Francisella tularensis

I. Organism Information

A. Taxonomy Information
  1. Species:
    1. Francisella tularensis :
      1. Ontology: UMLS:C0016677
      2. GenBank Taxonomy No.: 263
      3. Description: Tularemia, also known as rabbit fever or deer-fly fever, is a zoonotic disease caused by the gram-negative intracellular pathogen Francisella tularensis (Farlow et al., 2005). Francisella is the only genus within the family Francisellaceae and, on the basis of small subunit RNA sequences, is a member of the gamma-subclass of proteobacteria . The organism most closely related to Francisella is Wolbachia persica, a tick endosymbiont. As defined by DNA similarity and fatty acid composition, there are two species within the Francisella genus: tularensis and philomiragia. In addition, there are five subspecies of F. tularensis: tularensis (also called F. tularensis type A), novicida, mediasiatica, holarctica (F. tularensis type B), and a variant of holarctica found in Japan. Of these, only F. tularensis subsp. tularensis and subsp. holarctica cause disease in humans; and highly virulent type A organisms are evolutionarily older than moderately virulent type B bacteria (McLendon et al., 2006). This bacterium was first identified in 1912 following reports of a plaguelike illness in ground squirrels in Tulare County, California. One of the most pathogenic microorganisms known, F. tularensis is currently listed as a category A select agent because of its potential as a bioterrorism agent (Farlow et al., 2005). F. tularensis has been classified into four distinct subspecies, tularensis, holarctica, mediasiatica, and novicida. Of the four subspecies, subsp. tularensis, also known as Type A, has the highest mortality rate. Infections due to Type A have been limited to North America. In comparison, F. tularensis subsp. holarctica, also known as Type B, has been documented throughout the Northern Hemisphere. Thus, in North America, both Type A and Type B are present and often over-lap within a given sub-region. The subsp. novicida and mediasiatica have more focal distributions with mediasiatica isolated only from the Central Asian regions of the former USSR, and novicida isolated from North America and more recently Australia. These two subspecies are infrequently associated with human disease (Petersen and Schriefer, 2005).
    2. Francisella tularensis subsp. holarctica :
      1. Ontology: UMLS:C0445899
      2. GenBank Taxonomy No.: 119857
      3. Description: F. tularensis subsp. holarctica (previously palaearctica), the type B biovar, is less virulent and is the most widely distributed subspecies recovered from human and animal cases in North America, Europe and Central and Far-East Asia (Whipp et al., 2003). F. tularensis subsp. holarctica strains produce milder disease symptoms in humans (Green et al., 2005).
      4. Variant(s):
        • Francisella tularensis subsp. holarctica FSC200 :
          • GenBank Taxonomy No.: 351581
          • Parent: Francisella tularensis subsp. holarctica
          • Description: Francisella tularensis subsp. holarctica strain FSC200. This strain was isolated from a patient with type B tularemia. The genome sequencing of Francisella tularensis subsp. holarctica FSC200 is in progress at University of Washington (Project ID: 16087) (NCBI Genome)
        • Francisella tularensis subsp. holarctica LVS :
          • GenBank Taxonomy No.: 376619
          • Parent: Francisella tularensis subsp. holarctica
          • Description: An attenuated live vaccine strain (LVS) was derived from repeated passage of a type B strain sometime between the 1930s and 1950s in the former Soviet Union. LVS provides protection against both type A and type B infection but is not licensed for use in the United States because its immunogenicity in humans is poorly characterized, the mechanism of attenuation for this strain is unknown, and the strain kills mice with a 50% lethal dose of <10 CFU when it is introduced via intraperitoneal injection (Petrosino et al., 2006).
    3. Francisella tularensis subsp. mediasiatica; Francisella tularensis var. mediasiatica :
      1. Ontology: UMLS:C0445900
      2. GenBank Taxonomy No.: 135248
      3. Description: F. tularensis subsp. mediasiatica has only been recovered sporadically from ticks and animals in prescribed regions of Central Asia, without any human disease association (Whipp et al., 2003).
    4. Francisella tularensis subsp. novicida :
      1. GenBank Taxonomy No.: 264
      2. Description: F. tularensis subsp. novicida was first recovered from water in Utah, USA, in 1951 (Utah 112 prototype strain). Subsequently, isolates recovered from four hospitalized patients, first identified as atypical F. tularensis, were classified as 'F. tularensis subsp. novicida' or, more conservatively, as novicida-like organisms. These patients recovered from their infections with comparatively milder disease than type A infections (Whipp et al., 2003). Francisella tularensis subsp. novicida is nonvirulent, however this organism may cause disease in immunocompromised individuals (NCBI Genome).
    5. Francisella tularensis subsp. tularensis :
      1. Ontology: UMLS:C0445901
      2. GenBank Taxonomy No.: 119856
      3. Description: F. tularensis subsp. tularensis, also known as the type A biovar, causes the most severe form of tularemia and is limited in its distribution to North America (Whipp et al., 2003). Until recently, isolates of F. tularensis subsp. tularensis were isolated only in North America, but a mite-derived isolate from Slovakia showed the phenotypic characteristics of the subspecies (Johansson et al., 2000 (b)). Type A isolates have been recovered from arthropod vectors in Europe but have not been associated with human disease there (Whipp et al., 2003).
      4. Variant(s):
        • Francisella tularensis subsp. tularensis SCHU S4 :
          • GenBank Taxonomy No.: 177416
          • Parent: Francisella tularensis subsp. tularensis
          • Description: Originally isolated by Foshay in 1941 from a human ulcer (Eigelsbach et al., 1951). F. tularensis subspecies tularensis strain SCHU S4 is a fully virulent human isolate (Larsson et al., 2005). Among the biotypes of F. tularensis that are recognised, subspecies (subsp.) tularensis strains, e.g. F. tularensis SchuS4, are one of the most infective agents for humans known, with an infectious dose by the aerosol route of approximately 20 colony forming units (cfu) and a mortality rate of 30% in untreated cases (Green et al., 2005).
B. Lifecycle Information :
  1. Bacilli :
    1. Size: 0.2 um x 0.2-0.7 um (Dennis et al., 2001).
    2. Shape: Pleomorphic, poorly staining, gram-negative coccobacillus (Dennis et al., 2001)

