 173 - 184. [PubMed: 15742629].
Sacramento et al., 1991: Sacramento D, Bourhy H, Tordo N. PCR technique as an alternative method for diagnosis and molecular epidemiology of rabies virus. Mol Cell Probes. 1991; 5(3): 229 - 240. [PubMed: 1714538].
Sakamoto et al., 1994: Sakamoto S, Ide T, Nakatake H, Tokiyoshi S, Yamamoto M, Kawai A, Smith JS. Studies on the antigenicity and nucleotide sequence of the rabies virus Nishigahara strain, a current seed strain used for dog vaccine production in Japan. Virus Genes. 1994; 8(1): 35 - 46. [PubMed: 8209421].
Slate et al., 2005: Slate D, Rupprecht CE, Rooney JA, Donovan D, Lein DH, Chipman RB. Status of oral rabies vaccination in wild carnivores in the United States. Virus Res. 2005; 111(1): 68 - 76. [PubMed: 15896404].
Smith et al., 1967: Smith PC, Lawhaswasdi K, Vick WE, Stanton JS. Isolation of rabies virus from fruit bats in Thailand. Nature. 1967; 216(113): 384 - 384. [PubMed: 4861360].
Smith et al., 2003b: Smith J, McElhinney L, Parsons G, Brink N, Doherty T, Agranoff D, Miranda ME, Fooks AR. Case report: rapid ante-mortem diagnosis of a human case of rabies imported into the UK from the Philippines. J Med Virol. 2003; 69(1): 150 - 155. [PubMed: 12436491].
Takayama-Ito et al., 2006: Takayama-Ito M, Ito N, Yamada K, Sugiyama M, Minamoto N. Multiple amino acids in the glycoprotein of rabies virus are responsible for pathogenicity in adult mice. Virus Res. 2006; 115(2): 169 - 175. [PubMed: 16188341].
Thoulouze et al., 1997: Thoulouze MI, Lafage M, Montano-Hirose JA, Lafon M. Rabies virus infects mouse and human lymphocytes and induces apoptosis. J Virol. 1997; 71(10): 7372 - 7380. [PubMed: 9311815].
Trabelsi et al., 2006: Trabelsi K, Rourou S, Loukil H, Majoul S, Kallel H. Optimization of virus yield as a strategy to improve rabies vaccine production by Vero cells in a bioreactor. J Biotechnol. 2006; 121(2): 261 - 271. [PubMed: 16153733].
Vasanth et al., 2004: Vasanth JP, Madhusudana SN, Abhilash KV, Suja MS, Muhamuda K. Development and evaluation of an enzyme immunoassay for rapid diagnosis of rabies in humans and animals. Indian J Pathol Microbiol. 2004; 47(4): 574 - 578. [PubMed: 16295401].
Wacharapluesadee and Hemachudha, 2001: Wacharapluesadee S, Hemachudha T. Nucleic-acid sequence based amplification in the rapid diagnosis of rabies. Lancet. 2001; 358(9285): 892 - 893. [PubMed: 11567709].
Warrell and Warrell, 2004: Warrell MJ, Warrell DA. Rabies and other lyssavirus diseases. Lancet. 2004; 363(9413): 959 - 969. [PubMed: 15043965].
Whitby et al., 1997: Whitby JE, Heaton PR, Whitby HE, O'Sullivan E, Johnstone P. Rapid detection of rabies and rabies-related viruses by RT-PCR and enzyme-linked immunosorbent assay. J Virol Methods. 1997; 69(1-2): 63 - 72. [PubMed: 9504752].
Wilkerson, 2000: Wilkerson JA. Rabies update. Wilderness Environ Med. 2000; 11(1): 31 - 39. [PubMed: 10731906].
Windiyaningsih et al., 2004: Windiyaningsih C, Wilde H, Meslin FX, Suroso T, Widarso HS. The rabies epidemic on Flores Island, Indonesia (1998-2003). J Med Assoc Thai. 2004; 87(11): 1389 - 1393. [PubMed: 15825719].
Winkler et al., 1972: Winkler WG, Baker EF Jr, Hopkins CC. An outbreak of non-bite transmitted rabies in a laboratory animal colony. Am J Epidemiol. 1972; 95(3): 267 - 277. [PubMed: 4551654].
