Phakopsora pachyrhizi
I. Organism Information
A. Taxonomy Information
-
Species:
-
Phakopsora pachyrhizi
(Website 1):
-
Ontology: UMLS:C1197678
-
GenBank Taxonomy No.:
170000
-
Description:
Soybean Rust (SRB) is caused by two related species of fungi, the most aggressive is Phakopsora pachyrhizi Sydow (anamorph Malupa sojae), and the less virulent species, Phakopsora meibomiae (Arthur) Arthur (anamorph Malupa vignae) which has only been found in limited areas in the Western Hemisphere and is not known to cause severe yield losses in soybean (Hartman et al., 1996).
P. meibomiae, is referred to as the tropical, Latin American or New World rust strain (Website 49).
The Asian strain of soybean rust caused by P. pachyrhizi is extremely aggressive and is listed as a select biological agent (Title 7, Code of Federal Regulations, Part 331.2), determined to have the potential to pose a threat to plant health or plant products (Website 49)
Phakopsora pachyrhizi, is ranked #22 of the top 100 most dangerous and exotic pests and diseases (Website 46).
Phakopsora pachyrhizi is an air-borne fungal pathogen that is not present in the continental United States. Under conducive environmental conditions, this pathogen could cause serious economic and crop losses in major soybean production regions of the United States. The probability of long-distance spread of P. pachyrhizi across U.S. borders may be reduced through strong international cooperation to reduce inoculum levels beyond our borders. However, it is anticipated that the disease will eventually reach the U.S. and establish in major soybean growing regions via wind currents. The confirmation of the presence of Asian SBR in soybean production regions of Argentina, Bolivia, Brazil and Paraguay has lead to heightened concerns regarding the potential for spread to the continental United States. In particular, there is concern about potential introduction of Asian SBR in the importation of soybean seed, meal, and grain of host plant members of the pea and bean family (Leguminosae) (Website 49).
Extreme weather events (such as a hurricane) carried P. pachyrhizi from infested areas to the United States (Website 49).
Long-distance dispersal of fungal spores by the wind can spread plant diseases across and even between continents and reestablish diseases in areas where host plants are seasonally absent. For such epidemics to occur, hosts that are susceptible to the same pathogen genotypes must be grown over wide areas, as is the case with many modern crops (Brown and Hovmoller, 2002).
Besides via wind current from Africa or South America, experts predict there are several ways spores could potentially be carried into this country. Those include: by tourists who have traveled internationally, via the movement of plant materials from infected countries, through the land bridge of Central America or even intentionally, through bioterrorism (Website 44).
To compound the fears, soybean cultivars show little promise for genetic resistance or tolerance. There are only four known resistance genes for soybean, but all can be overcome by at least one of the many P. pachyrhizi isolates. In a search for genetic resistance, 940 soybean cultivars currently grown in the US and 12,000 soybean accessions from the USDA germplasm collection were evaluated in seedling assays against soybean rust at the BSL-3 containment greenhouse at Ft. Detrick, MD. None were found to be resistant and fewer than 100 showed any promise for disease tolerance (Website 46).
WASHINGTON, Nov 10, 2004 -- The U.S. Department of Agriculture's Animal and Plant Health Inspection Service today confirmed the presence of soybean rust on soybean leaf samples taken from two plots associated with a Louisiana State University research farm Saturday (Website 61).
On December 1, researchers at the National Plant Germplasm and Biotechnology Laboratory in Beltsville, Md., said today that one of two soybean leaf samples collected near Memphis, Tenn., has tested positive for Phakopsora pachyrhizi, or soybean rust. Soybean rust, has been confirmed in nine states since it was first discovered in the United States on Nov. 10 in Louisiana. Other states include Alabama, Arkansas, Florida, Georgia, Mississippi, Missouri and South Carolina. USDA encourages growers to contact USDA's Extension Service, their State Department of Agriculture, and their crop consultants to obtain information on what fungicides are registered for use in their states, as well as when these fungicides should be used."> (Website 62)
May 2, 2005 INDIANAPOLIS --The states of Georgia, Wisconsin and West Virginia have received Section 18 emergency exemptions for EC, Laredo EW and fungicides to be used for the control of soybean rust. Laredo EC and Laredo EW contain the active ingredient myclobutanil, while PropiMax contains the active ingredient propiconazole. Both fungicides provide preventive and curative control of soybean rust. Laredo EC and Laredo EW contain the active ingredient myclobutanil, while PropiMax contains the active ingredient propiconazole. Both fungicides provide preventive and curative control of soybean rust (Website 70).
B. Lifecycle Information
:
-
Stage Information:
-
Urediniospores (urediospores, uredospore, uredinospore) from infected host: (Website 49):
-
Size:
Uredinospores are 18-34 to 15-24 microns (Ono et al., 1992).
-
Shape:
Urediniospores are sessile, obovoid to broadly ellipsoid, and minutely and densely echinulate, and the walls are about 1 micron thick. The color of the urediniospores range from pale yellowish-brown to colorless (Ono et al., 1992).
-
Picture(s):
-
Soybean rust spores. (Photo courtesy of Dr. Glen Hartman.) (Website 66):
Description:
Diagnostic Characters for Soybean Rust Identification (Website 56)
-
Description:
Primary inocula for new infections are urediniospores (Website 49).
-
Uredinia bearing uredinospores: :
-
Size:
Subepidermal in origin, the uredinia are surrounded by paraphyses arising from peridioid pseudoparenchyma; in addition the uredinia have hymenal paraphyses (Ono et al., 1992).
Paraphyses are 25-50 by 5-14 microns slightly to conspicuously thickened (-18 microns) apically (Ono et al., 1992).
-
Shape:
Uredinia are amphigenous (growing all round), mostly hypophyllous (on the under surfaces of leaves), minute, scattered or in groups on discolored lesions (Ono et al., 1992).
The paraphyses are cylindric to clavate. Openings are through central apertures. In appearance, the uredinia are pulverulent (appearing as if powdered); in color, uredinia are pale cinnamon-brown (Ono et al., 1992).
-
Telia bearing teliospores: (Ono et al., 1992):
-
Size:
Teliospores are 15-26 by 6-12 microns (Ono et al., 1992).
-
Shape:
Telia are 2-7-spored layered. Often mixed with uredinia, the subepidermal telia are hypophyllus and crustose. The teliospores are single-celled, oblong to ellipsoid. The telia are chesnut-brown to chocolate brown; the teliospores are pale yellowish-brown to colorless (Ono et al., 1992).
-
Description:
Telia and teliospores have been reported on only six of 87 hosts in nature (Sinclair, 1982).
Teliospores are generally over-seasoning structures, and have been germinated under laboratory conditions to produce basidiospores (Saksirirat and Hoppe, 1991).
The importance of the telial stage in the development of soybean rust in the field is unknown (Website 49).
Teliospores are not generally considered the primary source of inoculum and are not often observed in the field (Ono et al., 1992).
-
Urediospores disseminated by wind: :
-
Description:
Wind dissemination of urediniospores facilitates short- and long-distance spread of the pathogen (Marchetti et al., 1976).
-
Susceptible host: :
-
Description:
New disease foci can develop as long as living host plants are available. Urediniospores infect native hosts (legumes, volunteer host plants and weeds) allowing the disease cycle to continue (Website 49).
-
Healthy host: :
-
Description:
New disease foci can develop as long as living host plants are available. Urediniospores infect native hosts (legumes, volunteer host plants and weeds) allowing the disease cycle to continue (Website 49).
-
Progression Information:
-
Life cycle of P. pachyrhizi --
From stage:
Urediniospores (urediospores, uredospore, uredinospore) from infected host
, To stage:
Susceptible host:
-
Description:
Urediospores germinate and the new uredinia matures in 10 days and they are capable of producing new urediospores for 3 weeks thereafter. The new urediospores may infect healthy plants, or an alternate or over-wintering host (such as kudzu) (Website 53).
Urediniospores are the most common spore type found during the growing season. These urediniospores are the primary inoculum source and with prevailing winds and conducive environmental conditions can initiate soybean rust epidemic (Yeh et al., 1976)
-
Life cycle of soybean rust (Website 53):
Description:
Soybean rust has a rapid repeating life cycle period (modified to gif from: http://www.cai.iastate.edu/SoybeanRust/Lifecycle.swf) (Website 53)
C. Genome Summary:
-
Genome of
Phakopsora pachyrhizi
-
Description:
The P. pachyrizhi genome is currently being sequenced (Website 58)
-
():
-
GenBank Accession Number:
-
Size:
()
-
Gene Count:
()
-
Description:
()
II. Epidemiology Information
Epidemics of Soybean rust (SBR) in Africa and South America have spread rapidly following their initial detection (Website 49).
