I. Organism Information

A. Taxonomy Information

1. Species:
   1. Norwalk virus (NCBI Taxonomy):
      1. GenBank Taxonomy No.: 11983
      2. Description: The family Caliciviridae is composed of small (27 to 40 nm), nonenveloped, icosahedral viruses that possess a linear, positive-sense, single-stranded RNA (ssRNA) genome. The four genera of the family are Norovirus, Sapovirus, Vesivirus, and Lagovirus. The major medical pathogens in the family are the noroviruses and sapoviruses, which cause acute gastroenteritis. Important veterinary pathogens include vesiviruses such as feline calicivirus (FCV), which causes a respiratory disease in cats, and lagoviruses such as rabbit hemorrhagic disease virus (RHDV), which causes an often fatal hemorrhagic disease in rabbits (Green et al., 2007). Noroviruses are the major cause of nonbacterial epidemic gastroenteritis, a disease that usually occurs in family or community-wide outbreaks. Noroviruses and sapoviruses have been associated with gastroenteritis in infants and young children, but the predominant etiologic agent of severe diarrheal illness in this young age group is the 70-nm rotavirus in the family Reoviridae (Green et al., 2007) Norovirus (NV) (formerly called Norwalk-like virus) is a member of the family Caliciviridae and causes acute nonbacterial gastroenteritis in humans worldwide. NV is highly infectious and spreads by ingestion of contaminated food, such as oysters and water. NV also spreads by person-to-person transmission through the fecal-oral route in semiclosed communities, such as hospitals, schools, nursing homes, and cruise ships. These characteristics make NV a major public health concern (Kageyama et al., 2003). The prototype strain of NoVs is the Norwalk virus (Hu/NV/Norwalk virus/1968/US), which was first discovered from an outbreak of gastroenteritis in an elementary school in Norwalk, Ohio, U.S.A. in 1968 (Hansman et al., 2004). Within the last decade molecular analyses of the genome of Norwalk-like viruses (NLVs) have confirmed that this important group of infectious agents belongs to the Caliciviridae family. NLVs have a positive-sense, single-stranded RNA genome of approximately 7700 nucleotides excluding the polyadenylated tail (Clark and Lambden, 2002).
      3. Variant(s):
         • Camberwell virus (NCBI Taxonomy):
           • GenBank Taxonomy No.: 94433
           • Parent: Norwalk virus
           • Description: In January 1994 an outbreak of vomiting and diarrhoea was reported in a hostel for the aged in Camberwell. A total of 30 residents and 8 staff were affected by the illness. The duration of the illness was 24-36 hr with the major symptoms of vomiting and diarrhoea occurring during the first 6 hr. The outbreak lasted for 10 days. The virus isolate is designated Camberwell-101922/94/AUS following the suggested convention of Wang et al (Cauchi et al., 1996).
         • Chiba virus (NCBI Taxonomy):
           • GenBank Taxonomy No.: 99565
           • Parent: Norwalk virus
           • Description: The Chiba virus (Hu/NLV/Chiba407/1987/JP) is one of the NLVs that was isolated in Chiba Prefecture, Japan (Someya et al., 2002).
         • Hawaii calicivirus (NCBI Taxonomy):
           • GenBank Taxonomy No.: 33750
           • Parent: Norwalk virus
           • Description: The NV-like human caliciviruses are comprised of at least four distinct serotypes represented by NV, Hawaii virus (HV), Snow Mountain virus (SMV), and Taunton virus, which have been defined by immune electron microscopy (IEM). HV was recovered from a family outbreak of gastroenteritis. Cross-challenge studies in adult volunteers, with NV and HV, as well as serologic studies by IEM, have established that these two viruses are antigenically distinct (Green et al., 1997). The Hawaii virus was first identified in 1977 by IEM as a Norwalk-like (27-nm) virus in the stool of a volunteer who was challenged with a stool suspension derived from a 1971 family outbreak of gastroenteritis. Cross-challenge studies in human volunteers supported the serologic distinction between NV and HV in that prior infection with NV did not protect volunteers from illness after subsequent challenge with HV but did induce short-term resistance to infection after rechallenge with NV (Lew et al., 1994).
         • Maryland calicivirus 1 (NCBI Taxonomy):
           • GenBank Taxonomy No.: 33751
           • Parent: Norwalk virus
           • Description: Additional specimens from naturally occurring outbreaks of gastroenteritis included stools MD6 and MD1, which were both Norwalk virus positive by ELISA, obtained from 2 elderly residents who became ill during separate outbreaks of gastroenteritis that occurred in different Maryland nursing homes in December 1987 or January 1988 (Lew et al., 1994). The MD145-12 strain (Hu/NLV/GII/MD145-12/1987/US) was described in an epidemiological survey of gastroenteritis outbreaks occurring in Maryland nursing homes during the winter of 1987-88. Sequence analysis of the MD145-12 genome showed that it was closely related to Camberwell virus and belonged to cluster GII/4 (Belliot et al., 2003).
         • Norovirus genogroup 1 isolates (NCBI Taxonomy):
           • GenBank Taxonomy No.: 235544
           • Parent: Norwalk virus
           • Description: NoVs have been divided into five genogroups, among which only genogroup I (GI) and GII are known to infect humans. A recent study indicated that NoV GI and GII strains consist of at least 14 and 17 genotypes, respectively (Hansman et al., 2004). It soon became apparent that Norwalk virus was representative of a large, genetically and antigenically diverse group of viruses associated with epidemic gastroenteritis. These "Norwalk-like viruses" segregated into two major phylogenetic groups that were designated genogroups I (GI) and II (GII), with Norwalk virus belonging to GI and the Hawaii and Snow Mountain viruses belonging to GII (Green et al., 2001). NLVs are now classified into two genogroups, GGI and GGII. Each genogroup comprises a range of genetically and antigenically diverse strains (Vinje et al., 2000).
         • Norovirus genogroup 2 (NCBI Taxonomy):
           • GenBank Taxonomy No.: 122929
           • Parent: Norwalk virus
           • Description: NoVs have been divided into five genogroups, among which only genogroup I (GI) and GII are known to infect humans. A recent study indicated that NoV GI and GII strains consist of at least 14 and 17 genotypes, respectively (Hansman et al., 2004). It soon became apparent that Norwalk virus was representative of a large, genetically and antigenically diverse group of viruses associated with epidemic gastroenteritis. These "Norwalk-like viruses" segregated into two major phylogenetic groups that were designated genogroups I (GI) and II (GII), with Norwalk virus belonging to GI and the Hawaii and Snow Mountain viruses belonging to GII (Green et al., 2001). NLVs are now classified into two genogroups, GGI and GGII. Each genogroup comprises a range of genetically and antigenically diverse strains (Vinje et al., 2000).
         • Norovirus genogroup 4 (NCBI Taxonomy):
           • GenBank Taxonomy No.: 262897
           • Parent: Norwalk virus
           • Description: A new genogroup has been proposed, GGIV, which contains members of the Alphatron genetic cluster (Lindell et al., 2005). On the basis of sequence analysis of the entire capsid gene, we have assigned 2 strains into genogroup IV (GIV) because of their relationship to other existing GI, GII, and GIII strains and using the criteria described by Ando et al (Fankhauser et al., 2002).
         • Norovirus isolates (NCBI Taxonomy):
           • GenBank Taxonomy No.: 150080
           • Parent: Norwalk virus
           • Description: The confusing early names of these viruses, which were determined on the basis of the locations of their discovery (e.g., Norwalk, Hawaii) or their appearance by EM (e.g., SRSV, classic caliciviruses) have been clarified recently. The names are now based on identification of the genetic sequences of the viruses and determination of their genomic organization. All belong to the family Caliciviridae, and they fall into 2 provisionally named genera - Norwalk-like viruses" (NLV) and Sapporo-like viruses" (SLV). Consequently, early papers referring to the NV, the Norwalk family of viruses, or NLVs, should generally be viewed as relating to human caliciviruses of the genus NLV (Glass et al., 2000).
         • Norwalk-like virus (NCBI Taxonomy):
           • GenBank Taxonomy No.: 95340
           • Parent: Norwalk virus
           • Description: The confusing early names of these viruses, which were determined on the basis of the locations of their discover (e.g., Norwalk, Hawaii) or their appearance by EM (e.g., SRSV, classic caliciviruses) have been clarified recently. The names are now based on identification of the genetic sequences of the viruses and determination of their genomic organization. All belong to the family Caliciviridae,a nd they fall into 2 provisionally named genera - "Norwalk-like viruses" (NLV) and "Sapporo-like viruses" (SLV). Consequently, early papers referring to the NV, the Norwalk family of viruses, or NLVs, should generally be viewed as relating to human caliciviruses of the genus NLV (Glass et al., 2000).
         • Small round structured virus (NCBI Taxonomy):
           • GenBank Taxonomy No.: 37141
           • Parent: Norwalk virus
           • Description: Small round-structured viruses (SRSVs) is the name commonly applied to a group of viruses within the family Caliciviridae that are associated with gastroenteritis in humans Although the illness is usually mild and self-limiting, the virus is highly infectious, and a major cause of morbidity. On some occasions, infection may also be associated with mortality. The SRSVs can be distinguished by electron microscopy from classical human caliciviruses (ClHuCVs) which have typical cup-shaped depressions on their surface. Infection by ClHuCVs also causes gastroenteritis, more commonly in children than adults (Wright et al., 1998).
   2. Human norovirus Saitama (NCBI Taxonomy):
      1. GenBank Taxonomy No.: 233890
      2. Description: Ten stool specimens, SzUG1, WUG1, U1, U3, U4, U16, U17, U18, U201, and U25 were collected from adults and children involved in outbreaks and sporadic cases of gastroenteritis that occurred between 1997 and 2001 in Saitama and Wakayama Prefecture Japan. The U3, U4, U16, and U17 were from different patients in the same outbreak in 1997. SzUG1, U1, U18, and U25, were collected from patients with sporadic cases of acute gastroenteritis associated with oysters between 1997 and 1999. U201 was from a child with acute gastroenteritis in a 1998 outbreak at an elementary school (Katayama et al., 2002). (Katayama et al., 2002)
   3. Maryland calicivirus 6 (NCBI Taxonomy):
      1. GenBank Taxonomy No.: 33752
      2. Description: Additional specimens from naturally occurring outbreaks of gastroenteritis included stools MD6 and MD1, which were both Norwalk virus positive by ELISA, obtained from 2 elderly residents who became ill during separate outbreaks of gastroenteritis that occurred in different Maryland nursing homes in December 1987 or January 1988 (Lew et al., 1994).
   4. Minireovirus (NCBI Taxonomy):
      1. GenBank Taxonomy No.: 194422
      2. Description: In 1977, 30- to 32-nm virus-like particles, named minireovirus because of their unique morphologic appearance, were detected by electron microscopy in the stools of infants and young children with gastroenteritis. Sequence analysis of approximately 2,800 consecutive bases derived from overlapping PCR clones of a recent minireovirus clinical isolate showed 52% nucleotide sequence identity with the Norwalk virus sequence and, in addition, demonstrated that the genomic organizations of these two viruses were similar. Our data show that minireovirus is a Norwalk-like virus and should now also be included in the Caliciviridae family (Lew et al., 1994).
   5. Bovine enteric calici-like virus (NCBI Taxonomy):
      1. GenBank Taxonomy No.: 88294
      2. Description: Viruses described as caliciviruses, small round structured viruses (SRSVs), Norwalk-like viruses, or calici-like viruses have been associated with enteric disease of human, cattle, and pigs. Much progress has been made with the human viruses in recent years by the application of genomic approaches, in contrast to the animal viruses. Initially, two morphological groups of human viruses were recognized based on the degree of surface structure that particles exhibited in the electron microscope, those with classical calicivirus morphology and those described as SRSVs. Viruses with SRSV morphology have been identified in only one other animal species, cattle, and by only a limited number of investigators, in the United Kingdom and Germany. The viruses were termed calici-like viruses or Newbury agents. They were shown to cause diarrhea in experimental calves and to be associated with outbreaks of calf diarrhea (Dastjerdi et al., 1999). The bovine viruses, Newbury agent 1 (NA1) and Newbury agent 2 (NA2) originated from two herds in the UK with a history of calf diarrhoea and were initially described as Newbury agent SRV-1 and SRV-2 (Dastjerdi et al., 2000). Characterized bovine noroviruses (BoNVs) comprise two genotypes (1 and 2) in Norovirus GIII, of which Bo/Jena/80/DE and Bo/Newbury-2/76/UK are the prototype viruses of GIII/1 and GIII/2, respectively (Han et al., 2004).
   6. Bovine enteric calicivirus (NCBI Taxonomy):
      1. GenBank Taxonomy No.: 206156
      2. Description: Bovine enteric caliciviruses (BECVs) are classified as a third genogroup (GIII) of noroviruses, distinct from GI and GII human noroviruses. They include Bo/NVL/Newbury-2/76/UK and Bo/NLV/Jena/80/DE (Han et al., 2004)

B. Lifecycle Information :

1. Virion :
   1. Size: 27-40 nm in diameter (Cauchi et al., 1996)
   2. Shape: The Norwalk-like viruses detected in feces are spherical in shape, 27-40 nm in diameter, and lack sharply defined edges (Cauchi et al., 1996). NV-like particles were identified on the basis of their size (with a diameter of approximately 27-40 nm), and typical morphology (spherical,no envelope,somewhat lace-like appearance). This is distinct from other small viruses (e.g.astroviruses), and non-NV caliciviruses such as SV which typically show a cup-like or 'star of David' morphology (Rabenau et al., 2003).
   3. Description: Analysis of Norwalk recombinant virus-like particles (rVLPs) by electron cryomicroscopy and computer image processing shows that the particles (38 nm in diameter by this technique) have a distinct architecture and exhibit T=3 icosahedral symmetry. The capsid contains 90 dimers of the capsid protein that form a shell from which 90 archlike capsomeres protrude at the local and strict twofold axes. These arches are arranged in such a way that there are large hollows at the icosahedral five- and three-fold positions, and these hollows are seen as cuplike structures on the surface of caliciviruses (calici is derived from the Latin word calyx, or cup) (Green et al., 2001).