  2. Description: Two disease cycles, terrestrial and aquatic, have been described. In the terrestrial cycle, rabbits and hares typically serve as amplifying hosts and ticks or biting flies are arthropod vectors. In the aquatic cycle, beaver, muskrat and voles serve as important mammalian hosts and appear to shed live organisms into their environments. In Sweden, mosquitoes have been strongly implicated as vectors of tularemia and may acquire infection from other components of the aquatic cycle. Curiously, mosquitoes are not thought to be significant contributors to disease transmission in the United States, despite their sharing of the same environments as other components of the aquatic system. Recently, protozoa have been shown to harbor F. tularensis and may play an important role in aquatic cycles. The interaction between aquatic and terrestrial cycles is largely unknown (Petersen and Schriefer, 2005).
C. Genome Summary:
  1. Genome of Francisella tularensis subsp. holarctica OSU18
    1. Chromosome:
      1. GenBank Accession Number: NC_008369
      2. Size: 1,895,727 bp (NCBI Genome)
      3. Gene Count: 1932 (NCBI Genome)
      4. Description: The complete genome sequence and annotation for a low-passage type B strain (OSU18) isolated from a dead beaver found near Red Rock, Okla., in 1978. A comparison of the F. tularensis subsp. holarctica sequence with that of F. tularensis subsp. tularensis strain Schu4 highlighted genetic differences that may underlie different pathogenicity phenotypes and the evolutionary relationship between type A and type B strains. Despite extensive DNA sequence identity, the most significant difference between type A and type B isolates is the striking amount of genomic rearrangement that exists between the strains. All but two rearrangements can be attributed to homologous recombination occurring between two prominent insertion elements, ISFtu1 and ISFtu2. Numerous pseudogenes have been found in the genomes and are likely contributors to the difference in virulence between the strains. In contrast, no rearrangements have been observed between the OSU18 genome and the genome of the type B live vaccine strain (LVS), and only 448 polymorphisms have been found within non-transposase-coding sequences whose homologs are intact in OSU18 (Petrosino et al., 2006).

  2. Genome of Francisella tularensis subsp. novicida
    1. Plasmid:
      1. GenBank Accession Number: NC_004952
      2. Size: 3990 bp (NCBI Genome)
      3. Gene Count: 6 (NCBI Genome)
      4. Description: pFNL10, is a 3990-bp cryptic plasmid of Francisella novicida-like F6168. The plasmid was maintained in F. novicida Utah 112 and F. tularensis LVS strains. Pomerantsev and co-workers sequenced the entire plasmid and found six open reading frames (ORFs)-ORF1, ORF2, ORF3, ORF4, ORF5, and ORFm. ORF3, ORF4, ORF5, and ORFm are located on the same strand, designated the plus strand. ORF1 and ORF2 are on the complementary strand. The ORFs appear to be arranged in two operons, one comprising ORF5 and ORF4 and the other ORF1 and ORF2. There exist two distinct promoters similar to the Escherichia coli sigma 70 promoter, one 5' to ORF1-ORF2 operon and the other 5' to ORF5-ORF4 operon. In both promoters the transcriptional start is an adenosine. ORF3 is positioned in tandem with ORF5-ORF4, but has its own transcriptional start, a thymidine. However, sequence analysis revealed no recognizable promoter in physical proximity to ORF3. Sequence analysis revealed transcriptional terminators immediately downstream of the two operons. Experimental results showed that the ORF1-ORF2 terminator is authentic. Two sets of direct repeats, one 31 and the other 13 bp, characteristic of ori are positioned between the two promoters. ORF1 encodes a protein that bears homology to the replication initiation protein RepA of various bacteria, and disruption of this ORF indeed blocked pFNL10 replication. In contrast, ORF2 disruption caused formation of plasmid multimers, suggesting aberrant replication. Analysis also suggests that pFNL10 replicates by the theta mode. The ORF5-ORF4 operon resembles the phd-doc operon of Escherichia coli bacteriophage P1, but the significance of this similarity is unclear (Pomerantsev et al., 2001(b)).

  3. Genome of Francisella tularensis subsp. tularensis FSC 198
    1. Chromosome:
      1. GenBank Accession Number: NC_008245
      2. Size: 1,892,616 bp (NCBI Genome)
      3. Gene Count: 1852 (NCBI Genome)
      4. Description: Chaudhuri, R.R., Ren, C.P., Desmond, L., Vincent, G.A., Silman, N.J., Brehm, J., Elmore, M.J., Hudson, M.J., Forsman, M., Isherwood, K.E., Gurycova, D., Minton, N.P., Titball, R.W., Pallen, M.J. and Vipond, R. The complete genome sequence of the European Francisella tularensis subspecies tularensis isolate FSC 198 suggests that it is derived from the archetypal laboratory strain Schu S4, originally isolated in North America. Unpublished (NCBI Genome).

  4. Genome of Francisella tularensis subsp. tularensis
    1. Chromosome:
      1. GenBank Accession Number: NC_008601
      2. Size: 1,910,031 bp (NCBI Genome)
      3. Gene Count: 1781 genes, 1719 protein coding (NCBI Genome)
      4. Description: Brittnacher,M., Rohmer,L., Zhou,Y., Abmayr,S., D'Argenio,D., Bovee,D., Chang,J., Chen,J., Drees,B., Ernst,R., Fong,C., Forsman,M., Gallagher,L., Gallis,B., Gillett,W., Goodlett,D., Guina,T., Guenthner,D., Haugen,E., Hayden,H., Jacobs,M., Kang,A., Larson Freeman,T., Levy,R., Lim,R., Manoil,C., Olson,M.V., Radey,M., Shaffer,S., Svensson,K., Taylor,G., Wasnick,M., Kaul,R. and Miller,S.I. Unpublished (NCBI Genome).

  5. Genome of Francisella tularensis subsp. holarctica
    1. Chromosome:
      1. GenBank Accession Number: NC_007880
      2. Size: 2019 (NCBI Genome)
      3. Gene Count: 1,895,994 bp (NCBI Genome)
      4. Description: Chain, P., Larimer, F., Land, M., Stilwagen, S., Larsson, P., Bearden, S., Chu, M., Oyston, P., Forsman, M., Andersson, S., Lindler, L., Titball, R. and Garcia, E. Complete genome sequence of Francisella tularensis LVS (Live Vaccine Strain). Unpublished (NCBI Genome).