Rust that causes these types of disease epidemics are characterized by multi-cyclic foci and copious production of urediniospores (Bromfield and Hartwig, 1980).
A single leaf with severe rust lesions, may contain an adequate mass of urediniospores to cause an SBR epidemic. (Bromfield and Hartwig, 1980).
Although theoretically possible, the infected leaf would need to be placed on live green tissue of a susceptible host, when temperature and free moisture conditions favor infection, within a period of time when the spores are still viable and able to cause infection. Local epidemics of SBR are characterized by examining spatial and temporal aspects, including final disease ratings of research plots, the apparent infection rates, and velocity of spread. However, specific values may vary across environment, cultivar, and between growing seasons (Website 49).
Apparent infection rate (r) relates disease progression to time, and is often calculated from disease progress curves using van der Planks logistic (logit-linear) model. Several authors calculate r for natural soybean rust populations using disease severity as a measure of disease progression, and days after planting (DAP) as a measure for time (Website 49).
Free water on plant surfaces is necessary for uredospore germination and direct penetration. Optimal temperature for infection is about 18-21C . In this range, infection can occur by 6.5 hours after penetration, but the success of infection is enhanced if leaf wetness last about 16 hours (Sinclair, 1982).
Each lesion can produce an average of more than 12,000 urediniospores in 4 to 6 weeks, with more than 400 lesions possible on heavily infested soybean leaves. (Bromfield and Hartwig, 1980).
A single leaf with severe rust lesions, may contain an adequate mass of urediniospores to cause an SBR epidemic (Bromfield and Hartwig, 1980).
The ability of P. pachyrhizi to cause an epidemic in soybean is dependant on a number of factors. Two of these are temperature and leaf wetness duration, which determine the suitability of infection periods. Another factor, at least when soybeans are grown during the dry season, is the timing of the first rain and the amount of rainfall. Even when soybeans are grown with mist-type overhead or furrow irrigation, rainfall initiates the development of a rust epidemic. Also as plants mature the rate of the epidemic increases (Tschanz and Shanmugasundram, 1984).
After traveling to Brazil in March, Holshouser says there's a continuous source of inoculum in South America. The disease never went away from what I saw, he says. I can understand why it's so bad because of the continuous inoculate source. We were in a southern Florida type of climate (Website 51).
Soybean rust would likely have to be blown in by air, similar to how blue mold arrives in the U.S. from the Caribbean (Website 51).
Soybean rust was detected in the continental U. S., and there is a response plan that will provide technical and educational support for local decision. Thereby minimizing the impacts and facilitating the dissemination of information on the first confirmed detection of SBR in the continental United States. The response plan will address the following issues: Incident Coordination, Communication (National and Local), Technical Support (Incident Assessment, Surveillance, Management, Forecasting) (Website 59).
In response to the recent introduction of Phakopsora pachyrhizi, or soybean rust, into the United States, USDA facilitated the development of a federal, state, university and industry-coordinated framework for surveillance, reporting, prediction, and management of soybean rust for the 2005 growing season (Website 67).
A. Outbreak Locations:
-
Soybean rust caused by Phakopsora pachyrhizi was first observed in Japan in 1902, and by 1934 the pathogen was found throughout most Asian countries and in Australia. The current distribution of P. pachyrhizi includes countries in Africa, Asia, Australia and most recently South America. Asian soybean rust (ASBR) causes serious crop losses in most infested soybean production regions. The disease has not yet been detected in Europe. SBR has been reported in the main soybean growing regions of Brazil including the states of Parana, Rio Grande do Sul, Mato Grosso do Sul and Goais. About 2.6 percent of the 15 million hectares planted to soybean in Brazil tested positive for the P. pachyrhizi, and the disease caused 10 percent loss in the 2000-2001 soybean crop in affected fields. In the Brazilian regions of Mato Grosso do Sul and Goais, ABR reduced yield by up to 75% in some fields. During the 2001-2002 growing season, Brazilian growers lost approximately 112 thousand tons of their annual soybean production. P. pachyrhizi is suspected to have been introduced to Brazil via air currents from Africa and/or Asia (Website 49).
Phakopsora pachyrhizi is present throughout the soybean production areas of Australia, Burma, Cambodia, China, Congo, Ghana, India, Indonesia, Japan, Kenya, Korea, Malaysia, Mozambique, Nepal, Nigeria, New Guinea, Philippines, Rwanda, Sierra Leone, South Africa, Taiwan, Thailand, Uganda, Vietnam, Zambia, and Zimbabwe. Soybean rust was observed in Hawaii in 1994 on the islands of Oahu, Kakaha, Kauai, and Hilo, where it is thought to have arrived in fresh soybean plants smuggled in for use in ethnic Laotian cuisine. P. pachyrhizi was first detected on the South American continent in Paraguay in 2001, where it was widely spread, then was wind spread across the border into Argentina. SBR was recently found in Bolivia in July, 2003 (Website 49).
In Uganda, the disease was first observed on experimental plots in 1996, and thereafter the disease was observed on farmer's field throughout the country with all the commercial cultivars succumbing to the disease (Kawuki et al. 2004).
WASHINGTON, Nov 10, 2004 -- The U.S. Department of Agriculture's Animal and Plant Health Inspection Service today confirmed the presence of soybean rust on soybean leaf samples taken from two plots associated with a Louisiana State University research farm Saturday (Website 61).
On December 1, researchers at the National Plant Germplasm and Biotechnology Laboratory in Beltsville, Md., said today that one of two soybean leaf samples collected near Memphis, Tenn., has tested positive for Phakopsora pachyrhizi, or soybean rust. Soybean rust, has been confirmed in nine states since it was first discovered in the United States on Nov. 10 in Louisiana. Other states include Alabama, Arkansas, Florida, Georgia, Mississippi, Missouri and South Carolina. USDA encourages growers to contact USDA's Extension Service, their State Department of Agriculture, and their crop consultants to obtain information on what fungicides are registered for use in their states, as well as when these fungicides should be used."> (Website 62)
Soybean rust was introduced into the continental United States in the fall of 2004, presumably as a consequence of tropical storm activity. Model predictions indicated that soybean rust had been widely dispersed throughout the southeastern United States, and subsequent field and laboratory observations confirmed this distribution. Figures 1 and 2 provide information on spore deposition in late 2004 and overwintering areas for soybean rust in the continental United States (Website 67).
The Asian soybean rust found Monday and confirmed today (4/27/2005) on volunteer soybeans in Seminole County, Georgia, was visible and sporulating on several plants across the field, according to the county agent who found it. And those plants are right next to a large acreage of very young commercial snap beans (Website 68).
Kemerait said the kudzu samples, found right next to the infected volunteer soybeans and in a patch that was positive for rust last year, had so many other diseases on them those particular ones might not test positive at the USDA lab. "I believe it's in the kudzu," he said. "They had the same spores, and were right next to each other," he said of the kudzu and the rust-positive volunteer soybeans, both found near Donalsvonville in the extreme southwest corner of the state. "We're at the very beginning of an epidemic," he said, "and you have to really believe it's there and try hard to see it to be able to find it at this early stage." (Website 68)
B. Transmission Information:
-
Ontology:
UMLS:xxx, GO:xxx, SNOMED:xxx, otherStd:xxx From:
Infected living host
(at lifecycle stage: Urediniospores (urediospores, uredospore, uredinospore) from infected host), To:
Infected living host
(at lifecycle stage: Healthy host) ():
Mechanism:
Soybean rust spreads primarily by wind-borne spores across regions dependent upon prevailing winds and environmental conditions conducive to disease development (Website 59).
The disease is likely to be restricted to parts of Florida and the southern Texas during the winter in the frost-free areas or areas where the fungus could overcome short periods of below-freezing temperatures. Occurrence of rust epidemics within the U. S. soybean belt would depend on south-to-north dispersal of urediospores (Pivonia and Yang, 2004).
Kudzu is a common weed in the southern U.S. and is great concern that it could serve as a continual source of P. pachyrhizi inocula. Kudzu begins growth in the spring before soybeans are planted and thus, the weed could act as a "disease bridge" by allowing build-up of the fungus followed by movement into soybean (Website 43).
C. Environmental Reservoir:
-
Infected living host
:
-
Ontology: UMLS:xxx, GO:xxx, SNOMED:xxx, otherStd:xxx
-
Description:
P. pachyrhizi is still known as an obligate parasite. Uredospores survive (in resting or dormant state) less than 2 days under natural outdoor conditions. They do not survive in dried or decayed tissues or in the soil (Ilag, 1977).
-
Survival Information:
When soybean plants are not present in the field the fungus is viable only when transferred to another living host (Ilag, 1977).