2. Description: Norovirus infections result from ingestion of viral particles, which includes possible airborne transmission (Clark and Lambden, 2002). It is now apparent that NLVs circulate commonly in the community and there has been increasing evidence for their involvement in sporadic cases of gastroenteritis. A study of infectious intestinal diseases in the UK found NLV to be present in 6.5% of all cases of gastroenteritis that presented to a general practitioner in the UK, and in 7% of a community cohort, but they concluded that due to mild symptoms, poor sampling and insensitive screening methods National surveillance data underestimates the true burden of disease due to NLVs by up to 1,000 fold (Froggatt et al., 2004).

C. Genome Summary:

1. Genome of Norwalk virus
1. Chromosome:
   1. GenBank Accession Number: NC_001959
   2. Size: 7654 bp ss-RNA
   3. Gene Count: 3 genes
   4. Description: The genome encodes three open reading frames: ORF 1 is the largest (approximately 1700 amino acids) and is expressed as a polyprotein precursor that is cleaved by the viral 3C-like protease; ORF 2 encodes the viral capsid (550 amino acids); and ORF 3 encodes a small basic protein of unknown function. Comparative sequencing studies of human caliciviruses have revealed a second distinct group of viruses known as Sapporo-like viruses (SLVs). SLVs also have a single-stranded, positive-sense RNA genome of approximately 7400 nucleotides and the small 3' terminal ORF (NLV-ORF3 equivalent) is retained. Phylogenetic analyses of NLV and SLV genomic sequences have assigned these viruses to two different genera with each genus comprised of two distinct genogroups. The fundamental difference in genome organization between NLVs and SLVs is that the polyprotein and capsid ORFs are contiguous and fused in SLVs (Clark and Lambden, 2002).


2. Genome of Norwalk virus
1. Description: Norwalk virus strain Vietnam 026, complete genome (NCBI Genome).
2. Chromosome:
   1. GenBank Accession Number: AF504671
   2. Size: 7540 bp
   3. Gene Count: 3 genes
   4. Description:


3. Genome of Norovirus isolates
1. Description: Norovirus Hu/GI/Otofuke/1979/JP genomic RNA, complete genome (NCBI Genome).
2. Chromosome:
   1. GenBank Accession Number: AB187514
   2. Size: 7746 bp
   3. Gene Count: 3 genes
   4. Description: Taniguchi K and Wakuda M. Complete nucleotide sequence of genome of Otofuke virus, a member of Caliciviridae, associated with acute non-bacterial gastroenteritis. Unpublished (NCBI Genome).


4. Genome of Norovirus isolates
1. Description: Norovirus Hu/NLV/Dresden174/pUS-NorII/1997/GE, complete genome (NCBI Genome)
2. Chromosome:
   1. GenBank Accession Number: AY741811
   2. Size: 7555 bp ss-RNA
   3. Gene Count: 3 genes
   4. Description: Scheffler U and Rohayem, J. Generation and characterization of a norovirus full-length clone. Unpublished (NCBI Genome).


5. Genome of Norovirus isolates
1. Description: Norovirus Hu/NLV/Oxford/B2S16/2002/UK, complete genome (NCBI Genome).
2. Chromosome:
   1. GenBank Accession Number: AY587989
   2. Size: 7558 bp
   3. Gene Count: 3 genes
   4. Description:


6. Genome of Norovirus isolates
1. Description: Norovirus Hu/NLV/Oxford/B4S1/2002/UK, complete genome (NCBI Genome).
2. Chromosome:
   1. GenBank Accession Number: AY587988
   2. Size: 7558 bp
   3. Gene Count: 3 genes
   4. Description:


7. Genome of Norovirus isolates
1. Description: Norovirus Hu/NLV/Oxford/B4S7/2002/UK, complete genome (NCBI Genome).
2. Chromosome:
   1. GenBank Accession Number: AY587987
   2. Size: 7558 bp
   3. Gene Count: 3 genes
   4. Description:


8. Genome of Norovirus isolates
1. Description: Norovirus Hu/NLV/Oxford/B4S4/2002/UK, complete genome (NCBI Genome).
2. Chromosome:
   1. GenBank Accession Number: AY587986
   2. Size: 7558 bp
   3. Gene Count: 3 genes
   4. Description:


9. Genome of Norovirus isolates
1. Description: Norovirus Hu/NLV/Oxford/B4S6/2002/UK, complete genome (NCBI Genome)
2. Chromosome:
   1. GenBank Accession Number: AY587985
   2. Size: 7558 bp
   3. Gene Count: 3 genes
   4. Description:


10. Genome of Norovirus isolates
1. Description: Norovirus Hu/NLV/Oxford/B4S5/2002/UK, complete genome (NCBI Genome)
2. Chromosome:
   1. GenBank Accession Number: AY587984
   2. Size: 7558 bp
   3. Gene Count: 3 genes
   4. Description:


11. Genome of Norovirus isolates
1. Description: Norovirus Hu/NLV/Oxford/B4S2/2002/UK, complete genome (NCBI Genome)
2. Chromosome:
   1. GenBank Accession Number: AY587983
   2. Size: 7558 bp
   3. Gene Count: 3 genes
   4. Description:


12. Genome of Norovirus isolates
1. Description: Human calicivirus Hu/NLV/Oxford/B5S22/2003/UK, complete genome (NCBI Genome)
2. Chromosome:
   1. GenBank Accession Number: AY581254
   2. Size: 7558 bp
   3. Gene Count: 3 genes
   4. Description:


13. Genome of Norovirus isolates
1. Description: Human calicivirus NLV/GII/Langen1061/2002/DE, complete genome (NCBI Genome)
2. Chromosome:
   1. GenBank Accession Number: AY485642
   2. Size: 7558 bp
   3. Gene Count: 3 genes
   4. Description: Hoehne M, Roeske H and Schreier E. Complete nucleotide sequence of a human Calicivirus predominant in 2002. Unpublished (NCBI Genome).


14. Genome of Norovirus genogroup 2
1. Description: Lordsdale virus complete genome (NCBI Genome).
2. Chromosome:
   1. GenBank Accession Number: X86557
   2. Size: 7555 bp
   3. Gene Count: 3 genes
   4. Description: The large ORF in the 5' half of the genome (5100 nt) is shorter than the group I SRSV ORF1 (5367 nt), but has the characteristic 2C helicase, 3C protease and 3D RNA polymerase enzyme motifs. ORF2, encoding the structural protein is of a similar size to the group I viruses but the small 3'-terminal ORF is significantly larger in group II. A highly conserved sequence of 28 nt was identified at the start of Lordsdale virus ORF1 and repeated at the start of ORF2. These conserved motifs are typical of the animal caliciviruses (Dingle et al., 1995).


15. Genome of Norovirus genogroup 2
1. Description: Norovirus Hu/NLV/GII/Neustrelitz260/2000/DE from Germany, complete genome (NCBI Genome).
2. Chromosome:
   1. GenBank Accession Number: NC_001959
   2. Size: 7579 bp
   3. Gene Count: 3 genes
   4. Description: Petznick S, Hoehne M and Schreier E. Complete nucleotide sequence of a new genotype of a human calicivirus from Germany in 2000. Unpublished (NCBI Genome).


16. Genome of Norovirus genogroup 2
1. Description: Snow Mountain virus, complete genome (NCBI Genome)
2. Chromosome:
   1. GenBank Accession Number: AY134748
   2. Size: 7537 bp
   3. Gene Count: 3 genes
   4. Description: Pairwise sequence alignments showed SMV ORF1 is highly conserved with other genogroup II noroviruses, and most closely related to GII strains Melksham and Hawaii virus. In addition, comparative sequence analyses indicated that SMV is likely a recombinant norovirus. VP1/VP2 proteins self-assembled into virus-like particles (VLPs) when expressed in insect cells by a recombinant baculovirus. Characterization of one clone that expressed VP1, but failed to assemble into VLPs, identified histidine residue 91 as important for particle assembly under standard conditions of expression (Lochridge and Hardy, 2003).


17. Genome of Norovirus genogroup 2
1. Description: Human calicivirus strain Mc37, complete genome (NCBI Genome)
2. Chromosome:
   1. GenBank Accession Number: AY237415
   2. Size: 7541 bp
   3. Gene Count: 3 genes
   4. Description:


18. Genome of Norovirus genogroup 2
1. Description: Human calicivirus Hu/NLV/GII/MD145-12/1987/US, complete genome (NCBI Genome)
2. Chromosome:
   1. GenBank Accession Number: AY032605
   2. Size: 7556 bp ss-RNA
   3. Gene Count: 3 genes
   4. Description:


19. Genome of Norwalk-like virus
1. Description: Norwalk-like virus genomic RNA, complete genome, specimen_voucher:Gifu'96 (NCBI Genome).
2. Chromosome:
   1. GenBank Accession Number: AB045603
   2. Size: 7521 bp
   3. Gene Count: 3 genes
   4. Description:


20. Genome of Norwalk-like virus
1. Description: Norwalk-like virus genomic RNA, complete genome, strain:WUG1 (NCBI Genome)
2. Chromosome:
   1. GenBank Accession Number: AB081723
   2. Size: 7688 bp
   3. Gene Count: 3 genes
   4. Description:


21. Genome of Norwalk-like virus
1. Description: Norwalk-like virus genomic RNA, complete genome, isolate:Saitama U201 (NCBI Genome)
2. Chromosome:
   1. GenBank Accession Number: AB039782
   2. Size: 7541 bp
   3. Gene Count: 3 genes
   4. Description:


22. Genome of Norwalk-like virus
1. Description: Norwalk-like virus genomic RNA, complete genome, isolate:Saitama U18 (NCBI Genome)
2. Chromosome:
   1. GenBank Accession Number: AB039781
   2. Size: 7541 bp
   3. Gene Count: 3 genes
   4. Description:


23. Genome of Norwalk-like virus
1. Description: Norwalk-like virus genomic RNA, complete genome, isolate:Saitama U25 (NCBI Genome)
2. Chromosome:
   1. GenBank Accession Number: AB039780
   2. Size: 7524 bp
   3. Gene Count: 3 genes
   4. Description:


24. Genome of Norwalk-like virus
1. Description: Norwalk-like virus genomic RNA, complete genome, isolate:Saitama U17 (NCBI Genome)
2. Chromosome:
   1. GenBank Accession Number: AB039779
   2. Size: 7546 bp
   3. Gene Count: 3 genes
   4. Description:


25. Genome of Norwalk-like virus
1. Description: Norwalk-like virus genomic RNA, complete genome, isolate:Saitama U16 (NCBI Genome)
2. Chromosome:
   1. GenBank Accession Number: AB039778
   2. Size: 7546 bp
   3. Gene Count: 3 genes
   4. Description:


26. Genome of Norwalk-like virus
1. Description: Norwalk-like virus genomic RNA, complete genome, isolate:Saitama U4 (NCBI Genome)
2. Chromosome:
   1. GenBank Accession Number: AB039777
   2. Size: 7564 bp
   3. Gene Count: 3 genes
   4. Description:


27. Genome of Norwalk-like virus
1. Description: Norwalk-like virus genomic RNA, complete genome, isolate:Saitama U3 (NCBI Genome)
2. Chromosome:
   1. GenBank Accession Number: AB039776
   2. Size: 7564 bp
   3. Gene Count: 3 genes
   4. Description:


28. Genome of Norwalk-like virus
1. Description: Norwalk-like virus genomic RNA, complete genome, isolate:Saitama U1 (NCBI Genome)
2. Chromosome:
   1. GenBank Accession Number: AB039775
   2. Size: 7521 bp
   3. Gene Count: 3 genes
   4. Description:


29. Genome of Norwalk-like virus
1. Description: Norwalk-like virus genomic RNA, complete genome, isolate:SzUG1 (NCBI Genome)
2. Chromosome:
   1. GenBank Accession Number: AB039774
   2. Size: 7700 bp
   3. Gene Count: 3 genes
   4. Description:


30. Genome of Chiba virus
1. Description: Chiba virus genomic RNA, complete genome (NCBI Taxonomy)
2. Chromosome:
   1. GenBank Accession Number: AB042808
   2. Size: 7697 bp
   3. Gene Count: 3 genes
   4. Description: Comparison of the nucleotide and amino acid sequences with those of other members of the species Norwalk virus (NV) revealed that ChV belongs to genogroup I NV. The ChV genome contains three open reading frames (ORFs). A large 5'-terminal ORF (ORF1) encodes a polyprotein with 1785 amino acids that are likely processed into functional proteins, including RNA helicase, VPg, protease, and RNA-dependent RNA polymerase. ORF2 encodes the capsid protein with 544 amino acids, and a small 3'-terminal ORF (ORF3) encodes a basic protein with 208 amino acids. The amino acid sequences of five cleavage sites in ORF1 are highly conserved compared with those of other members of NV (Someya et al., 2002).