  6. Genome of Francisella tularensis subsp. tularensis SCHU S4
    1. Chromosome:
      1. GenBank Accession Number: NC_006570
      2. Size: 1892819 bp (NCBI Genome)
      3. Gene Count: 1852 (NCBI Genome)
      4. Description: The genome of the F. tularensis strain SCHU S4 consists of a 1,892,819-bp circular chromosome, with an overall G+C content of 32.9% and 1,804 predicted coding sequences (CDSs; including pseudogenes). The low G+C content is typical of that found in small (0.9-2.0 Mb) bacterial genomes (range 25-40%). The origin of replication (ori) was identified with the aid of the strand specific mutation bias and was flanked by genes also present at this position in other species, such as dnaA and rng. In total, 1,281 genes in F. tularensis SCHU S4 had homologs (E < 1 times 10-10) in one or more gamma-proteobacterial genomes. These were randomly distributed around the genome, with the exception of a duplicated region of 33.9 kb (nucleotides 1,374,371-1,408,281 and 1,767,715-1,801,625), which lacked homologs in 16 other gamma-proteobacterial genomes. In F. tularensis strain LVS, duplication of one of the genes in this region (iglC) has been reported, suggesting that this region is also duplicated in this strain. The origin of the duplicated regions is not clear, because these genes do not show significant sequence homology with any other genes in GenBank. The genes encoding hypothetical proteins in these duplicated regions have a low G+C content (27.5%). But the G+C content of genes in the iglABCD operon and their codon usage are similar to those of other F. tularensis genes. In contrast to the genomic islands of other species, there are no flanking insertion elements or tRNA genes on both sides, although both copies are flanked on one side by rRNA operons and on the other an ISFtu1 element. Mutation of some genes within the duplicated regions can be attenuating; therefore, we believe that these regions are pathogenicity islands (Larsson et al., 2005).

  7. Genome of Francisella tularensis
    1. Plasmid:
      1. GenBank Accession Number: NC_002109
      2. Size: 4442 bp (NCBI Genome)
      3. Gene Count: 4 (NCBI Genome)
      4. Description: pOM1 is a recombinant 4442-bp plasmid that includes the replicon of the Francisella novicida-like strain F6168 cryptic plasmid pFNL10 and the tetracycline resistance gene (tetC) of plasmid pBR328. pOM1 can stably replicate and is maintained in Francisella tularensis biovars tularensis, palaearctica, and palaearctica var. japonica. The replicon of pOM1 includes the ori region and the repA gene. The ori region, located upstream of the repA gene includes two sets of 31- and 13-bp direct repeats (DR), with AT-rich regions preceding each of the DRs. Two putative promoters of the repA gene were found connected with the DR regions. A 40-kDa protein was encoded by the repA gene and found essential for replication. Expression of the tetC gene is regulated by an Escherichia coli sigma 70 -like promoter and is dependent on the F. tularensis strain and its environment (Pomerantsev et al., 2001(a)).

II. Epidemiology Information

Until 1925, it was widely believed that tularemia was a disease with risk limited to the United States. This perception soon changed. Ohara, studying hare disease (Yato-byo) in Japan, recognized the similarity of the disease to tularemia and sent specimens to Edward Francis (USA), who confirmed the presence of F. tularensis. In the USSR (1928), F. tularensis was recognized as the causative agent of "waterrat-trappers' disease", an illness acquired by trappers who skinned water-rats for their pelts. Soon thereafter, tularemia was also reported in Norway (1929), Canada (1930), Sweden (1931) and Austria (1935) (Petersen and Schriefer, 2005). Today, tularemia is recognized as a widely dispersed disease throughout the Northern Hemisphere with foci in certain parts of North America, Europe, and northern Asia. Few, if any, zoonotic diseases have a broader or more complex host distribution and epizootiology. F. tularensis infection has been evidenced in a staggering number of wildlife species including various lagomorphs, rodents, insectivores, carnivores, ungulates, marsupials, birds, amphibians, fish and invertebrates. Arthropods, including ticks, biting flies, and possibly mosquitoes, serve as vectors and potentially, long-term reservoirs. Despite the complexity of the global picture of tularemia, the main components of regional disease cycles are much more narrow, typically involving only one to a few, key mammalian and arthropod species (Petersen and Schriefer, 2005). The worldwide incidence of tularemia is not known, and the disease is probably greatly underrecognized and underreported. In the United States, reported cases have dropped sharply from several thousand per year prior to 1950 to less than 200 per year in the 1990s. Between 1985 and 1992, 1409 cases and 20 deaths were reported in the United States, for a mean of 171 cases per year and a case-fatality rate of 1.4%. Persons in all age groups were affected, but most were children younger than 10 years and adults aged 50 years or older. Of 1298 cases for which information on sex was available, 942 (72.6%) occurred in males, and males outnumbered females in all age groups. Most cases occur in June through September, when arthropod-borne transmission is most common. Cases in winter usually occur among hunters and trappers who handle infected animal carcasses. In the United States, cases are mostly sporadic or occur in small clusters; in Eurasia, waterborne, arthropod-borne, and airborne outbreaks involving hundreds of persons have been reported (Dennis et al., 2001). Risk factors associated with human disease are linked to local disease ecology. For example, in the Western United States, biting fly exposures, tick bites and animal contact are all significant risks factors. In contrast, human cases in the central United States are rarely linked with biting flies and most often associated with tick bites and animal exposure. Similarly, mosquito exposure is an important risk factor in Sweden, whereas tabanid exposure is more strongly linked to cases in Russia (Petersen and Schriefer, 2005).