One widespread host in the United States is kudzu, Pueraria montana var. lobata, that could serve as a reservoir for soybean rust. There are a variety of other important hosts that are leguminous crops or weeds that have shown varying degrees of susceptibility to both species of Soybean rust. Some other common hosts are yellow sweet clover (Melilotus officinalis), vetch (Vicia dasycarpa), medic (Medicago arborea), lupine (Lupinus hirsutus), green and kidney bean (Phaseolus vulgaris), lima and butter bean (Phaseolus lunatus), and cowpea or backeyed pea (Vigna unguiculata) (Website 55).
Unfortunately, P. pachyrhizi infects and develops on kudzu but the weed is not adversely affected by the disease (Website 53).
D. Intentional Release:
No release information is currently available here.
III. Infected Hosts
-
Plants:
-
Taxonomy Information:
-
Species:
-
Legumes
(Website 63):
-
Ontology: UMLS:xxx, GO:xxx, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
C0023263
-
Scientific Name:
Fabaceae (Website 63)
-
Description:
Phakopsora pachyrhizi infects 31 species in 17 genera of legumes (Website 49).
Natural hosts (those hosts from which P. pachyrhizi has been found in situ include species in the Fabaceae family, sub-family Papilionoideae: Crotalaria spp., Desmodium spp., Glycine spp., Kennedia spp., Lablab purpureus, Lupinus spp., Macroptilium spp., Melilotus officinalis, Neonotonia wightii, Pachyrhizus erosus, Phaseolus spp., Pueraria lobata, Sesbania exaltata, Trifolium incarnatum, Vicia dasycarpa, Vigna spp (Website 49).
Sixty species in 26 other genera have been infected under controlled conditions (Website 49).
Any list of hosts requires cautious interpretation (Bromfield, 1984).
In some cases a species may be designated "host" when the pathogen induces a visible symptom, regardless of whether the fungus sporulates in that species or not. From an epidemiological point of view, a species that does not support sporulation of the pathogen would be of no functional importance (Bromfield, 1984).
Some plants permitting sporulation may be recorded as nonhosts because of an unexpectedly prolonged delay in the appearance of fertile uredinia (Bromfield, 1984).
The existence of pathotypes or races of the fungus and strains or varieties within a given legume species further complicates the picture (Bromfield, 1984).
In other instances, results obtained in the field and those obtained in greenhouses and growth cabinet, leading to uncertainty about the appropriateness of designating a particular species or accession as a "host" (Bromfield, 1984).
From a practical point of view, the wild and cultivated legumes in each region where rust is a problem should be screened locally to endemic populations of P. pachyrhizi to determine their status as potential functional hosts. The information obtained will clarify the roles of these legumes as possible sources of initial inoculum, inoculum reservoirs, and overseasoning hosts (Bromfield, 1984).
The unusually large host range may be due to the unique ability of the fungus to directly penetrate host epidermal cells through the formation of an appressorium and germ tube (Marchetti et al., 1976).
-
Crotalaria
(Website 6):
-
Ontology: UMLS: C0330703, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
3828
-
Scientific Name:
Crotalaria sp (Website 6).
-
Description:
Phakopsora pachyrhizi was found in Indonesia on Crotalaria sp. (Ono et al., 1992).
-
Desmodium
(Website 37):
-
Ontology: UMLSC1017684, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
53935
-
Scientific Name:
Desmodium podocarpum subsp. oxyphyllums (Website 37)
-
Description:
Phakopsora pachyrhizi was found in China on D. podocarpus var. oxyphyllum (Ono et al., 1992).
-
Glycine
(Website 8):
-
Ontology: UMLS: C1093478, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
48924
-
Scientific Name:
Glycine canescens (Website 8)
-
Description:
Phakopsora pachyrhizi develops under laboratory or greenhouse conditions on G. canescens (Ono et al., 1992).
-
Twining glycine
(Website 9):
-
Ontology: UMLS: C1012151, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
45687
-
Scientific Name:
Glycine clandestina (Website 9)
-
Description:
Phakopsora pachyrhizi develops under laboratory or greenhouse conditions on G. clandestina (Ono et al., 1992).
-
Glycine falcata
(Website 10):
-
Ontology: UMLS: C1012153, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
45690
-
Scientific Name:
Glycine falcata (Website 10)
-
Description:
Phakopsora pachyrhi develops under laboratory or greenhouse conditions on G. falcata (Ono et al., 1992).
-
Glycine tabacina
(Website 12):
-
Ontology: UMLS: C1011159, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
44016
-
Scientific Name:
Glycine tabacina (Website 12)
-
Description:
Phakopsora pachyrhizi develops under laboratory or greenhouse conditions on G. tabacina (Ono et al., 1992).
-
Kennedia
(Website 19):
-
Ontology: UMLS C1032082, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
76709
-
Scientific Name:
Kennedia rubicunda (Website 19)
-
Description:
Phakopsora pachyrhizi was found in Australia on K. rubicunda (Ono et al., 1992).
-
Hyacinth
Hyacinth-bean
(Website 13):
-
Ontology: UMLS:C0330857, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
35936
-
Scientific Name:
Lablab purpureus(Dolichos lablab) (Website 13)
-
Description:
Phakopsora pachyrhizi was found in Costa Rica, Puerto Rico, and West Indies on L. purpureus (Ono et al., 1992).
-
White lupine
(Website 41):
-
Ontology: UMLS C0330814,SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
3870
-
Scientific Name:
Lupinus albus (Website 40)
-
Description:
Phakopsora pachyrhizi develops under laboratory and greenhouse conditions on L. albus (Ono et al., 1992).
-
Yellow lupine
(Website 42):
-
Ontology: UMLS C0330820,SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
3873
-
Scientific Name:
Lupinus luteus (Website 42)
-
Description:
Phakopsora pachyrhii develops under laboratory and greenhouse conditions on L. tuteus (Ono et al., 1992).
-
Macroptilium
(Website 15):
-
Ontology: UMLS: C1040459, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
90550
-
Scientific Name:
Macroptilium atropurpureum (Website 15)
-
Description:
Phakopsora pachyrhizi develops under laboratory or greenhouse conditions on M. atropurpureum (Ono et al., 1992).
-
Melilotus
(Website 18):
-
Ontology: UMLS :C0065919, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
47083
-
Scientific Name:
Melilotus officinalis (Website 18)
-
Description:
Phakopsora pachyrhizi develops under laboratory or greenhouse conditions on M. officinalis (Ono et al., 1992).
-
Neonotonia
(Website 20):
-
Ontology: UMLS C1047973, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
103823
-
Scientific Name:
Neonotonia wightii (Website 20)
-
Description:
Phakopsora pachyrhizi develops under laboratory or greenhouse conditions on N. wightii (Ono et al., 1992).
-
Jicama
(Website 21):
-
Ontology: UMLS C0950067, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
109171
-
Scientific Name:
Pachyrhizus erosus (Website 21)
-
Description:
Phakopsora pachyrhizi was found in China, Malaysia, Indonesia, Taiwan, Phillipines, and Vietnam on P. erosus (Ono et al., 1992).
-
Lima bean
(Website 22):
-
Ontology: UMLS: C0330835, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
3884
-
Scientific Name:
Phaseolus lunatus (Website 22)
-
Description:
Phakopsora pachyrhizi was found in Puerto Rico, India, New Guinea on P. lunatus (Ono et al., 1992).
-
Kidney bean
(Website 23):
-
Ontology: UMLS C0973452, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
3885
-
Scientific Name:
Phaseolus vulgaris (Website 23)
-
Description:
Phakopsora pachyrhizi was found in Puerto Rico on P. vulgaris (Vakili et al., 1976).
-
Kudzu vine
(Website 24):
-
Ontology: C0950070, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
3893
-
Scientific Name:
Pueraria montana var. lobata (=P. lobata) (Website 24)
-
Description:
Phakopsora pachyrhizi was found in China, Indonesia, Japan, and Taiwan on P. montana var. lobata (Ono et al., 1992).
Kudzu is a common weed in the southern U.S. and is great concern that it could serve as a continual source of P. pachyrhizi inocula. Kudzu begins growth in the spring before soybeans are planted and thus, the weed could act as a "disease bridge" by allowing build-up of the fungus followed by movement into soybean (Website 43).
-
Pueraria
(Website 25):
-
Ontology: UMLS C1088685, SNOMEd:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
109224
-
Scientific Name:
Pueraria phaseoloides (Website 25)
-
Description:
Phakopsora pachyrhizi was found in Cambodia and Nepal on P. phasoloides (Ono et al., 1992).
-
Trifolium
(Website 29):
-
Ontology: UMLS C0330786, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
60916
-
Scientific Name:
Trifolium incarnatum (Trifolium incarnatum cv. Dixie) (Website 29)
-
Description:
Phakopsora pachyrhizi develops under laboratory and greenhouse conditions on T. incarnatum (Ono et al., 1992).