II. Epidemiology Information

Researchers in the 1970s and 1980s demonstrated that NLVs are distributed worldwide (Noel et al., 1999). Most individuals in both developed and developing countries show evidence of infection with norovirus before adulthood, reflecting the global distribution and endemic nature of these viruses. Studies enabled by the development of immunoassays using rVLPs to detect antibodies to GI and GII viruses, demonstrate that the prevalence of antibodies to either genogroup characteristically increased more gradually by age in developed than in developing countries. The prevalence of antibody to the GII viruses (Mexico, Hawaii, or Lordsdale) appears to be greater than that of the GI viruses in most studies, which likely reflects the predominance of circulating GII strains (Green et al., 2007). Noroviruses are the most common cause of outbreaks of nonbacterial gastroenteritis and it is estimated that they are responsible for 68-80% of all outbreaks of gastroenteritis in industrialized countries. In the United States, noroviruses accounted for 93% of outbreaks of viral gastroenteritis examined over a 3-year period. The emergence and detection of new strains often coincide with the increase in norovirus outbreaks. When these outbreaks occur, thousands of persons can be infected, causing the closure of facilities and businesses. It is for this reason that noroviruses have since been described as being the most important cause of viral gastroenteritis worldwide (Clark and McKendrick, 2005). "Norwalk-like viruses" (NLVs) are the most common cause of outbreaks of nonbacterial gastroenteritis. During molecular surveillance of NLV strains from 152 outbreaks of gastroenteritis that occurred in the US between August 1993 and July 1997, an NLV strain that predominated during the 1995-1996 season was identified. The "95/96-US" strain caused 60 outbreaks in geographically distant locations within the US and was identified, by sequence comparisons, in an additional 7 countries on 5 continents during the same period. This is the first demonstration linking a single NLV strain globally and suggests that the circulation of these strains might involve patterns of transmission not previously considered (Noel et al., 1999). During the 1990's, GII was the most common type identified in outbreaks. Interestingly it was noted that in cruise ship settings genogroup I noroviruses were more common than in the hospital outbreaks. Also outbreaks on cruise ships were more common in the summer months than in winter (Clark and McKendrick, 2005).

A. Outbreak Locations:

1. Outbreaks of NLV gastroenteritis occur in multiple settings. Of 348 such outbreaks reported to CDC during January 1996 - November 2000, a total of 39% occurred in restaurants; 29% occurred in nursing homes and hospitals; 12% in schools and day care centers; 10% in vacation settings, including cruise ships; and 9% in other settings (Parashar et al., 2001).
2. The source of a norovirus outbreak among attendees of 46 weddings taking place during a single weekend was sought. Norovirus-compatible illness was experienced by 332 (39%) of wedding guests surveyed; the outbreak affected up to 2700 persons. Illness was associated with eating wedding cake provided by a bakery common to the weddings (adjusted RR 4.5, P less than 0.001). A cake requiring direct hand contact during its preparation accounted for the majority of illness. At least two bakery employees experienced norovirus-compatible illness during the week preceding the weddings. Identical sequence types of norovirus were detected in stool specimens submitted by two wedding guests, a wedding hall employee, and one of the ill bakery employees. It is likely that one or more food workers at the bakery contaminated the wedding cakes through direct and indirect contact. These findings reinforce the necessity of proper food-handling practices and of policies that discourage food handlers from working while ill (Friedman et al., 2005).
3. During the week after Hurricane Katrina struck the Gulf Coast on August 29, 2005, an estimated 240,000 persons, mostly from Louisiana, evacuated to Houston, Texas. On August 31, an estimated 24,000 evacuees were sheltered temporarily at facilities in Reliant Park, a sports and convention complex that includes Reliant Astrodome, Reliant Center, and Reliant Arena. All evacuees to these three facilities were provided with cots, bedding, food, water, and access to lavatories and showers. A medical facility was set up initially to provide emergency care to evacuees and subsequently to serve as a comprehensive outpatient clinic staffed largely by personnel from the Harris County Hospital District (HCHD), Baylor College of Medicine (BCM), and Texas Children's Hospital (TCH). On September 2, 2005, physicians and staff from Harris County Public Health and Environmental Services (HCPHES) noted a substantial number of adults and children with symptoms of acute gastroenteritis (defined as diarrhea and/or vomiting) at the medical clinic in Reliant Park. In collaboration with HCPHES, CDC and medical personnel of HCHD, BCM, and TCH conducted enhanced surveillance to improve identification of acute gastroenteritis, investigate the apparent outbreak, identify the infectious agent, and implement measures for its control. This report summarizes the preliminary epidemiologic data from this investigation and underscores the challenges to managing a large and rapidly spreading outbreak of norovirus in crowded evacuee settings (CDC, 2005).
4. Washington. During November--December 2002, the Southwest Washington Health District, Clark County, Washington, received reports of 10 outbreaks of AGE affecting 354 patients from six long-term--care facilities (LTCFs), a community hospital, an outpatient clinic, and the county jail. Outbreaks in four LTCFs accounted for 327 (92%) of the cases, including 220 (49%) among 452 residents and 107 (33%) among 326 staff. Onset of illness for all patients occurred during November 26--December 13. For all 354 patients, illness was characterized by diarrhea (84%), nausea (78%), and vomiting (77%). The mean duration of illness was 49 hours (range: 20--72 hours); mean duration of outbreak in the four LTCFs was 12 days (range: 9--16 days). Eight ill persons were hospitalized. Three of the four LTCFs included residents receiving various levels of care (i.e., nursing care). The fourth LTCF provided care exclusively for persons with Alzheimer's disease and experienced the highest attack rates (ARs) for residents (AR: 85%) and staff (AR: 41%), compared with the other three LTCFs (AR among residents: 42%; AR among staff: 30%). The range of dates of illness onset in each outbreak suggests person-to-person transmission. The incubation period was 24--48 hours (CDC, 2002).
5. New Hampshire. During 2002, the New Hampshire Department of Health and Human Services (NHDHHS) investigated 35 outbreaks of AGE consistent clinically and epidemiologically with norovirus infection from LTCFs and assisted-living facilities (n=29), restaurants (n=two), schools (n=two), and residential summer camps (n=two). Of the 29 outbreaks in LTCFs and assisted-living facilities, 28 were reported during November--December 2002. In 10 (29%) outbreaks, an etiology of norovirus was confirmed by RT-PCR testing of fecal specimens at NHDHHS or CDC, and 25 (71%) outbreaks were attributed to norovirus based on epidemiologic criteria. A total of 2,312 persons had AGE during the 35 norovirus outbreaks, resulting in 13 hospitalizations; two ill patients in LTCFs died. Epidemiologic investigation implicated person-to-person, foodborne, and waterborne transmission in 32, two, and one outbreak, respectively. Control measures in the LTCFs and assisted-living facilities included frequent and thorough hand washing, rapid cleaning of soiled areas, excluding ill staff from work for 48 hours after resolution of symptoms, ceasing of group activities, and stopping new admissions into the facilities (CDC, 2002).
6. New York City. During November 6, 2002 - January 13, 2003, a total of 66 outbreaks of AGE consistent epidemiologically with norovirus infection occurred in NYC and were reported to the NYC Department of Health and Mental Hygiene (DOHMH) or the New York State Department of Health (NYSDOH). The outbreak settings included 51 nursing homes, LTCFs, and rehabilitation facilities; 10 hospitals; three restaurants; one homeless shelter; and one school. Approximately 1,700 persons were affected. Twenty-nine stool specimens were collected from ill patients during outbreaks in the facilities and were tested for norovirus by RT-PCR performed either at YSDOH Wadsworth Center or CDC. Nineteen (66%) specimens tested positive for norovirus, one to 10 positive specimens from each of the six outbreak settings. Control measures implemented throughout all 51 residential facilities included appropriate hand washing techniques, rapid cleaning of contaminated areas, and exclusion of ill persons from institutional and congregate settings (e.g., schools and child care centers) until 48 hours after symptoms resolved (CDC, 2002).
7. Chile. Human caliciviruses caused 45% of 55 gastroenteritis outbreaks occurring in Santiago, Chile, during 2000-2003. Outbreaks affected less than or equal to 99 persons, occurred most commonly in the home, and were associated with seafood consumption. Thirteen outbreak strains sequenced were noroviruses, including 8 GII, 2 GI, and 3 belonging to a novel genogroup (Vidal et al., 2005).
8. Australia. In Victoria, Australia, from July to December 2002, 126 outbreaks of viral and suspected viral gastroenteritis were reported in healthcare institutions. Norovirus was found to account for at least 77 of the 126 outbreaks (Cooper and Blamey., 2005).
9. Hong Kong. Noroviruses (Norwalk-like viruses) are recognized as major causes of acute gastroenteritis worldwide. Outbreaks of norovirus gastroenteritis are often associated with consumption of oysters. In this study, oysters imported into Hong Kong from 11 countries over a 3-year period were screened by RT-PCR. Overall, 53 out of 507 (10.5%) samples were positive for norovirus-RNA, and a wide variety of strains were found. Two novel genetic clusters were detected, which could indicate novel human or animal norovirus strains. However, whether these two new clusters are of human or animal origin is not known. Thirteen outbreaks, in which oysters were implicated as the source of infection were investigated: Norovirus RNA sequences could be detected in oysters from six outbreaks, but only in one outbreak the strains isolated from patients and oysters matched (>98% homology). Therefore, RT-PCR was of use in detecting norovirus contamination of oysters implicated in an outbreak, but was less useful in demonstrating an actual molecular epidemiological link with human cases. It was shown that contamination by noroviruses could be demonstrated in oysters worldwide, and therefore oysters may serve as an important vehicle for introducing novel norovirus strains (Cheng et al., 2002).
10. South Africa. Two successive outbreaks of gastroenteritis in South Africa were investigated to identify the aetiological agents. Some patients were involved in both outbreaks. Enteropathogenic bacteria or parasites were not evident in either outbreak. Small round structured viruses (SRSVs) were demonstrated in both outbreaks by direct electron microscopy. SRSV UK3/Hawaii virus was identified by immune electron microscopy as the causative agent in the first outbreak. Using new recombinant Norwalk virus (rNV) immunoassays for antibodies and antigen, Norwalk virus was implicated in the second outbreak. Preexisting antibodies to Norwalk virus were not protective and there was no cross protection between Hawaii and Norwalk viruses. There was no anamnestic response to Norwalk virus following the SRSV UK3/Hawaii outbreak although those affected had preexisting antibodies to Norwalk virus. To our knowledge, this is the first definitive diagnosis of SRSV-associated gastroenteritis in South Africa (Taylor et al., 1993).
11. France. Sequences were compiled and epidemiological data from 172 caliciviruses detected in France from December 1998 to February 2004 in sporadic and outbreak cases. The results showed a cocirculation of strains with a majority of genogroup II (GII) noroviruses. Three groups of noroviruses, not detected before in our laboratory, emerged and spread during the period: the recombinant GGIIb and Norwalk-related strains not amplified in the polymerase gene in 2000 and a new Lordsdale variant in 2002. It was observed that (i) GII-4 noroviruses were predominant in nursing home and hospital outbreaks but rare in oyster- and water-related outbreaks despite continuous circulation in the population; (ii) at the opposite, genogroup I strains were detected in the majority of environmental outbreaks; (iii) several strains were frequently found in oyster- and water-linked outbreaks (up to seven), whereas one single strain was detected when transmission was from person to person; and (iv) whereas GII noroviruses were predominant in sporadic cases where patients were under 15 years of age, GI strains were more frequent in outbreaks occurring in this age group (Bon et al., 2002).
12. Noroviruses have also been documented as important agents of gastroenteritis in military populations in several different areas of the world. Among U.S. military personnel deployed to South America or West Africa, NV infection was detected in 10% of ill personnel, second in importance to enterotoxigenic Escherichia coli, which was the most frequently encountered pathogen (17%). In addition, large-scale outbreaks of gastroenteritis have been attributed to the noroviruses on ships such as aircraft carriers on which hundreds of crew members became ill. The serious nature of norovirus illness in military settings was demonstrated when personnel with severe acute illness in a military field hospital required evacuation from Afghanistan for treatment outside the country (Green et al., 2007).

B. Transmission Information:

1. From: Human To: Human , With Destination: Human
   Mechanism: Fecal/Oral Transmission. Transmission of norovirus is faecal-oral and is often foodborne via an ill or recently recovered food handler. Direct and indirect person-to-person transmission is also well documented. Indirect person-to-person transmission is likely aided by a low infectious dose and the widespread dissemination and hardiness of norovirus in the environment (Friedman et al., 2005). Fecal-oral spread is probably the primary NLV transmission mode, although airborne and fomite transmission might facilitate spread during outbreaks. Frequently during an outbreak, primary cases result from exposure to a fecally contaminated vehicle (e.g., food or water), whereas secondary and tertiary cases among contacts of primary cases result from person-to-person transmission. For 348 outbreaks of NLV gastroenteritis reported to CDC during January 1996 - November 2000, food was implicated in 39%, person-to-person contact in 12%, and water in 3%; 18% could not be linked to a specific transmission mode (Parashar et al., 2001).
   
   
2. From: Human To: Human , With Destination: Human
   Mechanism: Airborne Transmission. Person-to-person spread of NLVs occurs by direct fecal-oral and airborne transmission. Such transmission plays a role in propagating NLV disease outbreaks, notably in institutional settings (e.g., nursing homes and day care centers) and on cruise ships (Parashar et al., 2001). An outbreak of gastroenteritis affected a school attended by children aged 4-11 years. Epidemiological features suggested this was due to Norwalk-like virus (NLV) and this was confirmed by polymerase chain reaction (PCR). Nucleotide sequence analysis of the PCR amplicons revealed identical strains in all five positive stool samples. Pupils were significantly more likely to become ill following an episode of vomiting within their classroom (adjusted odds ratio 4.1, 95% CI 1.8-9.3). The times from exposure to illness were consistent with direct infection from aerosolized viral particles where exposure to vomiting was high. Cleaning with quaternary ammonium preparations made no impact on the course of the outbreak. However, the outbreak stopped after the school closed for 4 days and was cleaned using chlorine-based agents. This study confirms the importance of vomiting in the transmission of NLV and provides evidence that direct infection with aerosolized viral particles occurs (Marks et al., 2003).
   