Woldehiwet, 2005: Woldehiwet Z. Clinical laboratory advances in the detection of rabies virus. Clin Chim Acta. 2005; 351(1-2): 49 - 63. [PubMed: 15563871].
Yakobson et al., 2006: Yakobson BA, King R, Amir S, Devers N, Sheichat N, Rutenberg D, Mildenberg Z, David D. Rabies vaccination programme for red foxes (Vulpes vulpes) and golden jackals (Canis aureus) in Israel (1999-2004). Dev Biol (Basel). 2006; 125: 133 - 140. [PubMed: 16878470].
Yokomizo et al., 2004: Yokomizo AY, Antoniazzi MM, Galdino PL, Azambuja N Jr, Jorge SA, Pereira CA. Rabies virus production in high vero cell density cultures on macroporous microcarriers. Biotechnol Bioeng. 2004; 85(5): 506 - 515. [PubMed: 14760691].
Yuan et al., 2003: Yuan Hui-jun, Hu R-L, Zhang S-F. Characteristics of the Glycoprotein cDNA and Antigenicity of Radies virus Vaccine Strain SRV9. Virologica Sinica. 2003; 18(1): 63 - 67.
B. Book References:
AHFS, 2005a: America Society of Health-System Pharmacists. Rabies Immune Globulin. 3195 - 3197. In: McEvoy Gerald K. AHFS Drug Information 2005. America Society of Health-System Pharmacists Inc, Bethesda, MD USA.
AHFS, 2005b: America Society of Health-System Pharmacists. Rabies Vaccine. 3303 - 3310. In: McEvoy Gerald K. AHFS Drug Information 2005. America Society of Health-System Pharmacists Inc, Bethesda, MD USA.
Bertino and Hayney, 2002: Bertino Joseph S, Hayney Mary S. Vaccines, Toxoids, and Other Immunobiologics. 2123 - 2149. In: Dipiro Joseph T, Talbert Robert L, Yee Gary C, Matzke Gary R, Wells Barbara G, Possey L Michael. Pharmacotherapy- A Pathophysiologic Approach, Fifth Edition 2002. McGraw-Hill Medical Publishing Division, New York . Chicago . San Francisco . Lisbon . London . Madrid . Mexico City . Milan . New Delhi . San Juan . Seoul . Singapore . Sydney .Toronto.
Bleck and Rupprecht, 2000: Bleck Thomas P, Rupprecht Charles E. Rhabdovirus. 2047 - 2056. In: Mandell Gerald L, Benneth John E, Dolin Raphael. Mandell, Douglas, and Benneth's Principles and Practice of Infectious Diseases 2000. Elsevier Churchill Livingstone, Philadelphia, Pennsylvania.
Childs, 2002: Childs James E. Epidemiology. 113 - 162. In: Jackson Alan C, Wunner William H. Rabies 2002. Academic Press, Amsterdam . Boston . London . New York . Oxford . Paris . San Diego . San Francisco . Singapore . Sydney . Tokyo.
Cohen, 1969: Cohen A Chapter 33: Rabiesvirus Infection. 335 - 349. In: Cohen A Textbook of Medical Virology 1969. Blackwell Scientific Publications, Oxford and Edinburgh.
de Mattos et al., 2001: de Mathos Carlos A, de Mattos Cecilia C, Rupprecht Charles E. Rhabdoviruses. 1245 - 1277. In: Knipe David M, Howley Peter M. Fields Virology 2001. Lippincott Williams & Wilkins, Philadelphia . Baltimore . New York . London . Buenos Aires . Hong Kong . Sydney . Tokyo.
Dietschold et al., 2005: Dietschold B, Schnell M, Koprowski H. Pathogenesis of Rabies. 45 - 56. In: Fu ZF. The World of Rhabdoviruses 2005. Springer Verlag, Berlin, Germany.
Gardner and King, 1991: Gardner S, King A. Rabies - recent developments in research and human prophylaxis. 141 - 163. In: Morgan-Capner Peter. Current Topics in Clinical Virology 1991. Oxford University Press, Oxford . New York . Tokyo.