-
Vicia
(Website 45):
-
Ontology: UMLS C0330793, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
3904
-
Scientific Name:
Vicia dasycarpa (Website 45)
-
Description:
Phakopsora pachyrhizi develops under laboratory and greenhouse conditions on Vicia dasycarpa (Bromfield and Hartwig, 1980)
-
Calopo
(Website 3):
-
Ontology: UMLS: C1189780, otherStd:xxx
-
GenBank Taxonomy No.:
132433
-
Scientific Name:
Calopogonium mucunoides (Website 3)
-
Description:
Phakopsora pachyrhizi was found on Malaysia on C. mucunoides (Ono et al., 1992).
-
Pigeon pea
(Website 4):
-
Ontology: UMLS:C0996819
-
GenBank Taxonomy No.:
3821
-
Scientific Name:
Cajanus cajan (Website 4)
-
Description:
Phakopsora pachyrhizi develops under laboratory or greenhouse conditions on C. cajan (Ono et al., 1992).
-
Centrosema
(Website 5):
-
Ontology: UMLS:C1209775, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
185703
-
Scientific Name:
Centrosema pubescens (Website 5)
-
Description:
Phakopsora pachyrizi was found in Puerto Rico on C. pubescens (Vakili et al., 1976).
-
Delonix
(Website 7):
-
Ontology: UMLS: C1029321, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
72433
-
Scientific Name:
Delonix regia (Website 7)
-
Description:
Phakopsora pachyrhizi develops under laboratory or greenhouse conditions on D. regia (Ono et al., 1992).
-
Narrow-leaved blue lupine
(Website 14):
-
Ontology: UMLS: C0330815, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
3871
-
Scientific Name:
Lupinus angustifolius (Website 14)
-
Description:
Phakopsora pachyrhizi develops under laboratory or greenhouse conditions on L. angustifolius (Ono et al., 1992).
-
Macrotyloma
(Website 16):
-
Ontology: UMLS:C0996847, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
3876
-
Scientific Name:
Macrotyloma axillare (Website 16)
-
Description:
Phakopsora pachyrhizi develops under laboratory or greenhouse conditions M. axillare (Ono et al., 1992).
-
Medicago
(Website 17):
-
Ontology: UMLS C1084866, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
66807
-
Scientific Name:
Medicago arborea (Website 17)
-
Description:
Phakopsora pachyrhizi develops under laboratory or greenhouse conditions on M. arborea (Ono et al., 1992).
-
Rhynchosia
(Website 26):
-
Ontology: UMLS C1189807, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
132461
-
Scientific Name:
Rhynchosia minima (Website 26)
-
Description:
Phakopsora pachyrhizi develops under laboratory and greenhouse conditions on R. minima (Ono et al., 1992).
-
Bagpod
(Website 27):
-
Ontology: UMLS C0330743, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
54756
-
Scientific Name:
Sesbania vesicaria (Website 27)
-
Description:
Phakopsora pachyrhizi develops under laboratory and greenhouse conditions on S. vesicaria (Ono et al., 1992).
-
White clover
(Website 28):
-
Ontology: UMLS C0330781, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
3899
-
Scientific Name:
Trifolium repens (Website 28)
-
Description:
Phakopsora pachyrhizi develops under laboratory and greenhouse conditions on T. repens (Ono et al., 1992).
-
Fenugreek
(Website 30):
-
Ontology: UMLS C0060207, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
78534
-
Scientific Name:
Trigonella foenum-graecum (Website 30)
-
Description:
Phakopsora pachyrhizi develops under laboratory and greenhouse conditions on T. foenum-graecum (Ono et al., 1992).
-
Faba bean
(Website 31):
-
Ontology: UMLS C0330788 , SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
3906
-
Scientific Name:
Vicia faba (Website 31)
-
Description:
Phakopsora pachyrhizi develops under laboratory and greenhouse conditions on V. faba (Ono et al., 1992).
-
Teramnus
(Website 32):
-
Ontology: UMLS C1051271, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
109223
-
Scientific Name:
Teramnus uncinatus (Website 32)
-
Description:
Phakopsora pachyrhizi was found in Puerto Rico, St. Tomas, and West Indies on T. uncinatus (Seaver et al., 1926).
-
Black gram
(Website 33):
-
Ontology: UMLS C0996864, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
3915
-
Scientific Name:
Vigna mungo (Website 33)
-
Description:
Phakopsora pachyrhizi was found in Puerto Rico On V. mung (Vakili et al., 1976).
-
Cowpea
(Website 34):
-
Ontology: UMLSC0996865 , SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
3917
-
Scientific Name:
Vigna unguiculata (Website 34)
-
Description:
Phakopsora pachyrhizi was found in Cambodia, China, Ghana, Nigeria, and Sierra Leon on V. unguiculata (Ono et al., 1992).
-
Vigna
(Website 35):
-
Ontology: UMLSC1038388 , SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
87075
-
Scientific Name:
Vigna luteola (Website 35)
-
Description:
Phakopsora pachyrhizi develops under laboratory and greenhouse conditions on V. luteola (Ono et al., 1992).
-
Sesbania
(Website 36):
-
Ontology: UMLS C0330741SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
3894
-
Scientific Name:
Sesbania (Website 36)
-
Description:
Phakopsora pachyrhizi develops under laboratory and greenhouse conditions on Sesbania (Ono et al., 1992).
-
Erythrina
(Website 38):
-
Ontology: UMLS C1193627, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
157649
-
Scientific Name:
Erythrina senegalensis" (Website 38)
-
Description:
Phakopsora pachyrhizi was found in Nigeria, and Sierra Leone on E. senegalensis (Ono et al., 1992).
-
Erythrina variegata
(Website 39):
-
Ontology: UMLS C0996831, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
3845
-
Scientific Name:
Erythrina variegata (Website 39)
-
Description:
Phakopsora pachyrhizi was found in Philippines, and Thailand on E. variegata (Ono et al., 1992).
-
Lotus
(Website 40):
-
Ontology: UMLS C1046055,SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
100151
-
Scientific Name:
Lotus purshianus (Website 40)
-
Description:
Phakopsora pachyrhizi develops under laboratory and greenhouse conditions on L. purshianus (Ono et al., 1992).
-
Soybean
(Website 11):
-
Ontology: UMLS: C1262902, SNOMED:xxx, otherStd:xxx
-
GenBank Taxonomy No.:
3847
-
Scientific Name:
Glycine max (Website 11)
-
Description:
Phakopsora pachyrhizi was found on G. max in numerous countries and more recently in Hawaii (Ono et al., 1992).
-
Infection Process:
-
Description:
The infection process start when urediospores germinate to produce a single germ tube, formed appressoria and infect always by direct, cuticular penetration. Penetration started with the formation of an appressorial cone which was continuous with the cell wall of the penetration hypha. The penetration hypha entered the epidermal cell, transverse it and reached the intercellular space of the mesophyll where the first septum was formed separating the penetration hypha from the primary hypha. The first haustorium was visible between 24 and 48 hours after inoculation. Haustoria were formed in the mesophyll and epidermal cells (Koch et al., 1983).
Formation of uredospores is based on a sporogenous cell which by budding and septum formation produces a spore initial. By a second septum the uredospore initial is separated into a proximal pedicel and a distal, in mature uredospore (Koch et al., 1983).
It results in a column-like series of three cells lying one upon the other: the sporogenous cell, the pedicel, and the uredospore (Koch et al., 1983).
The first evidence of uredia formation, was the aggregation of hyphae into uredial primordia (Koch et al., 1983).
Uredia were commonly formed in the spongy mesophyll, liberating the spores on the lower surface of the leaf (Koch et al., 1983).
Uredinia may develop 5 to 8 days after infection by urediospores. Successful infections depend on the availability of moisture on plant surface. At least 6 hr of free moisture is needed (Koch et al., 1983).
Temperatures between 15 and 28 C are ideal for infection (Marchetti et al., 1976).
Soybean rust cannot over-winter below freezing temperatures (Website 50).
-
Disease Information:
-
Soybean Rust
(i.e., Soybean Rust)
(Website 1):
-
Pathogenesis Mechanism:
The first urediospores can be produced as early as 9 days after infection, and spore production can continue for up to 3 weeks (Koch et al., 1983).
Uredinia may develop for up to 4 weeks after a single inoculation, and secondary uredinia will arise on the margins of the initial infection for up to 8 weeks. Thus, from an initial infection, there could be first generation pustules that maintain sporulation for up to 15 weeks. Even under dry conditions this extended sporulation capacity allows the pathogen to persist and remain a threat. If conditions for re-infection are sporadic throughout the season, significant inoculum potential still remains from the initial infection to reestablish an epidemic (Koch et al., 1983).
-
Diagnosis Overview:
Early symptoms of Asian soybean rust (ASBR) are easily confused with bacterial pustule, bacterial blight and brown spot, when no spores, conidia or bacteria are evident (Website 54).