   

C. Environmental Reservoir:

1. Human :
   1. Description: The available data suggest that human infectious caliciviruses are principally of human origin and are generally seasonal, with a peak during the winter months (e.g., in the United Kingdom). There is little evidence that nonhuman mammals or other animals are a significant source of these viruses with regard to anthropogenic transmission; thus, animals are probably not important as environmental sources for these contaminants. There have been instances of calicivirus transmission from the marine environment, but these cases were isolated, and the disease manifestation was dermal rather than enteric. Further studies on waterborne calicivirus may need to evaluate human fecal contamination sources, such as inadequately operated sewage treatment plants, combined sewer overflows (CSOs), storm sewers from urban and suburban areas, land application of biosolids (previously termed "sewage sludge") not meeting final use and disposal requirements, and poorly maintained septic systems. These sources singly or in combination may contaminate a watershed and thus allow caliciviruses to reach drinking-water sources, recreational bathing beaches, and shellfish-growing areas (Schaub and Oshiro, 2000). In this study, the hypothesis that asymptomatic people act as a reservoir for norovirus was examined. Faecal specimens from 399 asymptomatic individuals were tested for norovirus by reverse transcription polymerase chain reaction (RT-PCR) methodology, and no norovirus was detected. The failure to detect norovirus was not apparently due to the test sample being resistant to norovirus infection, nor to the presence of PCR inhibitors in the test sample. The findings suggest that, if norovirus is carried by asymptomatic people, the carriage rate is very low; the upper bound (95% confidence interval, binomial distribution) of the carriage rate was only 0.8%. Thus, it is unlikely that asymptomatic people are an important reservoir for norovirus (Marshall et al., 2002). Marshall et al. report on the failure to detect norovirus in faecal samples of 399 asymptomatic individuals. They compare their results with data from one of our surveys and conclude that, due to the apparently low carriage rate (upper limit at 95% confidence interval of 0.8%), it is unlikely that asymptomatic people are an important reservoir for norovirus. We have several reasons for disagreeing with this conclusion. First, we believe that the carriage rate cannot be properly assessed based on the observations described in the manuscript. Second, the carriage rate in Europe/The Netherlands is higher than the 0.8% reported by Marshall et al. And last but not least, we think that carriage rates of norovirus at, or below 1%, would be sufficient to serve as reservoir for norovirus (Duzier et al., 2004).
   2. Survival Information: During the experimental infection of volunteers, virus shedding as detected by IEM coincided with the onset of illness and usually did not extend more than 72 hours after the first symptoms. However, the shedding has been detected for up to at least 7 days when analyzed by RE-PCR (Green et al., 2001).
2. Cattle :
   1. Description: "Norwalk-like viruses" (NLVs) are the most common cause of acute non-bacterial gastroenteritis in humans. Cattle may be a reservoir of NLVs although bovine NLVs have never been found in humans. To gain more insight into the epidemiology of NLV, infections in cattle in The Netherlands were studied. Individual faecal samples from a large dairy herd and 243 pooled samples from veal calf farms were analysed for NLV by RT-PCR. Calves under 3 months of age in the dairy herd were sampled three to five times with 3-week intervals, whereas dairy cattle were sampled twice with a 2-month interval. In 31.6% (77/243) of the veal calf farm samples and in 4.2% (13/312) of the individual dairy cattle samples NLV was detected. The mean age of virus positive dairy cattle was 2.5 months. The highest numbers of NLV positive veal calf farms in The Netherlands were found in the regions with the highest number of veal calf farms. NLV infected veal calf farms were detected in every month throughout the study period. Cattle appeared to be hosts of NLVs, and virus shedding was weakly associated with diarrhoea (van der Poel et al., 2003). Phylogenetic analysis of partial ORF1 and ORF2 sequences of all calf NLV strains in this study and complete ORF2 sequences of two strains, showed that these viruses form a new cluster or genotype within the proposed GenogroupIII NLV: GIII.2. Jena virus and Newbury virus, of which only a partial ORF2 sequence is available are the two most closely related strains from abroad. The genetic variation between the different strains was very limited even in the hypervariable region of the capsid. Nevertheless, the possibility of a cattle reservoir for human infection cannot be excluded, because of the close relationship with human ORF1 sequences. NLV recombination can play a role and NLVs from an animal reservoir may pose a public health risk (van der Poel et al., 2003). No evidence for strains circulating in both humans and cattle was found, suggesting that at least the BoCVs identified in the present study are not a risk to human health. It was noteworthy that the nucleotide and amino acid sequence identities between the bovine and human NLVs were considerably lower than those reported between the swine vesicular exanthema caliciviruses and the San Miguel sea lion caliciviruses, supporting the opinion that the BoCVs are unlikely to infect humans. Whether occasional cross-species infectivity events occur between cattle and humans requires more sequence data of the caliciviruses circulating in cattle from throughout the world (Oliver et al., 2003).
   2. Survival Information: In 0.15% (2/13) of NLV positive dairy calves viral RNA could still be detected after a 2-month interval. Duration of NLV shedding in calves was estimated between 1 and 4 weeks. The mean age of calves shedding virus was 2.5 months, with the youngest being 1 month of age and the oldest 9 months of age. Reinfections were not observed (van der Poel et al., 2003).
3. Pigs :
   1. Description: Viruses closely related to Norwalk-like viruses (NLVs) were recently found in stored stool samples from two calves (United Kingdom and Germany) and four pigs (Japan), sparking discussions about the potential for zoonotic transmission. To investigate if NLVs are commonly present in farm animals, pooled stool samples from 100 pig farms, 48 chicken farms, 43 dairy cow herds, and 75 veal calf farms from the Netherlands were assayed by reverse transcription-polymerase chain reaction amplification, using primers specific for the detection of NLVs from humans. NLV RNA was detected in 33 (44%) of the specimens from veal calf farms and two (2%) specimens from pig farms. Our data show that NLV infections-until recently thought to be restricted to humans-occur often in calves and sometimes in pigs. While zoonotic transmission has not been proven, these findings suggest that calves and pigs may be reservoir hosts of NLVs (Poel et al., 2000).
4. Oysters :
   1. Description: Outbreaks of norovirus gastroenteritis are often associated with consumption of oysters. Oysters are filter feeders, and hence concentrate the viruses from contaminated water (Cheng et al., 2005) Contamination by noroviruses could be demonstrated in oysters worldwide, and therefore oysters may serve as an important vehicle for introducing novel norovirus strains (Cheng et al., 2005).

D. Intentional Release:

No release information is currently available here.

III. Infected Hosts

1. Human:
   1. Taxonomy Information:
      1. Species:
         1. Human :
            • GenBank Taxonomy No.: 9606
            • Scientific Name: Homo sapiens (NCBI Taxonomy)
            • Description: Noroviruses are the most common cause of outbreaks of nonbacterial gastroenteritis and it is estimated that they are responsible for 68-80% of all outbreaks of gastroenteritis in industrialized countries. In the United States, noroviruses accounted for 93% of outbreaks of viral gastroenteritis examined over a 3-year period. The emergence and detection of new strains often coincide with the increase in norovirus outbreaks. When these outbreaks occur, thousands of persons can be infected, causing the closure of facilities and businesses. It is for this reason that noroviruses have since been described as being the most important cause of viral gastroenteritis worldwide (Clark and Lambden, 2002).
      
      
   2. Infection Process:
      1. Infectious Dose: The estimated dose range to initiate infection by small round structured viruses (SRSVs, used herein as a synonym for Norwalk-like viruses) is 10 -100 virus particles (Schaub and Oshiro, 2000). Characteristics of NLVs facilitate their spread during epidemics. The low infectious dose of NLVs (i.e., less than 100 viral particles) readily allows spread by droplets, fomites, person-to-person transmission, and environmental contamination, as evidenced by the increased rate of secondary and tertiary spread among contacts and family members (Parashar et al., 2001).
      2. Description: Previously, researchers believed that a person remained contagious 48--72 hours after recovery from NLV gastroenteritis. However, data from recent studies using more sensitive diagnostic assays demonstrate that this belief might require further evaluation. During a 1994 study of 50 volunteers exposed to NLV, 82% became infected; of these infections, 68% resulted in illness, whereas the remaining 32% were asymptomatic. Viral shedding in stool began 15 hours after virus administration and peaked 25 - 72 hours after virus administration. Unexpectedly, viral antigen could be detected by ELISA in stool specimens collected 7 days after inoculation in both symptomatic and asymptomatic persons. In a later study of infected volunteers, viral antigen in stool was detected less than 2 weeks after administration of virus. Anecdotal evidence from outbreak investigations also demonstrates that viral shedding can occur for a prolonged period and in the absence of clinical illness. However, the epidemiologic significance of these findings is unclear. Additional research is need to determine whether the viral antigen that is detectable for prolonged periods after recovery from illness is evidence of infectious virus or just a soluble antigen and to assess the time of maximal viral shedding so that control measures can focus on the period during which the person is most likely to be contagious (Parashar et al., 2001).
      
      
   3. Disease Information:
      1. Norovirus induced Gastroenteritis :
         1. Pathogenesis Mechanism: Human caliciviruses enter the body predominantly via the oral route. Virions are acid stable, consistent with an ability to survive passage through the stomach. Indirect evidence from epidemiologic studies suggests that viruses may enter also via aerosols, such as in those generated from the explosive vomiting that often occurs during illness. The site of primary replication for the human caliciviruses has not been established, but it is assumed that they replicate in the upper intestinal tract. Biopsies of the jejunum of volunteers who develop gastrointestinal illness following oral administration of the Norwalk or Hawaii virus exhibit histopatholgic leisons. There is broadening and blunting of the villi of the proximal small intestine, although the mucosa itself remains histologically intact. Infiltration with monnuclear cells and cytoplasmic vacuolization is also observed. When viewed by transmission EM, the epithelial cells are intact, but there is shortening of the microvilli. Biopsies obtained during the convalescent phase of illness are normal. Virus has not been detected by EM in epithelial cells of the mucosa. It is of interest that the characteristic jejunal lesion has also been observed in volunteers who were fed Norwalk or Hawaii virus but who did not become ill. Histologic lesions are not observed in the gastric fundus, antrium, or rectal mucosa of volunteers with Norwalk virus-induced illness (Green et al., 2001).
         
         
         
         2. Incubation Period: The incubation period has a range of 12-48 h; duration ranges from 12 to 60 h (Friedman et al., 2005).
         
         
         
         3. Prognosis: There is little evidence that the "Norwalk-like viruses" and "Sapporo-like viruses" cause chronic infection in a normal host. However, one study reported evidence for chronic infection in immunocompromised infants and young children, with one patient shedding the "Norwalk-like" virus GII strain for at least 8 months (Green et al., 2001). Viral gastroenteritis is generally considered to be mild and self-limiting, although the illness can be incapacitating during the symptomatic phase that usually lasts 24 to 48 hours. Illness induced by "Norwalk-like viruses" has occasionally been severe enough to require medical intervention (Green et al., 2001). Particularly in the elderly or immunocompromised, however, disease may be more severe, and in some cases results in death. In one report of norovirus-associated IID in the UK, all 43 reported fatalities occurred in 38 outbreaks affecting hospitals or residential care facilities. In the USA, norovirus infection is estimated to account for approximately 7% of fatalities due to foodborne disease (Radford et al., 2004). Clinical signs associated with norovirus are generally acute, lasting 1-2 days. They can last longer, however, particularly in children and the elderly. In addition, there are recent reports that highlight the potential for immunosuppressed patients to develop chronic disease (Radford et al., 2004).
         
         
         
         4. Diagnosis Overview: Differentiation of illness caused by Norwalk virus from that caused by other members of the genus "Norwalk-like viruses" cannot be made on clinical grounds. However, an analysis of the common features of 38 Norwalk virus outbreaks indicate that a provisional diagnosis of illness by this group can be made during an outbreak if the following criteria are met: (a) bacterial or parasitic pathogens are not detected; (b) vomiting occurs in more than 50% of the cases; (c) the mean or median duration of illness ranges from 12 to 60 hours; and (d) the incubation period is 24 to 48 hours (Green et al., 2001).
         
         
         
         5. Symptom Information :
            • Syndrome -- Gastroenteritis:
              • Description: Norovirus infections result from ingestion of viral particles, which includes possible airborne transmission. After a short incubation period (12-48 h), symptoms of nausea, vomiting, and diarrhoea follow. The illness is usually mild and self-limiting, but has a high secondary attack rate, resulting in high rates of transmission and large outbreaks (Clark and Lambden, 2002).
              • Observed: Noroviruses are the most common cause of outbreaks of nonbacterial gastroenteritis and it is estimated that they are responsible for 68-80% of all outbreaks of gastroenteritis in industrialized countries. In the United States, noroviruses accounted for 93% of outbreaks of viral gastroenteritis examined over a 3-year period (Clark and Lambden, 2002).
              