Hattwick and Gregg, 1975: Hattwick Michael AW, Gregg Michael B. Chapter18: The Disease in Man. 281 - 304. In: Baer George M The Natural History of Rabies 1975. Academic Press, New York . San Francisco . London.
Jackson, 2002: Jackson Alan C. Human Disease. 219 - 244. In: Jackson Alan C, Wunner William H. Rabies 2002. Academic Press, Amsterdam . Boston . London . New York . Oxford . Paris . San Diego . San Francisco . Singapore . Sydney . Tokyo.
King, 1998: King AA. Rabies. 437 - 458. In: Palmer SR, Soulsby Lord, Simpson DIH. Zoonoses: Biology, Clinical Practice, and Public Health Control 1998. Oxford University Press, USA.
Kraus et al., 2003: Kraus Hartmut, Weber Albert, Appel Max, Enders Burkhard, Isenberg Henry D, Schiefer Hans Gerd, Slenczka Werner, von Graevenitz Alexander, Zahner Horst. Zoonosis Caused by Rhabdoviruses. 112 - 122. In: Kraus Hartmut, Weber Albert, Appel Max, Enders Burkhard, Isenberg Henry D, Schiefer Hans Gerd, Slenczka Werner, von Graevenitz Alexander, Zahner Horst. Zoonoses: Infectious Diseases Transmissible from Animals to Humans. Third Edition [Original German Edition: Zoonosen: Von Tier zu Mensch ubertragbare Infektionskrankheiten. Copyright: 1986, 1997, 2003 by Deutscher Arzte-Verlag GmbH, Koln, Germany] 2003. American Society of Microbiology Press, Washington DC, USA.
Niezgoda et al., 2002: Niezgoda Michael, Hanlon Cathleen A, Rupprecht Charles E. Animal Rabies. 163 - 218. In: Jackson Alan C, Wunner William H. Rabies 2002. Academic Press, Amsterdam . Boston . London . New York . Oxford . Paris . San Diego . San Francisco . Singapore . Sydney . Tokyo.
Niezgoda et al., 2002: Trimarchi Charles V, Smith Jean S. Diagnostic Evaluation. 307 - 349. In: Jackson Alan C, Wunner William H. Rabies 2002. Academic Press, Amsterdam . Boston . London . New York . Oxford . Paris . San Diego . San Francisco . Singapore . Sydney . Tokyo.
Rose and Whitt, 2001: Rose John K, Whitt Michael A. Rhabdoviridae. 1221 - 1244. In: Knipe David M, Howley Peter M. Fields Virology 2001. Lippincott Williams & Wilkins, Philadelphia . Baltimore . New York . London . Buenos Aires . Hong Kong . Sydney . Tokyo.
Smith, 2002: Smith Jean S. Molecular Epidemiology. 79 - 111. In: Jackson Alan C, Wunner William H. Rabies 2002. Academic Press, Amsterdam . Boston . London . New York . Oxford . Paris . San Diego . San Francisco . Singapore . Sydney . Tokyo.
Smith, 2003a: Smith Jean S. Rabies Virus. 1544 - 1552. In: Murray Patrick R. Manual of Clinical Microbiology 8th Edition 2003. ASM Press, Washington, DC.
Tsiang, 1988: Tsiang H. Chaper 4. Interactions of Rabies Virus and Host Cells. 67 - 100. In: Campbell and JB, Charlton KM. Rabies 1988. Kluwer Academic Publishers, .
WHO, 1973: World Health Organization. WHO Expert Committee on Rabies (Sixth Report). 3 - 55. In: World Health Organization. World Health Organization Technical Report Series No. 523, 1973. WHO Press, Geneva, Switzerland.
WHO, 2002: World Health Organization. WHO Expert Consultation on Rabies. 1 - 121. In: World Health Organization. WHO technical report series; 931 2004. WHO Press, Geneva, Switzerland.
Wiktor and Hattwick, 1977: Wiktor TJ, Hattwick MAW. Chapter18: Rabdoviruses: Rabies and Rabies-Related Viruses. 793 - 838. In: Kurstak Edward, Kurstak Christine Comparative Diagnosis of Viral Diseases 1977. Academic Press, New York . San Francisco . London.