A. Outbreak Locations:
  1. USA: In the summer of 2000, an outbreak of primary pneumonic tularemia occurred on Martha's Vineyard, Massachusetts. The only previously reported outbreak of pneumonic tularemia in the United States also occurred on the island in 1978. A study of this outbreak of primary pneumonic tularemia implicates lawn mowing and brush cutting as risk factors for this infection (Feldman et al., 2001). Although, Tularemia is a recognized disease of the United States, yet in 2002 it emerged in a rather unusual and unexpected setting. The site of the outbreak was a Texas exotic pet facility where a variety of animal species were housed together and sold to domestic and international distributors. Thousands of wild-caught prairie dogs were supplied to this facility for commercial purposes and in July 2002 a large die-off (approximately 250 prairie dogs) occurred. Type B was isolated from the dead prairie dogs at the Texas facility as well as prairie dogs distributed to the Czech Republic and to a Texas pet shop (Petersen and Schriefer, 2005).
  2. France: Fifteen tularemia cases were identified after a holiday spent at a converted mill in the Vendee region (an endemic area for tularemia) in France, between 9 and 12 August 2004. Twelve of the cases (80%) had the pulmonary form. None of the patients was admitted to hospital. There was a strong association between infection and participation in a dinner at the mill on 4 August. One of the three dogs present in the dining room was serologically positive for F. tularensis (Siret et al., 2006).
  3. Bulgaria: The 1997-2005 tularemia outbreaks in Bulgaria affected 285 people (Kantardjiev et al., 2006). The majority of the patients presented with oropharyngeal tularemia. Less common were the glandular, pulmonary and oculoglandular forms (Christova et al., 2004). Ten strains were isolated from humans, a tick, a hare, and water. Amplified fragment length polymorphism typing of the present isolates and of the strain isolated in 1962 suggests that a new genetic variant caused the outbreak (Kantardjiev et al., 2006).
  4. Finland: In a tularemia epidemic during 1982 in northern Finland, 53 patients showed no peripheral portal of entry for infection or associated lymphadenopathy. Respiratory symptoms were observed in 72% of the patients. 26/38 cases had abnormal chest films. Hilar adenopathy was the most common finding (36%). 50 patients acquired the infection during common farming activities, such as making fresh hay with a hay-cutter, handling dry hay, threshing, etc (Syrjala et al., 1985).
  5. Spain: Although tularemia has been reported throughout much of Europe, it first emerged as a human disease in Spain in 1997-1998, when a large outbreak occurred. A total of 559 cases of tularemia were reported with 519 cases from the community of Castille-Leon in northwestern Spain. A study of 142 patients in this region indicated that 97.2% had previous contact with hares; 83.8% had prepared hare carcasses and 13.3% had handled hare meat. As expected based on contact with infected animals, ulceroglandular tularemia was the most common form of clinical disease observed (87% of patients). In 1998, a second outbreak of tularemia in humans was reported, this time in the central province of Cuenca, a region distant from the outbreak the previous year. Nineteen cases of ulceroglandular tularemia were identified in persons who had contact with crayfish. This outbreak was most unusual in that tularemia had not previously been associated with fishing. Transient contamination of the river and crayfish was implicated as the cause of the outbreak, with most patients incurring crayfish-related scratches, cuts, and abrasions while fishing. A sewage plant, which intermittently discharged water into the river, was linked to the cause of the outbreak (Petersen and Schriefer, 2005).
  6. Kosovo: The first report of tularemia in Kosovo occurred in early 2000, at the end of 10 years of political crisis and warfare in the region, when a cluster of patients was identified with an unusual syndrome of fever, pharyngitis and pronounced cervical lymphadenopathy. Active case-finding and serology testing confirmed 327 cases of tularemia in 21 Kosovo municipalities, with most cases presenting as oropharyngeal tularemia. Ingestion of F. tularensis was suspected as the cause of the outbreak and a follow-up case-control study indicated that the outbreak was food and water related (Petersen and Schriefer, 2005). Epidemiologists believed a runaway population of rats and mice gorging on unharvested crops and contaminating human food and water supplies triggered the outbreak (Vogel, 2003).
  7. Australia: Although F. tularensis has long been considered to cause disease in the Northern Hemisphere, in 2002 F. tularensis subsp. novicida emerged in the Southern Hemisphere with the first report of human infection. A 53-year old man presented with a swollen toe and swollen inguinal lymph nodes as a result of a cut received in brackish waters in the Northern Territory of Australia. The toe wound yielded an isolate of F. tularensis subsp. novicida (Petersen and Schriefer, 2005).
  8. Norway: The outbreak of tularemia in central Norway led to sporadic cases over an area of 42,000 square km, indicating that F. tularensis was widespread. Only a few cases were reported from areas outside of central Norway. In certain areas of northern Europe, tularemia occurs with epidemic outbreaks at fairly regular intervals. Before the outbreak described, tularemia cases were not diagnosed in central Norway for at least 15 years. Thus, not one patient with a positive MA (microagglutination) test has been recorded for the last 5 years before the outbreak described, the period we used to test for diagnostic serology. New cases have not been registered since December 1985. These data emphasize that epidemic outbreaks of tularemia may occur suddenly in areas which usually are not endemic for this disease (Bevanger et al., 1988).
  9. Sweden: The largest recorded airborne tularemia outbreak occurred in 1966-1967 in an extensive farming area of Sweden. This outbreak involved more than 600 patients infected with strains of the milder European biovar of F tularensis (F tularensis biovar palaearctica) [type B]), most of whom acquired infection while doing farm work that created contaminated aerosols. Case exposures and disease onsets occurred during a period of months but peaked during the winter, when rodent-infested hay was being sorted and moved from field storage sites to barns (Dennis et al., 2001). In the northern part of central Sweden, an extensive epidemic of tularemia with 529 cases, 400 of which were confirmed by laboratory tests, occurred in the summer of 1981. The outbreak was of short duration and was restricted to certain communities within a narrow geographical area. It began in the middle of July and progressed during that month and August, with only sporadic cases in September and October. During the 2 years preceding the outbreak only 3 and 7 cases were reported in Sweden. The infection was mainly transmitted by mosquitoes and most cases were ulceroglandular. The later cases in September and October were infected by contact with hares or rodents. All age groups were affected, with a slight predominance of women and the 30-60 yr age groups (Christenson, 1984).
  10. China: An outbreak of tularemia caused by contact with infected hares was first reported in Heilongjiang Province in 1959. Thereafter, 6 cases were diagnosed in Qinghai Province in 1965. Epidemiologic investigation identified several natural foci of the disease in Tibet from 1962 to 1972 and in Xinjiang Autonomous Region in 1986, where F. tularensis was isolated from patients, Ixodes liberelis and Dermacentor marginatus ticks, and woolly hares (Lepus oiostolos). The latest outbreak occurred in 1986 at a food processing factory in Shandong Province, where 31 of 36 workers who slaughtered hares became ill (Zhang et al., 2006).
B. Transmission Information:
  1. Ontology: UMLS:C0841595 From: Infected vertebrate or invertebrate To: Humans
    Mechanism: Humans become infected with Francisella tularensis through inoculation of the skin, conjunctival sac or oropharyngeal mucosa with blood or tissue while handling infected animals, or through contact with fluids from infected flies, ticks or other animals (Dennis et al., 2001). Transmission occurs through arthropod bites (especially ticks and deerflies), ingestion of contaminated food or water, inhalation of contaminated aerosols, and handling of infected animal tissues (Staples et al., 2006).