The soybean rust can be distinguished by two microscopic characteristic. Uredial pustules open through a round ostiole while bacterial pustules are torn across by a fissure. Breaking open the pustule will reveal a large number of urediniospores (Website 59).
Urediniospores can be identified by mounting them on a microscope slide and examining them under a compound microscope. Examination of the morphology of soybean uredinia and urediniospores found in soybean rust cone pustules cannot be used to confidently distinguish P. pachyrhizi from P. meibomiae. They can be distinguished based on difference in telia and teliospores. However, these are seldom seen in nature. Therefore, the only definitive methods for correct identification of ASBR are molecular techniques polymerase chain reaction (PCR) (Website 59).
In 2001, the development of both classical and real-time PCR assays was reported. The technique can be used to identify and differentiate between P. pachyrhizi and P. meibomiae. Also PCR assays can be used to detect P. pachyrhizi from infected plant tissue, with or without urediniospores, and facilitate surveying soybean fields and other plant species that may serve as alternate host for either of the Phakopsora spp. (Frederick et al., 2002).
The United States Department of Agriculture's Agricultural Research Service (ARS) laboratories in Ft. Detrick, Maryland made the primers available to APHIS, PPQ, Center for Plant Health, Science, and Technology (CPHST) in Beltsville, MD. ASBR diagnostic protocols have been validated by CPHST (Website 59).
-
Symptom Information
():
-
Soybean Rust Early Symptoms (Sinclair, 1982):
-
Description:
The most commonly observed symptom of soybean rust is the sporulating lesion on the lower surface of the leaf. In the early stages of development, the lesions may be confused with bacterial pustules (Sinclair, 1982).
Host plants infected with soybean rust exhibit small lesions that gradually increase in size and turn from gray to tan or brown. They become polygonally shaped restricted by veins, and may eventually reach 2 to 3 square millimeters (Website 59).
-
Soybean Rust Early Symptoms ():
Description:
-
Soybean Rust Late Symptoms (Sinclair, 1982):
-
Description:
At the onset of the disease, chlorotic to gray-brown or reddish brown spots appear on leaves and enlarge to form polygonal, tan or brown (sometime reddish brown or purplish brown lesions that eventually may reach 1 mm. Depending on the isolate of the fungus and the soybean strain, either reddish brown (RB-type) or tan (TAN-type) lesions appear; both types may appear on the same leaf of some cultivars. Lesions can appear on both leaf surfaces and on petioles and small stems (Sinclair, 1982).
-
Soybean Rust Uredia Development (Sinclair, 1982):
-
Description:
Pimple-like uredia develop in the lesions and release uredospores through a central pore. More uredia develop on the lower surface than on the upper surface of the leaf. Uredia with lesions multiply over time. Under some conditions, groups of uredia develop in tissue that is not discolored to form obvious lesions. The uredospores tend to stick together to form clumps; thus this disease is referred to as a sticky rust (Sinclair, 1982).
-
Defoliation (Sinclair, 1982):
-
Description:
Soybean rust causes premature defoliation, early maturity, and lower seed weight. Fewer pods and seeds may be produced when infection is early or severe (Sinclair, 1982).
-
Treatment Information:
-
Cultural practices:
Some cultural practices have been recommended that minimize the impact of rust. The recommendations differed, but were based upon avoiding the conditions that promote disease development or were practices that optimized overall yields (Website 58).
The results indicate that later maturing cultivars are more likely to produce relative stable and higher yields with small harvest losses in an environment where rust occurs in only some years and at different stages of the season, and where moisture stress periods vary within and among seasons (Desborough, 1984).
The following must be used effectively against soybean rust in certain situations: modification of planting date, utilization of early maturing varieties, utilization of varieties with a short pod-filling stage, control of wild weed hosts, and selection of planting sites. In Queensland, it is recommended that, wherever possible, soybeans be grown well away from pastures containing glycine (Neonotonia wightii), a common pasture legume known to be a host of P. pachyrhizi (Bromfield, 1984).
-
Fungicides:
Fungicides have been used effectively in other countries to mitigate the impacts on soybean production (Website 59).
In anticipation of the fungicides needed to fight soybean rust, the Environmental Protection Agency has pushed through paperwork that would speed up the process of registering chemicals currently not labeled in the U.S. for soybeans, but that are registered in other countries for the treatment of soybean rust (Website 51).
-
Applicable:
Fungicide applications will be the primary tool used to control soybean rust. There are some questions to be addressed. The first will be which fungicides, among those that could be or are already registered for use in the US, are effective in controlling soybean rust (Website 60).
The second question to be addressed involves improving the methods of fungicide application (Website 60)
Widespread fungicide applications on soybean fields in the United States are not deemed cost effective. As a result, this control option would be useful only for eradication on small acreages (Frederick et al., 2002).
May 2, 2005 INDIANAPOLIS --The states of Georgia, Wisconsin and West Virginia have received Section 18 emergency exemptions for EC, Laredo EW and fungicides to be used for the control of soybean rust. Laredo EC and Laredo EW contain the active ingredient myclobutanil, while PropiMax contains the active ingredient propiconazole. Both fungicides provide preventive and curative control of soybean rust. Laredo EC and Laredo EW contain the active ingredient myclobutanil, while PropiMax contains the active ingredient propiconazole. Both fungicides provide preventive and curative control of soybean rust (Website 70).
AgraQuest Inc. has announced the launch of Ballad biofungicide for control of Asian soybean rust on organic soybeans and other legumes. Ballad is based on a naturally occurring patented strain of the bacterial species Bacillus pumilus, which produces natural pesticidal compounds. These compounds, present in every container of Ballad, destroy the cell walls of the rust pathogen. AgraQuest recommends protecting the crop from the flowering stage to pod fill. Because of the biodegradability of the product, intervals between sprays should be no more than 14 days (Website 69).
To counter the threat from ASBR, many U.S. states have authorised a number of new fungicide products for use in soybeans under Section 18 of the EPA emergency quarantine exemptions for pesticide registration. The chemical group of these fungicides are: TRIAZOLES (Quadris, Domark, Folicur, Laredo, Bumper, Propimax, and Tilt), and COMBINATIONS (Quilt, Headline SBR (only in Minnessota), and Stratego). Section 3 products already have full clearance for use. The chemical group of these fungicides are: CHLOROTHALONIL (Bravo and Echo); SROBIRULINS (Headline, Pristine (section 3 pending), and Quadris). Soybean rust fungicides are classified as protectant or curative according to their mode of action. Chlorothalonil products are used entirely as protectants and therefore require good coverage of all plant surfaces prior to infection, including upper and lower leaf surfaces. As such, they are generally used early season, however, as the crop grows and becomes established, it becomes more difficult to achieve complete coverage on all plant surfaces with sprays whether applied from the ground or air. Strobilurins are systemic in their activity being able to penetrate within the plant and therefore help protect against initial infection and subsequent penetration of the fungus within the plant surface. Again, good coverage is required, but the systemic nature of strobilurins means under leaf coverage is less important as the chemical can pass through the leaf. Similarly, the triazoles are systemic in their activity and also are absorbed into the plant generally more readily than the strobilurins. Movement of fungicides within plants is always upward and outward as they move through the water transport system (xylem), so often multiple applications will be required during the season to protect new growth. Triazoles are both preventative and curative in their action being able to arrest the development of the disease, if the soybean is already in the early stages of infection (Website 70).
-
Success Rate:
Most soybeans are not treated with foliar fungicides, so there is little known about application methods or the effect of fungicides on the crop. Current fungicide application methods may not be sufficient to control the pathogen. Early in the season the pathogen is found on the lower leaves of the plant where lesion numbers increase and inoculum builds up. As the plants start to flower this build up of inoculum increases and the infection moves up the plant as the lower leaves die and drop off. To get maximum yields, the crop needs protection from flowering through pod fill. During this period the plant canopy is very dense, and can be an effective barrier to penetration from fungicides applied over the top of the canopy. Most of the available fungicides are not systemic, or if systemic will not move down in the plant. Application methods need to be developed that will deliver enough fungicide, uniformly, into the lower portion of the soybean canopy after flowering. The economics of fungicide application, timing, number of sprays, and which fungicides to use for the most cost effective control all need to be addressed by additional research (Website 58).
Good penetration and coverage of sprays are important (even with systemic fungicides), so selection of the appropriate drop size and spray volume is important, but timing of sprays is everything (Website 70).