Wunner, 2002: Wunner William H. Rabies Virus. 113 - 162. In: Jackson Alan C, Wunner William H. Rabies 2002. Academic Press, Amsterdam . Boston . London . New York . Oxford . Paris . San Diego . San Francisco . Singapore . Sydney . Tokyo.
C. Website References:
CDC(a): Rabies [ http://www.cdc.gov/ncidod/dvrd/rabies/the_virus/virus.htm ].
CDC(b): Rabies [ http://www.cdc.gov/ncidod/dvrd/rabies/Epidemiology/Epidemiology.htm ].
CDC(c): Rabies [ http://www.cdc.gov/ncidod/dvrd/rabies/natural_history/nathist.htm ].
FDA Consumer magazine July-August 2005 Issue: Reducing the Risk of Rabies [ http://www.fda.gov/fdac/features/2005/405_rabies.html ].
NCBI Taxonomy: Rabies virus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=11292 ].
NCBI Taxonomy: Rabies virus (strain AVO1) [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=11293&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Rabies virus (strain CVS-11) [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=11294&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Rabies virus (strain ERA) [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=11295&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Rabies virus (strain HEP-FLURY) [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=11296&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Rabies virus (strain Nishigahara RCEH) [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=11298&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Rabies virus (strain Ontario fox) [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=37132&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Rabies virus (strain ontario skunk) [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=39005&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Rabies virus (strain Pasteur / PV) [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=103929&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Rabies virus (strain PM) [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=11297&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Rabies virus (strain SAD B19) [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=11300&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Rabies virus (strain Street) [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=31613&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Rabies virus (strain vnukovo-32) [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=45418&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Rabies virus Eth2003 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=265000&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Thailand genotype 1 dog lyssavirus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=274042&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Entrez: Rabies virus genome [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=8648068 ].
NCBI Entrez: Rabies virus serotype 1, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=61808313 ].
NCBI Entrez: Rabies virus strain SHBRV-18, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=51860793 ].
NCBI Entrez: Rabies virus strain SRV9, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=49035250 ].
NCBI Entrez: Rabies virus genomic RNA, complete genome, strain:Ni-CE [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=39652602 ].
NCBI Entrez: Rabies virus genomic RNA, complete genome, viral-complementary sequence [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&val=8648084 ].
NCBI Entrez: Rabies virus genomic RNA, complete genome, strain:Nishigahara. [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&val=8648068 ].
NCBI Entrez: Rabies virus serotype 1, complete genome. [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&val=61808313 ].
NCBI Entrez: Rabies virus strain SHBRV-18, complete genome. [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&val=51860793 ].
NCBI Entrez: Rabies virus strain SRV9, complete genome. [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&val=49035250 ].
NCBI Entrez: Rabies virus genomic RNA, complete genome, strain:Ni-CE. [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&val=39652602 ].
NCBI Entrez: Rabies virus genomic RNA, complete genome, strain:HEP-Flury [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&val=27530021 ].
NCBI Entrez: Rabies virus (strain SAD B19), complete genome. [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&val=333556 ].
NCBI Entrez: Rabies virus M2, M1, G, N, and L genes, complete cds. [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&val=333585 ].
NCBI Entrez: Mokola virus, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=55770806 ].
NCBI Taxonomy: Homo sapiens [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9606&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Mammalia [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=40674&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Mammalia [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=40674&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Canis familiaris [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9615&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Entrez: Rabies virus, complete genome. [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&val=9627197 ].
NCBI Entrez: Rabies virus Eth2003 nucleoprotein (N) mRNA, complete cds. [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=44890092 ].
NCBI Taxonomy: Mokola virus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=12538 ].
NCBI Taxonomy: Lagos bat virus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=38766 ].
NCBI Taxonomy: Duvenhage virus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=38767 ].
NCBI Taxonomy: Australian bat virus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=90961 ].
NCBI Taxonomy: European bat lyssavirus 1 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=57482 ].
NCBI Taxonomy: European bat lyssavirus 2 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=57483 ].
NCBI Genome: Australian bat lyssavirus, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genome&cmd=Retrieve&dopt=Overview&list_uids=15865 ].
WHO Fact Sheet N 99, September 2005: Rabies [ http://www.who.int/mediacentre/factsheets/fs099/en/index.html ].
D. Thesis References:

No thesis or dissertation references used.


VI. Curation Information