C. Environmental Reservoir:
  1. Mammals :
    1. Description: The most important mammalian species involved in human infection include lagomorphs, voles, mice, squirrels, muskrats, and beavers (McLendon et al., 2006). Its principal animal reservoir appears to be the cottontail rabbit (Sylvilagus spp.) (Sjostedt et al., 1996). Type B is reported to have a mainly water-borne cycle with aquatic rodents as reservoirs, e.g. muskrats (Ondatra zibethicus) and beaver (Castor canadensis) in North America (Morner, 1992). Francisella tularensis type B is reported to have mainly ground voles (Arvicola terrestris) as reservoirs in the former Soviet Union (Morner, 1992).
    2. Survival Information: Francisella tularensis does not form spores but can survive in water, soil, and decaying animal carcasses. The organism has been isolated from water and mud samples stored at 7 C for as long as 14 weeks, in tap water for as long as three months, and in dry straw litter for at least 6 months (Feldman, 2003).
  2. Acanthamoeba castellanii :
    1. Ontology: UMLS:C0320458
    2. Description: The interaction between F. tularensis and amoebae (A. castellanii) indicates that ubiquitous protozoa might be an important environmental reservoir for F. tularensis (Abd et al., 2003).
D. Intentional Releases:
  1. Intentional Release information :
    1. Description: The inhalation of Francisella tularensis biovar A causes pneumonic tularemia associated with high morbidity and mortality rates in humans. Exposure to F. tularensis usually occurs by accident, but there is increasing awareness that F. tularensis may be deliberately released in an act of bioterrorism or war (Wu et al., 2005). Japanese germ warfare research units studied F. tularensis subsp. tularensis, and this organism may have been used against Chinese civilians, Russian troops, and American prisoners of war between 1932 and 1945. In addition, the appearance of tularemia in thousands of Russian and German troops at the siege of Stalingrad may have been the result of deliberate use by the Soviets. However, a natural cause for this outbreak has not been eliminated, and military personnel may have acquired F. tularensis from mice and rats whose numbers multiplied owing to the widespread disruption of sanitation and hygiene during battle. During the Cold War both the Soviet Union and the United States prepared and stockpiled tons of infectious agents for potential use against the civilian populations of their enemies (McLendon et al., 2006) A former Soviet Union biological weapons scientist, Ken Alibek, has suggested that tularemia outbreaks affecting tens of thousands of Soviet and German soldiers on the eastern European front during World War II may have been the result of intentional use. In the 1950s and 1960s, the US military developed weapons that would disseminate F. tularensis aerosols; concurrently, it conducted research to better understand the pathophysiology of tularemia and to develop vaccines and antibiotic prophylaxis and treatment regimens. In some studies, volunteers were infected with F. tularensis by direct aerosol delivery systems and by exposures in an aerosol chamber. A live attenuated vaccine was developed that partially protected against respiratory and subcutaneous challenges with the virulent Schu 4 strain of F. tularensis, and various regimens of streptomycin, tetracyclines, and chloramphenicol were found to be effective in prophylaxis and treatment. By the late 1960s, F. tularensis was one of several biological weapons stockpiled by the US military (Dennis et al., 2001).
    2. Emergency contact: Suspicion of inhalational tularemia must be promptly reported to local or state public health authorities so timely epidemiological and environmental investigations can be made (Dennis et al., 2001). Subsequent to intentional release of a biological agent, public health services attempt to ensure the dissemination of accurate information to communities, but the media and the internet may serve as potential sources of inflammatory material, thereby aggravating public insecurity and leading to hoarding of antimicrobial agents, as was observed after the 2001 U.S anthrax attacks. This behavior should be proactively discouraged by infectious diseases experts so it does not contribute to the potential development of antimicrobial resistance (Penn, 2005).
    3. Delivery mechanism: In 1969, a World Health Organization expert committee estimated that aerosol dispersal of 50 kg of virulent F. tularensis bacteria over a metropolitan area with five million inhabitants would result in 250,000 casualties requiring extensive medical care and 19,000 deaths (McLendon et al., 2006)
    4. Containment: In circumstances of a laboratory spill or intentional use in which authorities are concerned about an environmental risk (eg, inanimate surfaces wet with material thought to contain F tularensis), decontamination can be achieved by spraying the suspected contaminant with a 10% bleach solution (1 part household bleach and 9 parts water). After 10 minutes, a 70% solution of alcohol can be used to further clean the area and reduce the corrosive action of the bleach. Soap water can be used to flush away less hazardous contaminations. Persons with direct exposure to powder or liquid aerosols containing F. tularensis should wash body surfaces and clothing with soap water. Standard levels of chlorine in municipal water sources should protect against waterborne infection (Dennis et al., 2001).

III. Infected Hosts

  1. Human:
    1. Taxonomy Information:
      1. Species:
        1. Human; man :
          • Ontology: UMLS:C0086418
          • GenBank Taxonomy No.: 9606
          • Scientific Name: Homo sapiens (NCBI Taxonomy)
          • Description: Humans become infected with Francisella tularensis in various ways, including bites by infective arthropods, handling infectious animal tissues or fluids, direct contact with, or ingestion of, contaminated water, food, or soil, and inhalation of infective aerosols. Persons of all ages and both sexes appear to be equally susceptible to tularemia. Certain activities, such as hunting, trapping, butchering, and farming, are most likely to expose adult men. Laboratory workers are especially vulnerable to infection, either by accidentally inoculating themselves or by inhaling aerosolized organisms (Dennis et al., 2001).

    2. Infection Process:
      1. Infectious Dose: Francisella tularensis is a highly infectious aerosolizable intracellular pathogen that is capable of causing a debilitating or fatal disease with doses as low as 25 colony-forming units (Oyston et al., 2005). Inhaling as few as 10 of the microbes can cause debilitating illness. A few grams of a virulent strain of F. tularensis dispersed in a city could quickly sicken thousands, says Anders Sjostedt of the University of Umea in Sweden (Vogel, 2003).
      2. Description: Inhalation of 10-25 organisms can cause tularemia, accompanied by a pronounced inflammatory response. However, the bacterial component that causes such a response is unknown (Gavrilin et al., 2006). Human infection ranges from asymptomatic forms to a wide variety of clinical manifestations, basically depending on the route of infection. Six clinical forms are usually distinguished: ulceroglandular, which is the most common, glandular, typhoidal, ocular, oropharyngeal and pulmonary (Gutierrez et al., 2003).