Current U.S. label recommendations for many soybean fungicides advise application volumes typically around five gals/acre for aerial application and 10 gals/acre for ground rigs. The dose rates of fungicide applied are the same for both only the water volume is reduced for aerial application. These volume rates are largely based on the desire to obtain penetration of the crop canopy, yet maintain coverage over all plant surfaces using typically fine to medium-sized sprays with standard pressure nozzles. Swath widths should be carefully chosen to avoid any missed application, as unsprayed areas will be an important source of infection. A minimum flying height of 10-12 feet is usually recommended to ensure good fungicide distribution. Rotary nozzles offer the benefit of improved control of droplet size ensuring good coverage and penetration of the soybean plant at lower spray volumes to improve operator productivity. Figure 1 illustrates the productivity of a fixed-wing aircraft at different volume rates demonstrating a 40% increase in acres sprayed by reducing rates from five to two gals/acre. As results in Brazil have demonstrated, lower spray volumes of one-three gals/acre give excellent results. In time, lower volume rates of say two-three gals/acre for aerial application may become the norm as industry experience in controlling this disease improves. From experience in Brazil, some U.S. fungicide suppliers already advise growers to use an oil adjuvant or surfactant to enhance uptake of the fungicide. Selecting the most appropriate fungicide mix, adjuvant, drop size and volume rate to improve productivity, and hence timing of application, may well offer the best solution to improved disease control (Website 70).
-
Prevention:
-
Tolerant:
-
Ontology: UMLS C0231197
-
Description:
Tolerance is the strategy to select genotypes with high yield potential that have less yield loss from soybean rust. Screening for tolerance to soybean rust was started at the Asian Vegetable Research and Development Center, where yields from paired plots, with and without the fungicide Dithane M-45 applied every 2 weeks, were compared to determine losses due to rust. High yielding cultivars with less yield loss under severe rust conditions were considered to be tolerant. Rust development rates and estimates of rust severity on foliage were not correlated with yield loss in tolerant materials. Using fungicide protected plots as yield checks, tolerant lines from breeding populations were identified as early as the F5 generation without having to take detailed notes on rust severity (Website 58).
-
Disease resistance:
-
Ontology: UMLSC1136180
-
Description:
Currently there is no resistance to soybean rust in any of the U.S. commercial soybean cultivars (Frederick et al., 2002)
Specific resistance to P. pachyrhizi is known, and four single dominant genes have been identified as Rpp1, Rpp2, Rpp3, and Rpp4. These four genes condition resistance to a limited set of rust isolates (Website 58).
Single gene resistance has not been durable, and the usefulness of the single genes was lost soon after the sources were identified (Kochman, 1977).
Since the report of soybean rust in Hawaii in 1994, the USDA-ARS has renewed its support for soybean rust research in the U.S. The Foreign Disease-Weed Science Research Unit (FDWSRU) at Ft. Detrick is the focal point of this research with additional collaborators in the USDA and states universities with additional support from the United Soybean Board. Part of the research focus has been to identify resistant germplasm. Other research priorities include genome sequencing projects of both soybean rust pathogens, P. pachyrhizi and P. meibomiae, in collaboration with the DOE Joint Genome Institute, developing methods for molecular identification of rust isolates, and monitoring gene expression of both pathogen and host during susceptible and immune reactions. There are over 16,000 soybean accessions in the USDA Germplasm Collection located at the University of Illinois. These soybean accessions are being evaluated for resistance to P. pachyrhizi in the USDA-ARS FDWSRU Biosafety Level 3 Containment Greenhouses at Fort Detrick, MD, along with commercial and public cultivars grown in the U.S.. The germplasm evaluations are done on seedlings using a mixture of isolates from Africa, Asia and South America. None of the U.S. commercial cultivars evaluated were found to be resistant to the mixed inoculum, but some differences were observed in levels of susceptibility. Some cultivars were moderately susceptible when compared to other cultivars that were susceptible and super susceptible. From 3,600 soybean accessions screened to date, less than 100 have been identified as having some level of resistance. These soybean accessions will be further evaluated using individual isolates to detect race specific and/or partial resistance. They also will be planted in field trials in Brazil, Paraguay, China, Thailand, South Africa and Zimbabwe to be evaluated for adult plant resistance. Additionally, the 1,000 plus G. soja accessions will be screened along with verification of the perennial Glycine spp. previously reported as having resistance. As sources of resistance are identified, crosses will be made to incorporate this resistance into adapted backgrounds (Website 58).
-
Protection procedure ():
-
Ontology: UMLS:C1279755
-
Description:
USDA recognizes its responsibility to prevent the introduction of foreign plant pests and diseases with the potential for adversely impacting production agriculture and the environment. Therefore, USDA is working to delay the human assisted introduction of the disease through its safeguarding program. APHIS-Plant Protection and Quarantine (PPQ) will continue to support offshore information gathering, permitting and inspection activities as components of its exclusion and safeguarding activities, thereby reducing the risk of introducing ASBR through human assisted channels. An effective program to reduce the human assisted movement of the disease will help to provide additional time in preparing for the entry of the disease. USDA-APHIS-PPQ has legislative authority under the Plant Protection Act to control the importation of commodities that may serve as pathway for the introduction of foreign plant and animal pests and diseases. The agency administers this responsibility through the Department of Homeland Security, Customs and Border Patrol agricultural quarantine inspection program at the Nations international ports of entry and through PPQ permitting procedures. The Protection Plan will address the following human assisted movement issues: OFFSHORE PEST INFORMATION The collection, synthesis, and communication of information collected offshore will enhance PPQs strategy for addressing the entry and establishment of ASBR in the continental United States. This information will be critical in tracking new infestations or outbreaks of this pathogen offshore or detecting potential bioterrorist events and then correlating this information to entry pathways. Also, offshore information will be important to enhance detection, response, and recovery activities PATHWAY PEST RISK ASSESSMENT The assessment of risks associated with the introduction of ASBR on imported soybean seed, grain and meal is a critical component in identifying and recommending pathogen pathway entry standards. The assessment will consider biological, technical, and industry standards, available information to classify risk of introduction, and potential mitigative measures. PPQs Center for Plant Health, Science, and Technology will prepare an assessment of risks associated with the introduction of ASBR on imported soybean seed, grain and meal from areas with the disease. COMMODITY ENTRY STANDARDS A technical analysis of the pathway assessment and the development of least restrictive mitigation measures will establish the framework for entry standards or requirements for soybean seed, grain and meal from areas with soybean rust. PPQ will: prohibit or require appropriate treatment of host material moving into the United States that may serve as a pathway for introduction; modify commodity entry standards as appropriate based on the pathway assessment and communicate standards to DHS; and collaborate with foreign cooperators in the offshore mitigation of the disease to reduce the risk of entry into the continental United States (Website 58).
-
Pest alert:
-
Ontology: UMLS C0599519
-
Description:
Soybean rust is a serious disease causing crop losses in other parts of the world. It has not yet been detected in the continental United States, but the fact that it is principally spread by wind-borne spores indicates it may eventually reach major soybean growing areas in this country. The purpose of this pest alert is to give background and identification information on soybean rust. Included in this alert is information on how the fungus might be first detected on soybean plants, other soybean rust hosts that occur in the United States, the characteristics of soybean rust for proper identification, and procedures for identification verification (Website 55).
In the upper Southeast, as in other parts of the country, Extension experts, agents, consultants, state departments of agriculture, and USDA are preparing for an invasion. In the lower Southeast, the Florida Department of Agriculture has set out sentinel crops to have an early warning. Meteorologists are also involved in predicting when the disease might hit soybean fields in the United States. Extension county agents, consultants and state department of agriculture agronomists will most likely encounter the disease first. In the upper Southeast, training at the county level is scheduled to help those workers distinguish rust from soybean rust and outline the protocol for determining if it is soybean rust. Virginia is scouting soybeans every two weeks. One of the main reasons for scouting is to calm some of the fears that are out there, says David Holshouser, Virginia Tech Extension soybean specialist (Website 51).
-
Survey planning:
-
Ontology: UMLS C0516142
-
Description:
-
Remote sensing:
-
Ontology: UMLS C0599519
-
Description:
ARS is funding a project with U.S. and international collaborators to develop remote sensing techniques for monitoring the spread of soybean rust within fields (Website 58).
-
Model System:
No model system information is currently available here.
IV. Labwork Information
A. Biosafety Information:
-
General biosafety information
(Website 58):
-
Biosafety Level: 3There are over 16,000 soybean accessions in the USDA Germplasm Collection located at the University of Illinois. These soybean accessions are being evaluated for resistance to P. pachyrhizi in the USDA-ARS FDWSRU Biosafety Level 3 Containment Greenhouses at Fort Detrick, MD, along with commercial and public cultivars grown in the U.S (Website 58).
-
Precautions:
-
If soybean rust is suspected to be present on soybean or other hosts in the continental U.S., samples are to be submitted to the plant disease diagnostic laboratory at state universities for identification (Website 60)
The soybean rust pathogen is on the U. S. Select Agent list produced by the U. S. Dept. of Homeland Security. This rust pathogen cannot be transported across state lines without the appropriate permit. Testing of suspect soybean rust material should be done within the state (Website 50).