              
              Symptoms Shown in the Syndrome:
              
              
              • Nausea:
                • Observed: 79% (Green et al., 2001)
              • Vomiting:
                • Description: Vomiting occurred more frequently than diarrhea in children, whereas in adults the reverse was observed (Green et al., 2001). Persons infected with norovirus have an acute onset of vomiting and/or nonbloody diarrhea lasting 12-60 hours (CDC, 2005)
                • Observed: 69% (Green et al., 2001)
              • Diarrhea:
                • Description: Persons infected with norovirus have an acute onset of vomiting and/or nonbloody diarrhea lasting 12-60 hours (CDC, 2005)
                • Observed: 66% (Green et al., 2001)
              • Abdominal cramps:
                • Observed: 30% (Green et al., 2001)
              • Headache:
                • Observed: 22% (Green et al., 2001)
              • Fever:
                • Observed: 37% (Green et al., 2001)
              • Chills:
                • Observed: 32% (Green et al., 2001)
              • Myalgias:
                • Observed: 26% (Green et al., 2001)
              • Sore throat:
                • Observed: 18% (Green et al., 2001)
         
         
         6. Treatment Information:
            • No Specific Treatment: There is no specific treatment for calicivirus infection (Glass et al., 2000). As noted, the noroviruses characteristically induce a mild, self-limited gastroenteritis that normally resolves without complications. Oral fluid and electrolyte replacement therapy is usually sufficient to replace fluid loss. Parenteral administration of fluids may be necessary, however, if severe vomiting or diarrhea occurs. As noted, hospitalization for severe dehydration, although rare, can occur with norovirus gastroenteritis. In addition, deaths from norovirus gastroenteritis in debilitated elderly patients and in immunocompromised children infected with human caliciviruses have been reported; however, these fatalities were considered to be caused, in large part, by an underlying disease. Oral rehydration therapy should not be administered to patients with depressed consciousness because of the possibility of fluid aspiration. Patients with cardiovascular disease, those receiving immunosuppressive therapy, the elderly, and organ transplant recipients were found to be at higher risk of a severe clinical outcome from norovirus infection in a hospital setting, and frequent monitoring of these patients is recommended. Oral administration of bismuth subsalicylate after onset of symptoms significantly reduced the severity and duration of abdominal cramps during experimentally induced norovirus illness in adults. In addition, the median duration of gastrointestinal symptoms was reduced from 20 to 14 hours. The number, weight, and water content of stools, as well as the extent of virus excretion, were not significantly affected by treatment. The use of various medications for symptomatic treatment of acute diarrhea in infants and young children (aged 1 month to 5 years) was reviewed: bismuth subsalicylate, loperamide, anticholinergic agents, adsorbents, or Lactobacillus-containing compounds were not recommended by the American Academy of Pediatrics and, in addition, the use of opiates as well as opiate and atropine combination drugs was contraindicated (Green et al., 2007).
              • Applicable:
      
      
   4. Prevention:
      1. Infection Control Methods:
         • Description: In the hospital setting prompt implementation of infection control measures, staff restrictions, the cleaning of surfaces with an effective disinfectant, and ward closure can limit the spread of infection (Glass et al., 2000). The director of nursing and the infection control practitioner led the investigation and management of the outbreak. An Outbreak Management Committee was also formed to reinforce routine infection prevention practices and implement infection control strategies. Communication strategies for staff, patients and visitors were quickly devised and implemented. Gaps in the outbreak protocol were identified and resolved promptly. Four permanent changes were made: the use of alcohol hand rinse in designated locations; the development of a comprehensive e-mail to facilitate site-wide communication; the development of teamwork checklists and accountabilities; and the establishment of criteria for use in outbreak situations to proactively determine essential and non-essential therapies and treatments (Albers, 2004). Although interruption of person-to-person transmission can be difficult, certain measures might help. Frequent handwashing with soap and water is an effective means of prevention. The recommended procedure is to rub all surfaces of lathered hands together vigorously for >10 seconds and then thoroughly rinse the hands under a stream of water. Because spattering or aerosols of infectious material might be involved in disease transmission, wearing masks should be considered for persons who clean areas substantially contaminated by feces or vomitus (e.g., hospital or nursing home personnel). Soiled linens and clothes should be handled as little as possible and with minimum agitation. They should be laundered with detergent at the maximum available cycle length and then machine dried. Because environmental surfaces have been implicated in the transmission of enteric viruses, surfaces that have been soiled should be cleaned with an appropriate germicidal product (e.g., 10% solution of household bleach) according to the manufacturer's instructions. In situations in which the epidemic is extended by periodic renewal of the susceptible population (e.g., camps and cruise ships), the facility or institution might have to be closed until it can be cleaned appropriately (Parashar et al., 2001).
      2. Limiting Waterborne Exposure:
         • Description: Until reliable methods for assessing the occurrence and susceptibility to treatment of NLVs are available, prevention methods should focus on reducing human waste contamination of water supplies. If drinking or recreational water is suspected as being an outbreak source, high-level chlorination (i.e., 10 ppm or 10 mg/L for more than 30 minutes) might be required for adequate disinfection; however, even this method might be insufficient in certain cases (Parashar et al., 2001).
      3. Limiting Foodborne Exposure:
         • Description: Food contamination by infectious foodhandlers is another frequent cause of NLV gastroenteritis outbreaks. Because of the low infectious dose of NLVs and the high concentration of virus in stool, even a limited contamination can result in substantial outbreaks. Ready-to-eat foods that require handling but no subsequent cooking (e.g., salads and deli sandwiches) pose greater risk. Previously, the exclusion of ill foodhandlers for 48 - 72 hours after resolution of illness was recommended to prevent outbreaks caused by foodhandlers. Data from recent human volunteer and epidemiologic studies demonstrate that viral antigen can be shed for a longer duration after recovery from illness and in the absence of clinical disease. Although data are limited regarding whether this detectable viral antigen represents infectious virus, foodhandlers should be required to maintain strict personal hygiene at all times (Parashar et al., 2001).
      
      
   5. Model System:
      1. Macaca nemestrina:
         1. Model Host: Human. Sequential passaging of an NLV through an immunoincompetent newborn pigtail macaque (Macaca nemestrina) may allow for the adaptation of a human NLV to a primate host, thus providing an animal model for investigating this disease. A fecal filtrate of human origin containing NLV, Toronto virus P2-A, was obtained from a patient during an epidemic of viral gastroenteritis. The filtrate was administered via nasogastric tube to three newborn pigtailed macaques. Clinical illness, which was characterized by diarrhea, dehydration, and vomiting, occurred in three monkeys. Reverse transcription-polymerase chain reaction (RT-PCR) and oligonucleotide probe analysis of RNA extracted from the stool samples following infection revealed viral RNA in all inoculated monkeys. Infection was also transmitted experimentally by feeding two additional newborn macaques a fecal filtrate prepared from the three previously infected animals. Detection of viral RNA in the stools of animals that received the fecal filtrate indicates that viral replication occurred in association with clinical illness. The susceptibility of Macaca nemestrina to infection with a Norwalk-like agent will facilitate the study of the mechanisms of the pathogenesis of NLV. This system may also have the potential to serve as a vaccine test model for human epidemic viral gastroenteritis (Subekti et al., 2002).
2. Cow:
   1. Taxonomy Information:
      1. Species:
         1. Cow :
            • GenBank Taxonomy No.: 9913
            • Scientific Name: Bos taurus (NCBI Taxonomy)
            • Description: Enteropathogenic bovine enteric caliciviruses (BECs) with small round-structured virus morphology, which are similar to human NLV, have also been identified in cattle. In recent years, two such NLV-BEC strains from Europe, Jena and Newbury Agent-2 (NA-2), were genetically characterized and shown to be similar to human NLVs. Similar virus gene sequences were also detected in pooled fecal samples collected from veal calves in The Netherlands. These findings have raised questions about the host range of BECs because it was unclear whether these viruses comprised their own distinct genetic lineage or whether they were, potentially, part of a common pool of viruses circulating between animals and humans (Smiley et al., 2003).
      
      
   2. Infection Process:
      
      No infection process information is currently available here.
      
      
   3. Disease Information:
      
      No disease information is currently available here.
      
      
   4. Prevention:
      
      No prevention information is currently available here.
      
      
   5. Model System:
      
      No model system information is currently available here.
      
      
3. Pig:
   1. Taxonomy Information:
      1. Species:
         1. Pig :
            • GenBank Taxonomy No.: 9823
            • Scientific Name: Sus scrofa (NCBI Taxonomy)
            • Description: Caliciviridae consists of four genera, Norovirus (NV), Sapovirus (SV), Lagovirus, and Vesivirus, from which NV and SV mainly cause acute gastroenteritis in humans; therefore, these two genera also are called human caliciviruses (HuCVs). Recently several animal enteric CVs genetically closely related to NV or SV have been reported. The porcine enteric CV is the only cultivable enteric CV that is closely related to HuCVs, representing a distinct genogroup within SV. The bovine enteric CVs (the Jena and Newbury viruses) represent two distinct clusters of genogroup III (GIII) NV (1, 21), while the swine enteric CVs that are closely related to human NVs represent a distinct cluster within genogroup II (22, 23). The discovery of these animal CVs raised the question about CV gastroenteritis as a zoonotic disease (Farkas et al., 2005). In this study antibody prevalence among domestic pigs by using recombinant capsid antigens of two human NVs (Norwalk and Hawaii) and one swine NV (SW918) that is genetically related to GII human NVs were categorized. Recombinant SW918 capsid protein expressed in baculovirus self-assembled into virus-like particles (VLPs) that were detected by antibodies against GII (Hawaii and Mexico), but not GI (Norwalk and VA115), human NVs. NVs recognize human histo-blood group antigens as receptors, but SW918 VLPs did not bind to human saliva samples with major histo-blood group types. Seventy-eight of 110 (71%) pig serum samples from the United States and 95 of 266 (36%) pig serum samples from Japan possessed antibodies against SW918. Serum samples from pigs in the United States were also tested for antibodies against human NVs; 63% were positive for Norwalk virus (GI) and 52% for Hawaii virus (GII). These results indicate that NV infections are common among domestic pigs; the finding of antigenic relationships between SW918 and human NVs and the detection of antibodies against both GI and GII human NVs in domestic animals highlights the importance of further studies on NV gastroenteritis as a possible zoonotic disease (Farkas et al., 2005).
      
      
   2. Infection Process:
      
      No infection process information is currently available here.
      
      
   3. Disease Information:
      
      No disease information is currently available here.
      
      
   4. Prevention:
      
      No prevention information is currently available here.
      
      
   5. Model System:
      
      No model system information is currently available here.
      
      

IV. Labwork Information

A. Biosafety Information:

1. Biosafety information for : Norwalk virus :
   • Precautions:
     • The Norwalk virus retains infectivity for volunteers following (a) exposure of the stool filtrate to pH 2.7 for 3 hours at room temperature, (b) treatment with 20% ether at 4 C for 18 hours, or (c) incubation at 60 C for 30 minutes. Norwalk virus is resistant to inactivation following treatment with 3.75 to 6.35 mg/L of chlorine (free residual chlorine of 0.5 to 1.0 mg/L), a chlorine concentration consistent with that found in drinking water distribution system. However, Norwalk virus is inactivated following treatment with 10 mg/L chlorine, a concentration that is used to treat water supply systems after contamination has been detected. Norwalk virus is more resistant to inactivation by chlorine than poliovirus type 1, human rotavirus (Wa), simian rotavirus (SA11), or f2 bacteriophage (Green et al., 2001).
   • Disposal:
     • The practice of dumping sewage overboard continues in Louisiana despite good evidence that such disposal by oyster harvesters into oyster bed waters was the most likely source of sewage in at least two of the NLV gastroenteritis outbreaks. Changing this behavior seems to be the most likely way to prevent future oyster-related NLV outbreaks. What are the obstacles to preventing this practice? The Louisiana Sanitary Code already requires that boats have a container on board for the collection of sewage, and it prohibits the overboard discharge of sewage; however, these provisions are not being adequately enforced. Since oyster boats operate far from land and often in isolated areas, it is impossible for even diligent enforcement officers to monitor them at all times. However, changing the requirements for the sewage-holding containers might be helpful. For example, designing a container that cannot be easily dumped or flushed out overboard, mandating its use, and enacting severe penalties for violation of this mandate might help prevent overboard dumping. Many harvesters interviewed in the 1993 outbreak noted that even if they had a container to collect sewage on board their boats, there were no facilities for emptying that container once their boats had docked. Policies and possibly funding programs that encourage and enable the construction of such facilities will be needed before harvesters can reasonably be expected to comply with regulations against disposal into the water (Berg et al., 2000).

B. Culturing Information:

1. Macrophages and Dendritic Cell Culture for Noroviruses :
   1. Description: Noroviruses are understudied because these important enteric pathogens have not been cultured to date (Wobus et al., 2005). Only one member of the genus Norovirus, murine norovirus, grows efficiently in cell culture. Murine norovirus grows in cultured primary macrophage and dendritic cells of murine origin and forms plaques in RAW264.7 cells, a continuous murine macrophage-like cell line. (Green et al., 2007). Wobus and co-workers found that the norovirus murine norovirus 1 (MNV-1) infects macrophage-like cells in vivo and replicates in cultured primary dendritic cells and macrophages. MNV-1 growth was inhibited by the interferon-(alpha beta) receptor and STAT-1, and was associated with extensive rearrangements of intracellular membranes. An amino acid substitution in the capsid protein of serially passaged MNV-1 was associated with virulence attenuation in vivo. This is the first report of replication of a norovirus in cell culture (Wobus et al., 2005).
      