    3. Disease Information:
      1. Tularemai [a.k.a. Rabbit fever, market's men disease, meat-cutter's disease, deer-fly fever, glandular type of tick fever, hare disease (Yato-byo)] (i.e., Tularemia) :
        1. Pathogenesis Mechanism: Francisella tularensis can infect humans through the skin, mucous membranes, gastrointestinal tract, and lungs. It is a facultative intracellular bacterium that multiplies within macrophages. The major target organs are the lymph nodes, lungs and pleura, spleen, liver, and kidney. Untreated, bacilli inoculated into skin or mucous membranes multiply, spread to the regional lymph nodes and further multiply, and may then disseminate to organs throughout the body. Bacteremia may be common in the early phase of infection. The initial tissue reaction to infection is a focal, intensely suppurative necrosis consisting largely of accumulations of polymorphonuclear leukocytes, followed by invasion of macrophages, epithelioid cells, and lymphocytes. Suppurative lesions become granulomatous, and histopathological examination of the granulomas shows a central necrotic, sometimes caseating zone surrounded by a layer of epithelioid cells, multinucleated giant cells, and fibroblasts in a radial arrangement, typical of other granulomatous conditions, such as tuberculosis and sarcoidosis. Monkeys that inhaled the virulent SCHU S-4 strain of F tularensis (type A) developed acute bronchiolitis within 24 hours of exposure to 1-um particles and within 48 hours of exposure to 8-um particles. By 72 hours following challenge, inflammation was present in peribronchial tissues and alveolar septa. Bronchopneumonia was most pronounced in animals exposed to the smaller particles and was characterized by tracheobronchial lymph node enlargement and reddish, firm, 0.2- to 0.5-cm-diameter discrete inflammatory lesions scattered throughout the lungs. In the absence of treatment, the disease progressed to pneumonic consolidation and organization, granuloma formation, and eventual chronic interstitial fibrosis. Humans with inhalational exposures also develop hemorrhagic inflammation of the airways early in the course of illness, which may progress to bronchopneumonia. Histopathological examination of affected lungs shows alveolar spaces filled with an exudate of mononuclear cells. Pleuritis with adhesions and effusion and hilar lymphadenopathy are common radiological and pathological findings (Dennis et al., 2001).


        2. Incubation Period: The incubation period of the disease is 2 to 6 days (range: 1 to 20 days) (Arikan et al., 2003). The median incubation period for the disease is 3 to 5 days (range: 1 to 14 days) (Siret et al., 2006)


        3. Prognosis: Patients with chronic debilitating conditions or immunocompromise are at increased risk for severe forms of the disease. In these patients, infection may be quite dramatic with acute prostration and rapid death. Unless treated promptly, septic shock and multiorgan system failure may ensue. Renal involvement, has been associated with a worse prognosis. Fatality rates as high as 30-60% have been reported in patients with acute tularemia. In other patients, the infection may manifest as a more indolent febrile illness that lasts several days, remits briefly, and then recurs. Progressive weakness, malaise, anorexia, and weight loss may persist for months in the absence of treatment (Sarria et al., 2003).


        4. Diagnosis Overview: Culture recovery and characterization remains the "gold standard" for laboratory confirmation of tularemia infection according to the CDC. However, this approach has historically proven itself challenging, particularly with F. tularensis subsps., Type A and Type B. F. tularensis subsps., Type A and Type B, are slow-growing, fastidious organisms requiring sulfhydryl compounds and 24-72 h for growth on artificial media at 37 C. F. tularensis is also notorious for causing laboratory acquired infections and has to be handled under BSL-3 conditions. Despite these concerns, culture provides a conclusive diagnosis of infection and an invaluable resource for molecular epidemiology, subtyping and discovery of novel species and subspecies (Petersen and Schriefer, 2005). Francisella tularensis may be identified by direct examination of secretions, exudates, or biopsy specimens using direct fluorescent antibody or immunohistochemical stains (Dennis et al., 2001). Serology: Serology is the most commonly used laboratory approach for confirmation of suspected disease. However, specific antibody responses are typically not detectable prior to two weeks of infection with currently available tests. IgM, IgA and IgG antibodies appear simultaneously after initial infection and IgM antibodies can last for many years. Agglutination based on formalin-killed whole cells is the standard serology test used for determining the presence of antibody against F. tularensis. ELISAs based on LPS or outer membrane carbohydrate-protein fractions have also been utilized (Petersen and Schriefer, 2005). PCR: A variety of PCR methods have been described for the detection of F. tularensis DNA in both clinical and environmental specimens. PCR can be an invaluable diagnostic tool when organisms are noncultivable or nonviable. The majority of PCR tests for F. tularensis have been gel-based PCR assays targeted at the genes encoding the outer membrane proteins, fopA or tul4. These PCR assays show good specificity and allow for rapid detection of F. tularensis in specimens (Petersen and Schriefer, 2005). 16S rDNA sequencing: Several studies have shown the usefulness of 16S rDNA sequence identification in the diagnostic laboratory, especially as relates to slow-growing, unusual, and fastidious bacteria. For identifying true emergence of F. tularensis, in areas where it has not previously been reported, 16S rDNA sequencing is a particularly useful diagnostic test. 16S rDNA sequencing played an important role in the first identification of F. tularensis in the Southern Hemisphere and also in the tularemia outbreak associated with crayfish in Spain. For identification of recovered bacterial isolates, the universal 16S rDNA primers as well as the Francisella specific 16S rDNA primers, provide good sequence data. For diagnostic identification of Francisella spp. in contaminated samples (ticks, water, field specimens), the Francisella specific 16S rDNA primers should be considered (Petersen and Schriefer, 2005). Molecular subtyping: PCR subtyping assays have been developed that allow for discriminating F. tularensis subsp., Type A and Type B, in the absence of a culture. These assays are gel-based and center on the detection of differences in amplified product sizes. More recently, a gel-based PCR assay targeted at the region of difference 1 (RD1), has been reported to distinguish between all four subspecies of F. tularensis, Type A, Type B, novicida, and mediaasiatica, although evaluation of a larger panel of isolates, especially novicida, will be required before this assay can be employed routinely for F. tularensis subtyping (Petersen and Schriefer, 2005).


        5. Symptom Information :
          • Syndrome -- Ulceroglandular tularemia:
            • Description: Ulceroglandular tularemia generally arises from contact with an infected animal or by the bite of an infected vector and is characterized by the presence of an ulcerated lesion and enlargement of regional lymph nodes. This type of exposure is exemplified by cases in a recent outbreak in Spain (Petersen and Schriefer, 2005). In ulceroglandular tularemia, a local cutaneous papule appears at the inoculation site at about the time of onset of generalized symptoms, becomes pustular, and ulcerates within a few days of its first appearance (Dennis et al., 2001).
            • Observed: Ulceroglandular disease accounts for most (80%) clinical illness resulting from Francisella tularemia (Choi, 2002).