If university or state departments of agriculture laboratories determine that a sample is Phakopsora spp. on soybean or another leguminous hosts, further identification to the species level will be necessary. There are no Phakopsora species on legume hosts recorded in the continental Unites States. A new Phakopsora record, because of its potential economic importance, will require verification by the PPQ national mycologist in Beltsville, Maryland. Verification will utilize the validated PCR-based molecular test. Diagnostic laboratories should contact Dr. Mary Palm at (301) 504-5327 or Dr. John McKemy at (301) 504-5280 if Phakopsora spp. on a legume host is found (Website 59).
The preparation and distribution of information regarding survey and identification procedures is the foundation for the early detection of ASBR. The early detection and diagnosis of the pathogen relies on producers, crop consultant, or handler referral of symptomatic material. It is absolutely essential that appropriate program training and detection aides showing symptoms and instructions for referring specimens be provided to the public frequenting soybean production and other host's areas (Website 59).
B. Culturing Information:
No culturing information is currently available here.
C. Diagnostic Tests
:
-
Organism Detection Tests:
-
Light microscopy (Website 59):
-
Ontology:
UMLS:C0430389
-
Description:
Soybean symptoms can be distinguished by two microscopic characteristics. Uredial pustules open through a round ostiole and white clumps of urediniospores can generally be observed on top of the uredial cone sometimes emerging in columns. Uredinospores can be identify by mounting them on a microscope slide and examined under a compound microscope (Website 59).
-
False Positive:
Early symptoms of soybean rust are easily confused with bacterial pustule (Xanthomonas campestris pv. phaseoli), or bacterial blight (Pseudomonas glycinea), and brown spot (Septoria glycines).The diseases also occcur often on the underside of soybean leaves causing a raised light brown blister within a lesion. A hand lens is usually used to distinguished these disease symptoms from ASBR, but early the stages of disease are difficult to distinguished if no spores, conidia or bacteria are evident (Website 59).
Also bacterial lesions can be differentiated by the cracks that usually appear in host tissue with a bacterial pustule lesion (Hartman et al., 1996).
-
Isoenzymes:
-
Ontology:
UMLS:C002217
-
Time to Perform:
unknown
-
Description:
Isozyme analysis supported the identification of P. pachyrhizi and P. meibomiae as separate species. When multilocus banding patterns were compared among Asian and New World rust isolates, no differences were found among the Asian isolates, nor among the New World isolates. However, the two groups differed greatly from one another, with the maximum coefficient of similarity estimated at 0.07 (7% of alleles in common) for the 14 loci examined (Bonde et al., 1988).
They reported that the lack of isoenzymes variation within P. pachyrhizi might be due to the lack of an effective sexual cycle. (Bonde et al., 1988).
Although teliospores of the pathogen have been observed, germination may be rare or absent. (Bonde et al., 1988).
While isozymes represent an important research tool, they are generally not considered appropriate for use as a diagnostic test (Website 49).
-
Immunoassay Tests:
No immuno-assay tests available here.
-
Nucleic Acid Detection Tests:
:
-
PCR test (Frederick et al., 2002):
-
Ontology:
UMLS:C0032520
-
Time to Perform:
1-hour-to-1-day
-
Description:
Soybean rust occurs in Australia and many countries throughout Africa, Asia, and South America. The causal agents of soybean rust are two closely related fungi, Phakopsora pachyrhizi and P. meibomiae, which are differentiated based upon morphological characteristics of the telia. Determination of the nucleotide sequence of the internal transcribed spacer (ITS) region revealed greater than 99% nucleotide sequence similarity among isolates of either P. pachyrhizi or P. meibomiae, but only 80% sequence similarity between the two species. Utilizing differences within the ITS region, four sets of polymerase chain reaction (PCR) primers were designed specifically for P. pachyrhizi and two sets for P. meibomiae. Classical and real-time fluorescent PCR assays were developed to identify and differentiate between P. pachyrhizi and P. meibomiae. Identification of P. pachyrhizi from infected soybean leaves using the real-time PCR assay will allow for more rapid diagnoses (Frederick et al., 2002).
Because the nucleotide sequence comparisons of the ITS1 and ITS2 regions revealed significant divergence between the P. pachyrhizi and P. meibomiae isolates, sequence sites were selected for PCR primer design that utilize these differences. PCR primers Ppa1, Ppa2, Ppa3, and Ppa4 (for P. pachyrhizi) are designed specifically to P. pachyrhizi sequences, whereas the primers Pme1 and Pme2 (for P. meibomiae) are directed at P. meibomiae sequences. The primers Ppm1 and Ppm2 (for P. pachyrhizi and meibomiae) are aimed at the 5.8S rDNA region that is conserved between P. pachyrhizi and P. meibomiae. Four pairs of PCR primers were selected for specificity to P. pachyrhizi (Frederick et al., 2002).
-
Primers:
-
Ppa1, Ppa2
-
Forward:
TAAGATCTTTGGGCAATGGT
-
Reverse:
GCAACACTCAAAATCCAACAAT
-
Product
-
Ppa3, Ppa4
-
Pme1, Pme2
-
Ppm1, Ppm2
-
Ppm1, Ppa2
-
Ppm1, Ppa4
-
Ppm1, Pme2
-
False Positive:
()
-
False Negative:
()
-
Other Types of Diagnostic Tests:
No other tests available here.
V. References
A. Journal References:
Bonde et al., 1988:
Bonde MR,
Peterson GL,
Dowler WM A comparison of isozymes of Phakopsora pachyrhizin from the Eastern Hemisphere and teh New World .
Phytopathology.
1988;
78(11):
1491 -
1494.
Bromfield and Hartwig, 1980:
Bromfield KR,
Hartwig EE Resistance to Soybean Rust and Mode of Inheritance.
Crop Science.
1980;
20(2):
254 -
255.
Brown and Hovmoller, 2002:
Brown JKM,
Hovmoller MS. Aerial Dispersal of Pathogens on the Global and Continental Scales and Its Impact on Plant Disease.
Science.
2002;
297(5581):
537 -
541.
Desborough, 1984:
Desborough PJ Selection of cultivar and sowing date as a strategy for avoidance of rust (Phakopsora pachyrhizi Syd.) losses in coastal New South Wales .
Australian Journal Exp. Agric. Anim. Husb..
1984;
24:
995 -
999.
Frederick et al., 2002:
Frederick RD,
Snyder CL,
Peterson GL, Bonde MR Polymerase chain reaction assays for the detection and discrimination of the soybean rust pathogens Phakopsora pachyrhizi and P. meibomiae.
Phytopathology.
2002;
92(2):
217 -
227.
Hartman et al., 1992:
Hartman GL,
Wang TC,
Hymowitz T Sources of resistance to soybean rust in perennial Glycine species .
Plant Disease.
1992;
76(4):
396 -
399.
Kawuki et al. 2004:
Kawuki RS,
Takamuhabwa P, Adipala E Soybean rust severity, rate of rust development, and tolerance as influenced by maturity period and season.
Crop Protection.
2004;
23:
447 -
455.
Koch et al., 1983:
Koch E,
Ebrahim-Nesbat F,
Hoppe HH Light and Electron microscopic studies on the development of soybean rust (Phakopsora pachyrhizi Syd.) in susceptible soybean leaves
.
Phytopath. Z..
1983;
106(3):
302 -
320.
Marchetti et al., 1976:
Marcheti MA,
Melching JS,
Bromfield KR The effect of temperature and dew period on germination and infection of uredospores of Phakopsora pachyrhizi.
Phytopathology.
1976;
66:
461 -
463.
Melching et al., 1976:
Melching JS,
Dowler WM,
Koogle DL, Royer M. H. Effect of duration, frequency, and temperature of leaf wetness periods on soybean rust.
Plant Disease.
1989;
73(2):
117 -
122.
Ono et al., 1992:
Ono Y,
Buritica P, HennenJ.F. Delimitation of Phakopsora, Physopella and Cerotellium and their species on Leguminosae.
Mycological Research.
1992;
96(10):
825 -
850.
Pivonia and Yang, 2004:
Pivonia S,
Yang XB Assessment of the potential year-round establishment of soybean rust throughout the world .
Plant disease.
2004;
88(5):
523 -
529.
Saksirirat and Hoppe, 1991:
Saksirirat W,
Hoppe HH Teliospore Germination of Soybean Rust Fungus (Phakopsora pachyrhizi Syd.).
J. Phytopathology.
1991;
132:
339 -
342.
Seaver et al., 1926:
Seaver FJ,
Chardon CE Scientific survey of Puero Rico and the Virgin Islands.
Mycology.
1926;
3(1):
113 -
114.