      
   2. Medium:
      1. DMEM (Cellgro, Mediatech, Herndon, Virginia, United States) supplemented with 10% low-endotoxin fetal calf serum (SH30070.03, HyClone, Logan, Utah, United States), 100 U penicillin/ml, 100 ug/ml streptomycin, 10 mM HEPES (N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid), and 2 mM L-glutamine (Biosource, Camarillo, California, United States) (Wobus et al., 2005)
   3. Optimal Temperature: 37 C (Wobus et al., 2005)

C. Diagnostic Tests :

1. Organism Detection Tests:
   1. Electron microscopy:
      1. Time to Perform: 1-hour-to-1-day
      2. Description: Under the electron microscope, NLVs can be identified by their characteristic morphology. Approximately 10(6) - 10(7)/ml of virus in stool is required for visualization by EM; therefore, this technique is useful only for specimens collected during the early stages of illness when substantial quantities of virus are shed. Even among experimentally infected volunteers, the virus can be found in only 10% - 20% of fecal specimens collected on days 2 or 3 of illness (Parashar et al., 2001) A pea-sized stool sample or 200 ul of liquid stool was suspended in 500 and 200 ul phosphate-buffered saline (PBS), respectively, and a 200-mesh grid placed on a drop of these suspensions. To facilitate the detection of viral particles, negative staining was employed using electron-dense stains (2% phosphotungstic acid and 1% uranyl acetate). The stained specimens were examined carefully for at least 30 min/sample on a Zeiss 900 electron microscope (Zeiss,Oberhofen,Germany) at 50,000- to 100,000-fold magnification by an experienced technician. NV-like particles were identified on the basis of their size (with a diameter of approximately 27-40 nm), and typical morphology (spherical, no envelope, somewhat lace-like appearance). This is distinct from other small viruses (e.g. astroviruses), and non-NV caliciviruses such as SV which typically show a cup-like or 'star of David' morphology (Rabenau et al., 2003). The advantage of electron microscopy for the direct visualization of virus particles in specimens is that it detects any potentially responsible viral agents present in sufficient concentration (i.e. at least 10(5)-10(6) particles/ml), and that it provides a rapid diagnosis within 3 h on receipt of the specimen in the laboratory. On the other hand, it requires not only specialized and expensive equipment, and an experienced operator spending considerable time per specimen, its relative insensitivity may hamper the diagnosis of NV; furthermore, it does not enable speciation beyond the genus level (Rabenau et al., 2003). Up to the present, TEM is accepted as a 'gold standard' for the diagnosis of NV, but because newer methods are available, the results obtained by each method have to be discussed in context with the other results, i.e. a positive result in any two of the three tests used in this study (TEM, PCR and ELISA) should be defined as 'new gold standard'. Alternatively PCR, presumably the most sensitive method, could be used as 'gold standard' (Rabenau et al., 2003).
   2. Immune electron microscopy:
      1. Time to Perform: unknown
      2. Description: Immune electron microscopy (IEM) can improve the sensitivity of EM by 10- to 100-fold. In one type of IEM, convalescent-phase serum from patients is coated on the examination grid of the microscope before stool specimens are applied. The antibody on the grid traps homologous virus, thereby increasing diagnostic yield. However, IEM has certain disadvantages, the greatest of which is that success is highly dependant on the skill and expertise of the microscopist. Furthermore, the virus might be totally masked if a large excess of antibody is present, resulting in a false-negative test (Parashar et al., 2001).
      3. False Negative: The virus might be totally masked if a large excess of antibody is present, resulting in a false-negative test (Parashar et al., 2001).
   
   
2. Immunoassay Tests:
   1. ELISA:
      1. Time to Perform: 1-hour-to-1-day
      2. Description: The expression in baculoviruses of the capsid proteins of NLVs that self-assemble into stable virus-like particles has allowed the detection of these viruses by ELISAs. To develop assays to detect virus in fecal specimens, the expressed capsid antigens have been used to generate hyperimmune antibodies in laboratory animals. These assays have been reported to detect the presence of 10(4) - 10(6) viral particles/ml in clinical specimens. To date, these assays have been type-specific, but broadly reactive tests are under development (Parashar et al., 2001). Immunological methods are simple and less time consuming (three hours for ELISA, 15 minutes for Immunochromatography) and appeared to be useful for rapid diagnosis of viral gastroenteritis especially in developing countries (Kurokawa et al., 2004). The NV antigen ELISA (DAKO, Ely,U K) facilitates the detection and differentiation of GI and GII NV strains. It was performed according to the manufacturer's instructions as follows: 100 ul of liquid stool or a pea-sized formed stool sample was suspended in 1 ml of sample diluent, mixed thoroughly and incubated for 10 min before testing. Sample diluent served as a negative control, and cutoff controls for each genotype (lyophilized and reconstituted with 1 ml dilution buffer before use) supplied with the kit were used. 100 ul of samples and controls were added to microwell strips coated with a polyclonal antibody specific for each genotype. Then 100 ul of a polyclonal antibody conjugated with horseradish peroxidase and specific for each genotype was added to each well. After incubation at room temperature for 120 min, five wash cycles with freshly prepared washing buffer were performed on an automated microplate washer. After the final washing step,100 ul substrate was added, and the strips were incubated at room temperature for 30 min. Finally, the reaction was stopped by adding 100 ul stopping solution, and wells were read photometrically using an EIA plate reader set to 450 nm (Rabenau et al., 2003). In our study, a total of 244 stool samples obtained from 227 patients between March and May 2002 were tested by TEM, antigen ELISA and in-house PCR. Our data showed that PCR has the highest sensitivity (94.1%), followed by TEM (58.3%), and ELISA (31.3%), while specificity was highest for TEM (98.0%), followed by ELISA (94.9%), and PCR (92.4%). All three methods tested (TEM, ELISA and PCR) are useful for epidemiological investigations in gastroenteritis outbreaks; however, to maximize diagnostic validity for individual cases, at least two of the methods should be combined (Rabenau et al., 2003). The detection of viral antigens, e.g. by means of ELISA, is quick (usually within 6 h, i.e. within less than 1 working day) and easy, lending itself to the regular screening of large numbers of specimens in an economical fashion. However, specificity is often problematic; in the absence of specific neutralization methods, positive results should preferably be confirmed using a different technique such as TEM (Rabenau et al., 2003).
   2. Enzyme Immunoassay:
      1. Time to Perform: unknown
      2. Description: Simple diagnostic tests are needed for the detection of norovirus (NoV) outbreaks. Salivary antibody assays provide an attractive alternative to collecting and testing serum or stool samples. Antibodies to Norwalk virus (NV) in oral fluid samples were compared with NV antibodies in serum collected from 38 volunteers challenged with NV inoculum. Pre- and postchallenge (day 4, 8, 14, and 21) saliva and serum samples were examined by enzyme immunoassay (EIA) using recombinant NV antigen. Of 18 infected subjects (those who shed NV in stool or who demonstrated immunoglobulin G [IgG] seroconversion), 15 (83%) had > or = 4-fold increases in NV-specific salivary IgA and 15 (83%) had > or = 4-fold increases in NV-specific salivary IgG when prechallenge and postchallenge saliva samples were compared. When the results of the IgA and IgG assays were combined, all 18 infected subjects showed > or = 4-fold increases in NV-specific salivary IgG or IgA postchallenge titers compared to their prechallenge titers. One of 19 uninfected subjects had a > or = 4-fold increase in NV-specific salivary IgG. The sensitivity of the combined assay results was 100%, and the specificity was 95%. NV-specific salivary IgA titers peaked around 14 days postchallenge. NV-specific salivary IgG and serum IgG titers continued to rise through 21 days postchallenge. The application of this EIA to an elementary school outbreak indicated that 67% of the subjects with confirmed infections had > 4-fold rises in anti-NoV IgA when an antigen in the same genetic cluster as the outbreak virus was used. This is the first documented mucosal antibody response to NoV in children. This EIA provides a useful approach for diagnosing NoV outbreaks (Moe et al., 2004). The titers of anti-NV IgG in serum specimens were determined by an EIA with rNV capsid antigen, as described by Monroe et al., with alkaline phosphatase-conjugated goat anti-human IgG (Kirkegaard & Perry Laboratories, Inc., Gaithersburg, Md.). Net absorbance was calculated for each sample as the mean value in the duplicate antigen-coated wells minus the mean value in the duplicate antigen-negative wells. NV seroconversion was defined as a greater than or equal to 4-fold increase in NV-specific serum IgG units based on an assigned concentration of total NoV IgG units in the reference serum (Moe et al., 2004) The baculovirus-expressed viral antigen can be directly used for detection of antibodies to NLVs in patient's sera by enzyme immunoassay. Because certain adults have preexisting immunoglobulin G (IgG) antibodies to NLVs, a single serum specimen is insufficient to indicate recent infection. Seroconversion, defined as a less than 4-fold rise in IgG antibody titer during acute- and convalescent-phase sera, is indicative of a recent infection. In outbreak settings, if at least half of affected persons seroconvert to a specific NLV, that viral strain can be designated as etiologic. Titers can begin to rise by the fifth day after onset of symptoms, peak at approximately the third week, and begin to fall by the sixth week. Hence, for IgG assays, the acute-phase serum should be drawn within the first 5 days and the convalescent-phase serum during the third to sixth weeks. In certain cases where diagnosis is critical (e.g., when a foodhandler is implicated as the source of an outbreak), single assays of serum immunoglobulin A (IgA) antibody can be successful if specimens are collected 7 - 14 days after exposure. In addition to potential difficulties in obtaining an adequate number of serum specimens during outbreaks, serologic assays are currently limited by the fact that the available array of expressed NLV antigens is insufficient to detect all antigenic types of NLVs (Parashar et al., 2001).
   