Vakili et al., 1976:
Vakili NG,
Seaver FJ Phakopsora rust on soybean and other legumes in Puerto Rico .
Plant Dis. Reptr.
1976;
60:
995 -
999.
Yeh et al., 1976:
Yeh CC,
Tschanz AT,
Sinclair JB Induced teliospores formation by Phakopsora pachyrhizi on soybeans and other hosts .
Phytopathology.
1981;
71(10):
1111 -
1112.
B. Book References:
Agrios, 1997:
Agrios GN 371 -
375.
In: Agrios GN Plant Pathology1997.
Academic Press,
San Diego, California.
Alexopoulos et al., 1996:
Alexopoulos CJ,
Mims CW,
Blackwel MI -
.
In: Alexopoulos CJ Introductory Mycology1996.
John Wiley and Sons, Inc,
New York.
Bromfield, 1984:
Bromfield KR Disease management.
43 -
49.
In: Bromfield Kenneth Soybean Rust. Monograph No 111984.
The American Phytopathological Society,
St. Paul, Minnesota.
Hartman et al., 1996:
Hartman GL,
Sinclair JB,
Rupe JC Rust.
25 -
26.
In: Hartman GL,
Sinclair JB,
Rupe JC Compendium of soybean diseases1999.
The American Phytopathological Society,
St. Paul, Minnesota.
Ilag, 1977:
Ilag LL 16 -
17.
In: Ford RE,
Sinclair JB Rust of soybean--The Problem and Research Needs (Workshop held in Manilla, the Philippines)1977.
INTSOY Series Number 12,
University of Illinois at Urbana-Champaign.
Kochman, 1977:
Kochman JK 44 -
48.
In: Ford RE,
Sinclair JB Rust of soybean--The Problem and Research Needs (Workshop leld in Manilla, the Philippines1977.
INTSOY Series Number 12,
University of Illinois at Urbana-Champaign.
Sinclair, 1982:
Sinclair JB Rust.
24 -
26.
In: Sinclair JB Compendium of soybean diseases1982.
The American Phytopathological Society,
St. Paul, Minnesota.
Tschanz and Shanmugasundram, 1984:
Tschanz AT,
Shanmugasundram S 562 -
567.
In: Shibles R World Soybean Research Conference lll1985.
Westview Press,
5500 Central Avenue, Boulder, Colorado.
C. Website References:
Website 1:
Phakopsora pachyrhizi [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=170000&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 2:
Soybean rust [
http://www.aphis.usda.gov/ppq/ep/soybean_rust
].
Website 3:
Calopogonium mucunoides [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=132433&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 4:
Cajanus cajan [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=3821&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 5:
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi
Website 6:
Crotalaria sp. [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=3828&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 7:
Delonix regia [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=72433
].
Website 8:
Glycine canescens [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=48924
].
Website 9:
Glycine clandestina [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=45687
].
Website 10:
Glycine falcata [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=45690
].
Website 11:
Glycine max [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3847
].
Website 12:
Glycine tabacina [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=44016
].
Website 13:
Lablab purpureus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=35936
].
Website 14:
Lupinus angustifolius [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=3871&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 15:
Macroptilium atropurpureum [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=90550&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 16:
Macrotyloma axillare [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=3876&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 17:
Medicago arborea [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=66807
].
Website 18:
Melilotus officinalis [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=47083&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 19:
Kennedia rubicunda [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=76709&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 20:
Neonotonia wightii [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=103823&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 21:
Pachyrhizus erosus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=109171
].
Website 22:
Phaseolus lunatus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3884
].
Website 23:
Phaseolus vulgaris [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3885
].
Website 24:
Pueraria montana var. lobata [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=3893&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 25:
Pueraria phaseoloides [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=109224&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 26:
Rhynchosia minima [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=132461&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 27:
Sesbania vesicaria [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=54756&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 28:
Trifolium repens [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=3899&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 29:
Trifolium incarnatum [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=60916&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 30:
Trigonella foenum-graecum [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=78534&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 31:
Vicia faba [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=3906&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 32:
Teramnus uncinatus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=109223
].
Website 33:
Vigna mungo [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3915
].
Website 34:
Vigna unguiculata [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=3917&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 35:
Vigna luteola [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=87075
].
Website 36:
Sesbania [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=3894&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 37:
Desmodium podocarpum subsp. oxyphyllum [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=53935&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 38:
Erythrina senegalensis [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=157649&lvl=3&lin=f&keep=1&srchmode=1&unlock>
].
Website 39:
Erythrina variegata [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=3845&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 40:
Lotus purshianus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=100151
].
Website 41:
Lupinus albus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=3870&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 42:
Lupinus luteus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3873
].
Website 43:
NPAG data:: Phakopsora pachyrhizi: Australasian soybean rust [
http://www.aphis.usda.gov/ppq/ep/soybean_rust/UreMelPp502.pdf
].
Website 44:
Soybean Rust On The Move
[
http://www.cornandsoybeandigest.com/mag/soybean_soybean_rust_move_2/
].
Website 45:
Vicia dasycarpa [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=3904&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 46:
Dr. Breat Cooper [
http://bldg6.arsusda.gov/~pooley/soy/cooper.html
].
Website 49:
Status of Scientific Evidence on Risks Associated with the introduction into the Continental United States of Phakopsora pachyrhizi With Impported Soybean Grain, Seed and Meal [
http://www.aphis.usda.gov/ppq/ep/soybean_rust/sbr_riskevidoc2_23_04.pdf
].
Website 50:
Illinois soybean rust program [
http://www.agr.state.il.us/regulation/soybeanrustprogram.pdf/
].
Website 51:
Soybean rust threat taken seriously [
http://southeastfarmpress.com/mag/farming_soybean_rust_threat/
].
Website 52:
Early stages of soybean rust [
http://www.aphis.usda.gov/ppq/ep/soybean_rust/detection.html
].
Website 53:
Life cycle of soybean rust [
http://www.cai.iastate.edu/SoybeanRust/Lifecycle.swf
].
Website 54:
Soybean rust lesions type and early symptoms of soybean rust and bacterial pustule [
http://www.aphis.usda.gov/ppq/ep/soybean_rust/illustration.html
].
Website 55:
Pest Alert:Soybean Rust [
http://www.aphis.usda.gov/ppq/ep/soybean_rust/
].
Website 56:
Diagnostic Characters for Soybean Rust Identification
[
http://www.aphis.usda.gov/ppq/ep/soybean_rust/detection2.html
].
Website 57:
Survey planning for soybean rust based on aerobiological and climatological factors [
http://www.aphis.usda.gov/ppq/ep/soybean_rust/rsampling5.pps
].
Website 58:
Soybean Rust: Is the U.S. Soybean Crop At Risk? [
http://www.apsnet.org/online/feature/rust/
].
Website 59:
Strategic plan to minimize the impact of the introduction and establishment of soybean rust on soybean production in the United States [
http://www.aphis.usda.gov/ppq/ep/soybean_rust/sbrplan12-03.pdfl
].
Website 60:
Soybean Rust Symptoms [
http://www.aphis.usda.gov/ppq/ep/soybean_rust/detection5.html
].
Website 61:
Soybean Rust Update, November 12, 2004 [
http://www.aphis.usda.gov/lpa/issues/sbr/updates/sbr_update11-12.html
].
Website 62:
Soybean Rust Update, December 1, 2004 [
http://www.aphis.usda.gov/lpa/issues/sbr/updates/sbr_update12-1.html
].
Website 63:
Embryophyta [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=3193&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 65:
Crop Warch [
http://cropwatch.unl.edu/photos/slides/berust2.jpg
].
Website 66:
Basic Information About Soybean Rust [
http://www.ag.uiuc.edu/cespubs/pest/articles/200213k.html
].
Website 67:
Basic Information About Soybean Rust [
http://www.aphis.usda.gov/ppq/ep/soybean_rust/coordfram041405.pdf/URL
].
Website 68:
USDA says officially: Yes, it was rust on GA volunteer soybeans [
http://www.stopsoybeanrust.com/mc_home.asp
].
Website 69:
First biofungicide registered for soybean rust on organic beans [
http://www.stopsoybeanrust.com/viewStory.asp?StoryID=290
].
Website 70:
GA, WI, WV get Sec. 18s for two Dow soybean rust fungicides: Laredo and PropiMax
[
http://www.stopsoybeanrust.com/viewStory.asp?StoryID=290
].
Website 70:
Soybean rust control with Micronair rotary atomizers
[
http://www.agairupdate.com/aau/articles/2005/May2005.html
].
D. Thesis References:
No thesis or dissertation references used.
VI. Curation Information
-
Curators:
Graciela Santopietro
-
Date: 3/1/2005
-
Version: 1.0
-
Contact information:
- Email: pathinfo@vbi.vt.edu