   
3. Nucleic Acid Detection Tests: :
   1. Nested RT PCR for identification from stools:
      1. Time to Perform: 1-hour-to-1-day
      2. Description: A nested reverse transcription-PCR (nRT-PCR) was developed for the detection of noroviruses in stools, using random primers for RT, the JV12/JV13 primer pair in the first round of nPCR, and a set of nine inner primers for the second, comprising the reverse sequences of primers SR46, SR48, SR50, and SR52, and five novel oligonucleotide sequences (113-1, 113-2, 115-1, 115-2, and 115-3). The specificity of the nRT-PCR was confirmed by testing 61 stools containing enteric viruses other than noroviruses. In comparative assays on either stools or RNA dilutions from two genogroup I and three genogroup II (GII) norovirus-positive samples, nRT-PCR was always at least as sensitive as RT-PCR and Southern hybridization. With some of the samples tested, the increase in sensitivity was 10-fold or higher. For GII viruses, the detectable range of nRT-PCR was estimated to be 8.4 x 10(4) to 2 RNA viral particles. When used on 85 stools from pediatric patients with acute gastroenteritis negative for viruses by electron microscopy and cell culture, the nRT-PCR detected norovirus in 19 samples (22.3%), while it failed to detect one reference RT-PCR-positive sample containing a Desert Shield strain. Sixteen of the 19 nRT-PCR-positive samples gave concordant results with reference RT-PCR and Southern hybridization, and all with sequence analysis. Partial sequencing of the polymerase region revealed that from January to April 2000 all GII strains except two (Rotterdam- and Leeds-like viruses) formed a tight cluster related to Hawaii virus. The nRT-PCR described could prove suitable for large epidemiological studies and for specialized clinical laboratories performing routine molecular testing (Medici et al., 2005). The detection range of nRT-PCR was 2.1 x 10(5) to 1.45 x 10(3) particles/ml versus 3.9 x 10(6) to 1.45 x 10(4) particles/ml by RT-PCR and Southern hybridization (Medici et al., 2005).
      3. Primers:
         • First round primers JV12/JV13
           • Forward: JV12 ATA CCA CTA TGA TGC AGA TTA (Medici et al., 2005)
           • Reverse: JV13 TCA TCA TCA CCA TAG AAA GAG (Medici et al., 2005)
         • Second round primers
           • Forward: 113-1 GTG CAG CCA TGG AGG TAA TG, 113-2 CAG AAT CCT TCT CCA TCA TG, 115-1c GCA GCA CTT GAA ATC ATG GT, 115-2c GCA GCC CTA GAA ATC ATG GT, 115-3 GAG TCC TTA GCA ATC ATG TG (Medici et al., 2005)
           • Reverse: revSR46d CCA GTG GGC GAT GGA ATT CCA, revSR48d CCA GTG ATT TAT GCT GTT CAC, revSR50d CCA GTG GTT TAT ACT GTT CAC, revSR52d CCA ATG GTT TAT ACT GTT CAC (Medici et al., 2005)
           • Product
             • Size: 174 or 176 bp
             • Product source: Norwalk virus
   2. RT PCR for NLV and SLV:
      1. Time to Perform: 1-hour-to-1-day
      2. Description: A primer pair (p289/290) based on the RNA polymerase sequence of 25 prototype and currently circulating strains of human caliciviruses (HuCVs) was designed for the detection of both Norwalk-like caliciviruses (NLVs) and Sapporo-like caliciviruses (SLVs) by reverse transcription-polymerase chain reaction (RT-PCR). This primer pair produces RT-PCR products of 319 bp for NLVs and 331 bp for SLVs. The usefulness of this primer pair was shown by its detection of prototype NLVs (Norwalk, Snow Mountain, Hawaii and Mexico viruses) and SLVs (Sapporo/82, Hou/86, Hou/90 and Lon/92) and currently circulating strains of NLVs and SLVs in children and adults. This primer pair also detected more viruses in either NLV or SLV genera than previously designed primers. This primer pair is useful for broad detection of HuCVs for clinical and epidemiologic studies as well as for environmental monitoring (Jiang et al., 1999).
      3. Primers:
         • P289 and P290
           • Forward: 289 5' TGACAATGTAATCATCACCATA 3' (Jiang et al., 1999)
           • Reverse: 290 5'GATTACTCCAAGTGGGACTCCAC 3' (Jiang et al., 1999)
           • Product
             • Size: 319 bp for NLV and 331 bp for SLV
             • Product source: Norwalk virus
      4. False Negative: In the stool specimens from the UK, three specimens containing SRSVs and 4 specimens containing typical CV were negative by p289/290. Several possibilities could cause these negative results. First, these specimens may contain inhibitors. Second, the stool specimens originally were tested for HuCVs by EM in the UK, where they were kept at 4 C at least for 4 years prior to testing and were frozen and thawed two to three times since being in Virginia. Viral RNA might have degraded in those conditions. Finally, these specimens could contain HuCV strains as yet uncharacterized that are not detected by the new primers. This possibility needs to be tested in the future (Jiang et al., 1999).
   3. Reverse transcription PCR:
      1. Time to Perform: 1-hour-to-1-day
      2. Description: Up to the present, TEM is accepted as a 'gold standard' for the diagnosis of NV, but because newer methods are available, the results obtained by each method have to be discussed in context with the other results, i.e. a positive result in any two of the three tests used in this study (TEM, PCR and ELISA) should be defined as 'new gold standard'. Alternatively PCR, presumably the most sensitive method, could be used as 'gold standard' (Rabenau et al., 2003). Reverse transcription PCR was done as described by Schreier et al. with some modifications. Briefly, 200 ul stool samples were dissolved in 1 ml 0.9% NaCl and centrifuged at 3,000 g for 3 min. RNA was extracted from 200 ul of supernatant using the QIAamp viral RNA kit (Qiagen, Hilden,Germany) according to he manufacturer's instructions with an elution volume of 50 ul. The Qiagen OneStep RT-PCR kit (Qiagen) was used with 20 ul of RNA in a final volume of 50 ul for reverse transcription and first round PCR employing outer primers 32 (5 )-ATg AAT ATg AAT gAA gAT gg-3 )) and 36 (5 )-ATT ggT CCT TCT gTT TTg TC-3 )) located in the ORF1 region. The following amplification protocol was performed: 50 C for 30 min, 95 C for 15 min, followed by 40 cycles at 94 C for 30 s, 42 C for 30 s, and 72 C for 45 s. The reaction was terminated by a final elongation step at 72 C for 5 min. Second round PCR was performed using the Taq PCR Master Mix kit (Qiagen) with 5 ul of the inner PCR product in a final volume of 50 ul employing inner primers 33 (5 )-TAC CAC TAT gAT gCA gAT TA-3 )) and 35 (5 )-gTT gAC ACA ATC TCA TCA TC-3 )). Amplification was performed as follows: 94 C for 5 min followed by the same cycling protocol as described above (Rabenau et al., 2003).
      3. Primers:
         • First round primers 32 and 36
           • Forward: 32 (5 )-ATg AAT ATg AAT gAA gAT gg-3 ) (Rabenau et al., 2003)
           • Reverse: 36 (5 )-ATT ggT CCT TCT gTT TTg TC-3 ) (Rabenau et al., 2003)
         • Second round primers 33 and 35
           • Forward: 33 (5 )-TAC CAC TAT gAT gCA gAT TA-3 ) (Rabenau et al., 2003)
           • Reverse: 35 (5 )-gTT gAC ACA ATC TCA TCA TC-3 ) (Rabenau et al., 2003)
   4. Multiplex real-time reverse transcription-PCR assay:
      1. Time to Perform: 1-hour-to-1-day
      2. Description: Wolf et al., developed a triplex real-time reverse transcription-PCR (RT-PCR)-based method that detects and distinguishes between noroviruses belonging to genogroups I, II, and III and that targets the junction between the regions of open reading frame 1 (ORF1) and ORF2. This is the first assay to include all three genogroups and the first real-time RT-PCR-based method developed for the detection of bovine noroviruses. The assay was shown to be broadly reactive against a wide spectrum of norovirus genotypes, including GI/1 through GI/7, GII/1 through GII/8, GII/10, GII/12, and GII/17, in different matrices (including fecal specimens, treated and raw sewage, source water, and treated drinking water). The assay is highly sensitive, detecting low copy numbers of plasmids that carry the target sequence. A new bovine norovirus, Bo/NLV/Norsewood/2006/NZL, was identified by this assay and was further genetically characterized. The results implicate a broad range of possible applications, including clinical diagnostics, tracing of fecal contaminants, and due to its sensitivity and broad reactivity, environmental studies (Something--Wrong).
      3. Primers:
         • SW GI/IIa and SW GI
           • Forward: SW GI/IIa: (5'-ATGTTYAGRTGGATGAGRTTYT-3') [5285?5306]a (Something--Wrong)
           • Reverse: SW GI: (5'-CTTAGACGCCATCATCATTYAC-3') [5354?5375]a (Something--Wrong)
           • Product
           • SW GI/IIa and SW GII
             • Forward: SW GI/IIa: (5'-ATGTTYAGRTGGATGAGRTTYT-3') [5285?5306]a (Something--Wrong)
             • Reverse: SW GII: (5'-TMGAYGCCATCWTCATTCAC-3') [5081?5100]b (Something--Wrong)
             • Product
             • SW GI/IIb and SW GII
               • Forward: SW GI/IIb: 5'-ATGTTCCGYTGGATGCGVTT-3') [5285?5304]a (Something--Wrong)
               • Reverse: SW GII: (5'-TMGAYGCCATCWTCATTCAC-3') [5081?5100]b (Something--Wrong)
               • Product
               • SW GIII and SW GIII
                 • Forward: SW GIII: (5'-CGCTCCATGTTYGCBTGG-3') [4973?4990]c (Something--Wrong)
                 • Reverse: SW GIII: (5'-TCAGTCATCTTCATTTACAAAATC-3') [5041?5064]c (Something--Wrong)
                 • Product
   
   
4. Other Types of Diagnostic Tests:
   
   No other tests available here.
   
   

V. References

A. Journal References:

Akihara et al., 2005: Akihara S, Phan TG, Nguyen TA, Yagyu F, Okitsu S, Muller WE, Ushijima H. Identification of sapovirus infection among Japanese infants in a day care center. J Med Virol. 2005; 77(4): 595 - 601. [PubMed: 16254963].

Albers, 2004: Albers MK An unwanted visitor. Aggressive infection control strategies are needed to shorten the hospital visit of the easily spread norovirus. Can Nurse. 2004; 100(9): 21 - 26. [PubMed: 15623009].

Belliot et al., 2003: Belliot G, Sosnovtsev SV, Mitra T, Hammer C, Garfield M, Green KY. In vitro proteolytic processing of the MD145 norovirus ORF1 nonstructural polyprotein yields stable precursors and products similar to those detected in calicivirus-infected cells. J Virol. 2003; 77(20): 10957 - 10974. [PubMed: 14512545].

Berg et al., 2000: Berg DE, Kohn MA, Farley TA, McFarland LM. Multi-state outbreaks of acute gastroenteritis traced to fecal-contaminated oysters harvested in Louisiana. J Infect Dis. 2000; 181(Suppl 2): S381 - S386. [PubMed: 10804152].

Bon et al., 2002: Bon F, Ambert-Balay K, Giraudon H, Kaplon J, Le Guyader S, Pommepuy M, Gallay A, Vaillant V, de Valk H, Chikhi-Brachet R, Flahaut A, Pothier P, Kohli E. Molecular epidemiology of caliciviruses detected in sporadic and outbreak cases of gastroenteritis in France from December 1998 to February 2004. J Clin Microbiol. 2005; 43(9): 4659 - 4664. [PubMed: 16145123].

Cauchi et al., 1996: Cauchi MR, Doultree JC, Marshall JA, Wright PJ. Molecular characterization of Camberwell virus and sequence variation in ORF3 of small round-structured (Norwalk-like) viruses. J Med Virol. 1996; 49(1): 70 - 76. [PubMed: 8732863].

CDC, 2002: Norovirus activity--United States, 2002. MMWR Morb Mortal Wkly Rep. 2002; 52(3): 41 - 45. [PubMed: 12570319].

CDC, 2005: Norovirus outbreak among evacuees from hurricane Katrina--Houston, Texas, September 2005. MMWR Morb Mortal Wkly Rep. 2005; 54(40): 1016 - 1018. [PubMed: 16224449].

Cheng et al., 2002: Cheng PK, Wong DK, Chung TW, Lim WW. Norovirus contamination found in oysters worldwide. J Med Virol. 2005; 76(4): 593 - 597. [PubMed: 15977231].

Cheng et al., 2005: Cheng PK, Wong DK, Chung TW, Lim WW. Norovirus contamination found in oysters worldwide. J Med Virol. 2005; 76(4): 593 - 597. [PubMed: 15977231].

Clark and Lambden, 2002: Clark IN, Lambden PR. The molecular biology of human caliciviruses. Novartis Found Symp. 2001; 238(): 180 - 191. [PubMed: 11444026].

Clark and McKendrick, 2005: Clark B, McKendrick M. A review of viral gastroenteritis. Curr Opin Infect Dis. 2004; 17(5): 461 - 469. [PubMed: 15353966].

Cooper and Blamey., 2005: Cooper E, Blamey S. A norovirus gastroenteritis epidemic in a long-term-care facility. Infect Control Hosp Epidemiol. 2005; 26(3): 256 - 258. [PubMed: 15796276].

Dastjerdi et al., 1999: Dastjerdi AM, Green J, Gallimore CI, Brown DW, Bridger JC. The bovine Newbury agent-2 is genetically more closely related to human SRSVs than to animal caliciviruses. Virology. 1999; 254(1): 1 - 5. [PubMed: 9927568].

Dastjerdi et al., 2000: Dastjerdi AM, Snodgrass DR, Bridger JC. Characterisation of the bovine enteric calici-like virus, Newbury agent 1. FEMS Microbiol Lett. 2000; 192(1): 125 - 131. [PubMed: 11040440].

Dingle et al., 1995: Dingle KE, Lambden PR, Caul EO, Clarke IN. Human enteric Caliciviridae: the complete genome sequence and expression of virus-like particles from a genetic group II small round structured virus. J Gen Virol. 1995; 76(Pt 9): 2349 - 2355. [PubMed: 7561776].

Duzier et al., 2004: Duzier E, van Duynhoven Y, Vennema H, Koopmans M. Failure to detect norovirus in a large group of asymptomatic individuals by Marshall et al. (Public Health Vol 118 (3) 230-233). Public Health. 2004; 118(6): 455 - 456. [PubMed: 15313600].

Fankhauser et al., 2002: Fankhauser RL, Monroe SS, Noel JS, Humphrey CD, Bresee JS, Parashar UD, Ando T, Glass RI. Epidemiologic and molecular trends of "Norwalk-like viruses" associated with outbreaks of gastroenteritis in the United States. J Infect Dis. 2002; 186(1): 1 - 7. [PubMed: 12089655].

Farkas et al., 2005: Farkas T, Nakajima S, Sugieda M, Deng X, Zhong W, Jiang X. Seroprevalence of noroviruses in swine. J Clin Microbiol. 2005; 43(2): 657 - 661. [PubMed: 15695660].

Friedman et al., 2005: Friedman DS, Heisey-Grove D, Argyros F, Berl E, Nsubuga J, Stiles T, Fontana J, Beard RS, Monroe S, McGrath ME, Sutherby H, Dicker RC, Demaria A, Matyas BT. An outbreak of norovirus gastroenteritis associated with wedding cakes. Epidemiol Infect. 2005; 133(6): 1057 - 1063. [PubMed: 16274502].

Froggatt et al., 2004: Froggatt PC, Barry Vipond I, Ashley CR, Lambden PR, Clarke IN, Caul EO. Surveillance of norovirus infection in a study of sporadic childhood gastroenteritis in South West England and South Wales, during one winter season (1999-2000). J Med Virol. 2004; 72(2): 307 - 311. [PubMed: 14695675].

Glass et al., 2000: Glass RI, Noel J, Ando T, Fankhauser R, Belliot G, Mounts A, Parashar UD, Bresee JS, Monroe SS. The epidemiology of enteric caliciviruses from humans: a reassessment using new diagnostics. J Infect Dis. 2000; 181(Suppl 2): S254 - S261. [PubMed: 10804134].

Green et al., 1997: Green KY, Kapikian AZ, Valdesuso J, Sosnovtsev S, Treanor JJ, Lew JF. Expression and self-assembly of recombinant capsid protein from the antigenically distinct Hawaii human calicivirus. J Clin Microbiol. 1997; 35(7): 1909 - 1914. [PubMed: 9196224].

Han et al., 2004: Han MG, Smiley JR, Thomas C, Saif LJ. Genetic recombination between two genotypes of genogroup III bovine noroviruses (BoNVs) and capsid sequence diversity among BoNVs and Nebraska-like bovine enteric caliciviruses. J Clin Microbiol. 2004; 42(11): 5214 - 5224. [PubMed: 15528717].

Hansman et al., 2004: Hansman GS, Doan LT, Kguyen TA, Okitsu S, Katayama K, Ogawa S, Natori K, Takeda N, Kato Y, Nishio O, Noda M, Ushijima H. Detection of norovirus and sapovirus infection among children with gastroenteritis in Ho Chi Minh City, Vietnam. Arch Virol. 2004; 149(9): 1673 - 1688. [PubMed: 15593412].

Jiang et al., 1999: Jiang X, Huang PW, Zhong WM, Farkas T, Cubitt DW, Matson DO. Design and evaluation of a primer pair that detects both Norwalk- and Sapporo-like caliciviruses by RT-PCR. J Virol Methods. 1999; 83(1-2): 145 - 154. [PubMed: 10598092].

Kageyama et al., 2003: Kageyama T, Kojima S, Shinohara M, Uchida K, Fukushi S, Hoshino FB, Takeda N, Katayama K. Broadly reactive and highly sensitive assay for Norwalk-like viruses based on real-time quantitative reverse transcription-PCR. J Clin Microbiol. 2003; 41(4): 1548 - 1557. [PubMed: 12682144].

Katayama et al., 2002: Katayama K, Shirato-Horikoshi H, Kojima S, Kageyama T, Oka T, Hoshino F, Fukushi S, Shinohara M, Uchida K, Suzuki Y, Gojobori T, Takeda N. Phylogenetic analysis of the complete genome of 18 Norwalk-like viruses. Virology. 2002; 299(2): 225 - 239. [PubMed: 12202225].

Kurokawa et al., 2004: Kurokawa M, Ono K, Ishiyama S, Rai SK. Evaluation of rapid diagnostic methods for pediatric viral diarrhea using samples collected in Nepal and Japan. Nepal Med Coll J. 2004; 6(2): 78 - 82. [PubMed: 16295734].

Lew et al., 1994: Lew JF, Kapikian AZ, Valdesuso J, Green KY. Molecular characterization of Hawaii virus and other Norwalk-like viruses: evidence for genetic polymorphism among human caliciviruses. J Infect Dis. 1994; 170(3): 535 - 542. [PubMed: 8077710].

Lew et al., 1994: Lew JF, Petric M, Kapikian AZ, Jiang X, Estes MK, Green KY. Identification of minireovirus as a Norwalk-like virus in pediatric patients with gastroenteritis. J Virol. 1994; 68(5): 3391 - 3396. [PubMed: 8151799].

Lindell et al., 2005: Lindell AT, Grillner L, Svensson L, Wirgart BZ. Molecular epidemiology of norovirus infections in Stockholm, Sweden, during the years 2000 to 2003: association of the GGIIb genetic cluster with infection in children. J Clin Microbiol. 2005; 43(3): 1086 - 1092. [PubMed: 15750066].

Lochridge and Hardy, 2003: Lochridge VP, VP, Hardy ME. Snow Mountain virus genome sequence and virus-like particle assembly. Virus Genes. 2003; 26(1): 71 - 82. [PubMed: 12680695].

Marks et al., 2003: Marks PJ, Vipond IB, Regan FM, Wedgwood K, Fey RE, Caul EO. A school outbreak of Norwalk-like virus: evidence for airborne transmission. Epidemiol Infect. 2003; 131(1): 727 - 736. [PubMed: 12948373].

Marshall et al., 2002: Marshall JA, Hellard ME, Sinclair MI, Fairley CK, Cox BJ, Catton MG, Kelly H, Wright PJ. Failure to detect norovirus in a large group of asymptomatic individuals. Public Health. 2004; 118(3): 230 - 233. [PubMed: 15003413].

Medici et al., 2005: Medici MC, Martinelli M, Ruggeri FM, Abelli LA, Bosco S, Arcangeletti MC, Pinardi F, De Conto F, Calderaro A, Chezzi C, Dettori G. Broadly reactive nested reverse transcription-PCR using an internal RNA standard control for detection of noroviruses in stool samples. J Clin Microbiol. 2005; 43(8): 3772 - 3778. [PubMed: 16081909].

Moe et al., 2004: Moe CL, Sair A, Lindesmith L, Estes MK, Jaykus LA. Diagnosis of norwalk virus infection by indirect enzyme immunoassay detection of salivary antibodies to recombinant norwalk virus antigen. Clin Diagn Lab Immunol. 2004; 11(6): 1028 - 1034. [PubMed: 15539501].

Monroe et al., 1993: Monroe SS, Stine SE, Jiang X, Estes MK, Glass RI. Detection of antibody to recombinant Norwalk virus antigen in specimens from outbreaks of gastroenteritis. J Clin Microbiol. 1993; 31(11): 2866 - 2872. [PubMed: 8263169].

Noel et al., 1999: Noel JS, Fankhauser RL, Ando T, Monroe SS, Glass RI. Identification of a distinct common strain of "Norwalk-like viruses" having a global distribution. J Infect Dis. 1999; 179(6): 1334 - 1344. [PubMed: 10228052].

Oliver et al., 2003: Oliver SL, Dastjerdi AM, Wong S, El-Attar L, Gallimore C, Brown DW, Green J, Bridger JC. Molecular characterization of bovine enteric caliciviruses: a distinct third genogroup of noroviruses (Norwalk-like viruses) unlikely to be of risk to humans. J Virol. 2003; 77(4): 2789 - 2798. [PubMed: 12552024].

Parashar et al., 2001: Parashar U, Parashar U, Quiroz ES, Mounts AW, Monroe SS, Fankhauser RL, Ando T, Noel JS, Bulens SN, Beard SR, Li JF, Bresee JS, Glass RI. "Norwalk-like viruses". Public health consequences and outbreak management. MMWR Recomm Rep. 2001; 50(RR-9): 1 - 17. [PubMed: 15580799].

Poel et al., 2000: van Der Poel WH, Vinje J, van Der Heide R, Herrera MI, Vivo A, Koopmans MP. Norwalk-like calicivirus genes in farm animals. Emerg Infect Dis. 2000; 6(1): 36 - 41. [PubMed: 10653567].

Rabenau et al., 2003: Rabenau HF, Sturmer M, Buxbaum S, Walczok A, Preiser W, Doerr HW. Laboratory diagnosis of norovirus: which method is the best?. Laboratory diagnosis of norovirus: which method is the best?. 2003; 46(4): 232 - 238. [PubMed: 12931032].

Radford et al., 2004: Radford AD, Gaskell RM, Hart CA. Human norovirus infection and the lessons from animal caliciviruses. Curr Opin Infect Dis. 2004; 17(5): 471 - 478. [PubMed: 15353967].

Schaub and Oshiro, 2000: Schaub SA, Oshiro RK. Public health concerns about caliciviruses as waterborne contaminants. J Infect Dis. 2000; 181(): S374 - S380. [PubMed: 10804151].

Smiley et al., 2003: Smiley JR, Hoet AE, Traven M, Tsunemitsu H, Saif LJ. Reverse transcription-PCR assays for detection of bovine enteric caliciviruses (BEC) and analysis of the genetic relationships among BEC and human caliciviruses. J Clin Microbiol. 2003; 41(7): 3089 - 3099. [PubMed: 12843048].

Someya et al., 2002: Someya Y, Takeda N, Miyamura T. Identification of active-site amino acid residues in the Chiba virus 3C-like protease. J Virol. 2002; 76(12): 5949 - 5958. [PubMed: 12021327].

Subekti et al., 2002: Subekti DS, Tjaniadi P, Lesmana M, McArdle J, Iskandriati D, Budiarsa IN, Walujo P, Suparto IH, Winoto I, Campbell JR, Porter KR, Sajuthi D, Ansari AA, Oyofo BA. Experimental infection of Macaca nemestrina with a Toronto Norwalk-like virus of epidemic viral gastroenteritis. J Med Virol. 2002; 66(3): 400 - 406. [PubMed: 11793394].

Taylor et al., 1993: Taylor MB, Schildhauer CI, Parker S, Grabow WO, Xi J, Estes MK, Cubitt WD. Two successive outbreaks of SRSV-associated gastroenteritis in South Africa. J Med Virol. 1993; 41(1): 18 - 23. [PubMed: 8228932].

van der Poel et al., 2003: van der Poel WH, van der Heide R, Verschoor F, Gelderblom H, Vinje J, Koopmans MP. Epidemiology of Norwalk-like virus infections in cattle in The Netherlands. Vet Microbiol. 2003; 92(4): 297 - 309. [PubMed: 12554100].

Vidal et al., 2005: Vidal R, Solari V, Mamani N, Jiang X, Vollaire J, Roessler P, Prado V, Matson DO, O'Ryan ML. Caliciviruses and foodborne gastroenteritis, Chile. Emerg Infect Dis. 2005; 11(7): 1134 - 1137. [PubMed: 16022799].

Vinje et al., 2000: Vinje J, Green J, Lewis DC, Gallimore CI, Brown DW, Koopmans MP. Genetic polymorphism across regions of the three open reading frames of "Norwalk-like viruses". Arch Virol. 2000; 145(2): 223 - 241. [PubMed: 10752550].

Wobus et al., 2005: Wobus CE, Karst SM, Thackray LB, Chang KO, Sosnovtsev SV, Belliot G, Krug A, Mackenzie JM, Green KY, Virgin HW. Replication of Norovirus in cell culture reveals a tropism for dendritic cells and macrophages. PLoS Biol. 2005; 2(12): 2076 - 2084. [PubMed: 15562321].

Wolf et al., 2007: Wolf S, Williamson WM, Hewitt J, Rivera-Aban M, Lin S, Ball A, Scholes P, Greening GE. Sensitive multiplex real-time reverse transcription-PCR assay for the detection of human and animal noroviruses in clinical and environmental samples.. Appl Environ Microbiol.. 2007; 73(17): 5464 - 5470. [PubMed: 17616614].

Wright et al., 1998: Wright PJ, Gunesekere IC, Doultree JC, Marshall JA. Small round-structured (Norwalk-like) viruses and classical human caliciviruses in southeastern Australia, 1980-1996. J Med Virol. 1998; 55(4): 312 - 320. [PubMed: 9661841].

B. Book References:

Green et al., 2001: Green KY, Chanock RM, Kapikian AZ Human Caliciviruses. 841 - 874. In: Knipe DM, Howley PM Fields Virology2001. Lippincott Williams and Wilkins, Philadelphia Pa.

Green et al., 2007: Green Kim Y Caliciviridae: The Noroviruses. 950 - 979. In: Knipe David M, Howley Peter M. Fields Virology 5th Edition 2007. Lippincott Williams & Wilkins, Philadelphia . Baltimore . New York . London . Buenos Aires . Hong Kong . Sydney . Tokyo.

C. Website References:

NCBI Taxonomy: Norwalk virus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=11983&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Camberwell virus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=94433&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Chiba virus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=99565&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Hawaii calicivirus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=33750&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Maryland calicivirus 1 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=33751&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Norovirus genogroup 1 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=122928&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Norovirus genogroup 2 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=122929&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Norovirus genogroup 4 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=262897&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Norovirus isolates [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=150080&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Norwalk-like virus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=95340&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Small round structured virus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=37141&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Human norovirus Saitama [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=233890&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Maryland calicivirus 6 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=33752&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Minireovirus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=194422&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Bovine enteric calici-like virus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=88294&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Bovine enteric calicivirus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=206156&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Genome: Norwalk virus, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi??db=nucleotide&val=NC_001959 ].

NCBI Genome: Norovirus Hu/GI/Otofuke/1979/JP genomic RNA, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=74038598 ].

NCBI Genome: Lordsdale virus complete genome [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=1008952 ].

NCBI Genome: Norwalk-like virus genomic RNA, complete genome, specimen_voucher:Gifu'96 [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=38229107 ].

NCBI Genome: Norwalk virus strain Vietnam 026, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=47175550 ].

NCBI Genome: Norovirus Hu/NLV/GII/Neustrelitz260/2000/DE from Germany, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=54694862 ].

NCBI Genome: Norovirus Hu/NLV/Dresden174/pUS-NorII/1997/GE, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=53854911 ].

NCBI Genome: Norovirus Hu/NLV/Oxford/B2S16/2002/UK, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=46519751 ].

NCBI Genome: Norovirus Hu/NLV/Oxford/B4S1/2002/UK, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=46519747 ].

NCBI Genome: Norovirus Hu/NLV/Oxford/B4S7/2002/UK, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=46519743 ].

NCBI Genome: Norovirus Hu/NLV/Oxford/B4S4/2002/UK, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=46519739 ].

NCBI Genome: Norovirus Hu/NLV/Oxford/B4S6/2002/UK, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=46519735 ].

NCBI Genome: Norovirus Hu/NLV/Oxford/B4S5/2002/UK, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=46519731 ].

NCBI Genome: Norovirus Hu/NLV/Oxford/B4S2/2002/UK, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=46519727 ].

NCBI Genome: Human calicivirus Hu/NLV/Oxford/B5S22/2003/UK, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=46360469 ].

NCBI Genome: Snow Mountain virus, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=27762117 ].

NCBI Genome: Human calicivirus strain Mc37, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=44829133 ].

NCBI Genome: Human calicivirus NLV/GII/Langen1061/2002/DE, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=39980428 ].

NCBI Genome: Norwalk-like virus genomic RNA, complete genome, strain:WUG1 [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=22773824 ].

NCBI Genome: Norwalk-like virus genomic RNA, complete genome, isolate:Saitama U201 [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=22773816 ].

NCBI Genome: Norwalk-like virus genomic RNA, complete genome, isolate:Saitama U18 [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=22773812 ].

NCBI Genome: Norwalk-like virus genomic RNA, complete genome, isolate:Saitama U25 [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=22773808 ].

NCBI Genome: Norwalk-like virus genomic RNA, complete genome, isolate:Saitama U17 [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=22773804 ].

NCBI Genome: Norwalk-like virus genomic RNA, complete genome, isolate:Saitama U16 [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=22773800 ].

NCBI Genome: Norwalk-like virus genomic RNA, complete genome, isolate:Saitama U4 [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=22773796 ].

NCBI Genome: Norwalk-like virus genomic RNA, complete genome, isolate:Saitama U3 [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=22773792 ].

NCBI Genome: Norwalk-like virus genomic RNA, complete genome, isolate:Saitama U1 [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=22773788 ].

NCBI Genome: Norwalk-like virus genomic RNA, complete genome, isolate:SzUG1 [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=22773784 ].

NCBI Genome: Human calicivirus Hu/NLV/GII/MD145-12/1987/US, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=18025351 ].

NCBI Genome: Chiba virus genomic RNA, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=11275371 ].

NCBI Taxonomy: Homo sapiens [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9606&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Sus scrofa [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9823&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Bos taurus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9913&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

D. Thesis References:

No thesis or dissertation references used.

VI. Curation Information

• Curators: Rebecca Wattam (wattam@vbi.vt.edu)
• Date: 11-25-2005
• Version: 0.83
• Note:
• Contact information:
  • Email: pathinfo@vbi.vt.edu