            • Symptoms Shown in the Syndrome:

            • Fever:
              • Ontology: UMLS:C0015967
              • Description: Patients typically present with fever, enlarged and tender lymph nodes, and an ulcer at the place of entry. The skin lesion is usually slight, and the appearance of an infected insect bite need not actually differ from that of a noninfected bite (Johansson et al., 2000(a)).
            • Enlarged and tender lymph nodes:
              • Description: Typically, one or more regional afferent lymph nodes may become enlarged and tender within several days of the appearance of the papule. Even with antibiotic treatment, the affected nodes may become fluctuant and rupture (Dennis et al., 2001).
            • Ulcer:
              • Ontology: UMLS:C0041582
              • Description: The ulcer is tender, generally has an indolent character, and may be covered by an eschar (Dennis et al., 2001).
          • Syndrome -- Pharyngeal tularemia:
            • Description: Pharyngeal tularemia, another variant of ulceroglandular disease, is the result of primary invasion through the oropharynx. The source may be contaminated foods or water or contaminated droplets. This form which represents 0% to 12% of cases overall, has been seen with increasing frequency in Japan, and predominate in outbreaks. Children have been involved more often than adults, and several family members may be affected simultaneously. In pharyngeal tularemia, the patient's predominant complaint typically is of fever and severe throat pain. Exudative pharyngitis or tonsillitis is the rule, and one of more ulcers may be seen. A pharyngeal membrane has been described in some patients that is similar to a diphtheric membrane. Cervical, preparotid, and retropharyngeal adenopathy may be present, occasionally with bilateral involvement or abscess formation. When there is a delay in seeking care the dominant manifestation may be cervical adenopathy without prominent fever or pharyngotonsillitis (Penn, 2005).
            • Observed: 0% to 12% of all cases (Penn, 2005).
          • Syndrome -- Glandular tularemia:
            • Description: Glandular tularemia, is an uncommon but significant cause of cervical lymphadenopathy in children (Collison and Adams, 2003). Glandular tularemia represents essentially the same process as ulceroglandular disease, except that a skin lesion either healed before presentation or was minimal or atypical and overlooked. Enlarged lymph nodes may persist for prolonged periods, and in some patients an exposure or prior febrile illness will be forgotten. For this reason, tularemia may not be considered in the initial differential diagnosis of some patients whose primary presentation is lymphadenopathy. In either ulceroglandular or glandular tularemia the lymph nodes may suppurate (Penn, 2005).
            • Observed: Glandular disease may occur in 15% of patients with tularemia (Choi, 2002). This form accounts for 3% to 20% of the cases in the United States, although 62% of cases in Japan have been of this type (Penn, 2005).


            • Symptoms Shown in the Syndrome:

            • Fever:
              • Ontology: UMLS:C0015967
              • Description: The clinical illness was mild, consisting of fever, headache, and lymphadenopathy (Markowitz et al., 1985).
            • Headache:
              • Ontology: UMLS:C0018681
              • Description: The clinical illness was mild, consisting of fever, headache, and lymphadenopathy (Markowitz et al., 1985).
            • Lymphadenopathy:
              • Ontology: UMLS:C0497156
              • Description: Lymphadenopathy is very unusual in typhoidal tularemia and is most often observed in cases of ulceroglandular or glandular disease (Plourde et al., 1992). All lymphadenopathy was in the head and neck area (Markowitz et al., 1985).
          • Syndrome -- Oculoglandular tularemia:
            • Description: Oculoglandular tularemia occurs when the conjunctiva is the initial site of infection, usually a result of mechanical transfer of organisms from an infectious source to the eye by the fingers. This form of disease is characterized by the appearance of ulcers and nodules on the conjunctiva and regional lymph node swelling (Petersen and Schriefer, 2005). Tularemia is one etiology of Parinaud's oculoglandular syndrome. Parinaud's oculoglandular syndrome is a unilateral granulomatous follicular conjunctivitis associated with mucopurulent discharge as well as painful preauricular and submandibular lymphadenopathy. Corneal ulceration and perforation may occur. The patient usually has fever, malaise, headache, fatigue, myalgias, and a history of exposure to animals, especially cats (Thompson et al., 2001).
            • Observed: Oculoglandular tularemia is much rarer, occurring in approximately 1% of cases (Choi, 2002).


            • Symptoms Shown in the Syndrome:

            • Conjunctivitis:
              • Ontology: UMLS:C0009763
              • Description: The etiology is usually unknown but has been associated with cat scratch disease, tularemia, sporotrichosis, tuberculosis and other mycobacteria, syphilis, lymphogranuloma venereum, certain fungal, viral and rickettsial diseases, and mononucleosis. A reported case of exposure of a patient to a wild rabbit, which subsequently died, suggested that tularemia was the likely etiology (Thompson et al., 2001).
              • Observed: 26% (Dennis et al., 2001)
          • Syndrome -- Oropharyngeal tularemia:
            • Description: The portal of entry is the oropharynx in the oropharyngeal form of tularemia (Arikan et al., 2003). Oropharyngeal tularemia is acquired by drinking contaminated water, ingesting contaminated food, and, sometimes, by inhaling contaminated droplets or aerosols. Affected persons may develop stomatitis but more commonly develop exudative pharyngitis or tonsillitis, sometimes with ulceration. Pronounced cervical or retropharyngeal lymphadenopathy may occur (Dennis et al., 2001). Most human cases in the recent outbreak of tularemia in Kosovo were of this form (Petersen and Schriefer, 2005).
            • Observed: Oropharyngeal disease also is relatively rare, accounting for less than 5% of cases of tularemia (Choi, 2002).


            • Symptoms Shown in the Syndrome:

            • Cervical lymphadenitis:
              • Ontology: UMLS:C0149642
              • Description: The main signs are pharyngotonsillitis and cervical lymphadenitis (Arikan et al., 2003).
            • Cough:
              • Ontology: UMLS:C0010200
              • Description: A dry or slightly productive cough and substernal pain or tightness frequently occur with or without objective signs of pneumonia, such as purulent sputum, dyspnea, tachypnea, pleuritic pain, or hemoptysis (Dennis et al., 2001).
            • Cutaneous lesions:
              • Description: Francisella tularensis can cause open sores. It was weaponized by Japan, the United States, and the Soviet Union (Vogel, 2003).
            • Diarrhea:
              • Ontology: UMLS:C0011991
              • Description: Depending on the infecting dose, gastrointestinal tularemia ranges from mild but persistent diarrhea to an acute fatal disease with extensive ulceration of the bowel (Ellis et al., 2002).
            • Fever:
              • Ontology: UMLS:C0015967
              • Description: It is characterized by general symptoms such as fever, headache, sore throat, malaise, myalgias, cough and cutaneous lesions (Arikan et al., 2003).
            • Headache (Arikan et al., 2003):
              • Ontology: UMLS:C0018681
            • Malaise (Arikan et al., 2003):
              • Ontology: UMLS:C0231218
            • Myalgias (Arikan et al., 2003):
              • Ontology: UMLS:C0231528
            • Sore throat (Arikan et al., 2003):
              • Ontology: UMLS:C0242429
              • Description: It is often described as a painful sore throat with enlargement of the tonsils and the formation of a yellow-white pseudomembrane. This is most often accompanied by swollen cervical lymph nodes (Ellis et al., 2002).
            • Tonsillopharyngitis (Arikan et al., 2003):
              • Ontology: UMLS:C0749591
          • Syndrome -- Pneumonic tularemia:
            • Description: Pneumonic tularemia, the most severe form of disease, occurs by direct inhalation of the organism, or may develop secondarily by septicemic spread of infection from a primary site of infection. Historically, farming, and more recently landscaping, have been significant occupational risk-factors associated with pneumonic tularemia in certain endemic areas (Petersen and Schriefer, 2005). An aerosol release of F tularensis would be expected to result in acute illness with signs and symptoms of 1 or more of pharyngitis, bronchiolitis, pleuropneumonitis, and hilar lymphadenitis, accompanied by various manifestations of systemic illness. Inhalational exposures, however, commonly result in an initial clinical picture of systemic illness without prominent signs of respiratory disease. The earliest pulmonary radiographic findings of inhalational tularemia may be peribronchial infiltrates, typically advancing to bronchopneumonia in 1 or more lobes, and often accompanied by pleural effusions and hilar lymphadenopathy. Signs may, however, be minimal or absent, and some patients will show only 1 or several small, discrete pulmonary infiltrates or scattered granulomatous lesions of lung parenchyma or pleura. Although volunteers challenged with aerosols of virulent F tularensis (type A) regularly developed systemic symptoms of acute illness 3 to 5 days following exposure, only 25% to 50% of participants had radiological evidence of pneumonia in the early stages of infection. On the other hand, pulmonary infection can sometimes rapidly progress to severe pneumonia, respiratory failure, and death. Lung abscesses occur infrequently (Dennis et al., 2001). Tularemia pneumonia may complicate the various clinical presentations of tularemia, or present as an uncommon zoonosis. Approximately 200 cases of tularemia are reported in the United States per year, and 10% to 20% present with pneumonia either as a primary event or as a complication of ulceroglandular or typhoidal tularemia. Tularemia pneumonia also occurs with the other tularemic forms, glandular, oculoglandular, and oropharyngeal tularemia as a result of secondary bacteremic spread to the lungs. Pneumonia usually occurs within 2 days to months after infection. The mortality rate of primary tularemic pneumonia and pneumonia complicating typhoidal tularemia is high. The clinical and roentgenographic presentations of tularemia pneumonia are highly variable and is one of the zoonotic atypical pneumonias. Tularemic pneumonia may mimic fungal and bacterial pneumonias, tuberculosis, or malignancy (Gill and Cunha, 1997).


            • Symptoms Shown in the Syndrome:

            • Pulmonary edema:
              • Ontology: UMLS:C0034063
              • Description: Infiltrates in left lower lung, tenting of diaphragm, probably caused by pleural effusion, and enlargement of left hilum. Source: Armed Forces Institute of Pathology (Dennis et al., 2001).
            • Cough (Avashia et al., 2004):
              • Ontology: UMLS:C0010200
          • Syndrome -- Typhoidal tularemia:
            • Description: Typhoidal tularemia refers to febrile illness caused by F. tularensis that is not associated with prominent lymphadenopathy and does not fit into any of the other major forms. This form of tularemia may result from any mode of acquisition (Penn, 2005) Typhoidal tularemia is used to describe systemic illness in the absence of signs indicating either site of inoculation or anatomic localization of infection. This should be differentiated from inhalational tularemia with pleuropneumonic disease (Dennis et al., 2001). The case-fatality rate among humans can reach 30%-60% in untreated typhoidal cases (MMWR et al., 2005).
            • Observed: From 5% to 30% of cases are typhoidal (Penn, 2005).


            • Symptoms Shown in the Syndrome:

            • Abdominal pain (Dennis et al., 2001):
              • Ontology: UMLS:C0000737
            • Anorexia (Dennis et al., 2001):
              • Ontology: UMLS:C0003123
            • Chills (Choi, 2002):
              • Ontology: UMLS:C0085593
            • Cough (Dennis et al., 2001):
              • Ontology: UMLS:C0010200
            • Diarrhea:
              • Ontology: UMLS:C0011991
              • Description: Diarrhea, a major manisfestation only in typhoidal tularemia, is loose and watery but only rarely bloody. Children may have more severe intestinal involvement, including focal areas of bowel necrosis (Penn, 2005).
            • Headache (Penn, 2005):
              • Ontology: UMLS:C0018681
            • Fever (Dennis et al., 2001):
              • Ontology: UMLS:C0015967
            • Myalgia (Dennis et al., 2001):
              • Ontology: UMLS:C0231528
            • Nausea (Dennis et al., 2001):
              • Ontology: UMLS:C0027497
            • Pneumonia (Penn, 2005):
              • Ontology: UMLS:C0032285
            • Sore throat (Dennis et al., 2001):
              • Ontology: UMLS:C0242429
            • Vomiting (Dennis et al., 2001):
              • Ontology: UMLS:C0042963
          • Syndrome -- Septic form:
            • Description: Tularemia sepsis is potentially severe and fatal. As in typhoidal tularemia, nonspecific findings of fever, abdominal pain, diarrhea, and vomiting may be prominent early in the course of illness. The patient typically appears toxic and may develop confusion and coma. Unless treated promptly, septic shock and other complications of systemic inflammatory response syndrome may ensue, including disseminated intravascular coagulation and bleeding, acute respiratory distress syndrome, and organ failure (Dennis et al., 2001).

        6. Treatment Information:
          • Antimicrobial Therapy: Streptomycin: The minimum dosage of streptomycin that is effective therapy for tularemia is 7.5 to 10 mg/kg intramuscularly every 12 hours for 7 to 14 days. An alternative regimen is 15 mg/kg intramuscularly every 12 hours for the first 3 days, followed by half this dose to complete treatment. For patients who are very ill, 15 mg/kg every 12 hours may be given throughout a 7- to 10 day course. Doses greater than 2 g/day of streptomycin in adults do not increase efficacy. The pediatric weight-based regimens for streptomycin are similar (up to a maximum of the adult dose): 30 to 40 mg/kg/day intramuscularly in two divided doses for a total of 7 days; or 40 mg/kg/day intramuscularly in two divided doses for the first 3 days, followed by 20 mg/kg/day intramuscularly in two divided doses for the next 4 days (Penn, 2005).
            • Applicable: The drug of choice for the treatment of all forms of tularemia except meningitis is streptomycin, although gentamycin is an acceptable substitute (Penn, 2005).
            • Contraindicator: In patients with impaired renal function, doses and/or frequency of administration of streptomycin must be modified in response to serum concentrations of the drug and the degree of renal impairment. The manufacturer states that peak serum concentration of streptomycin should not exceed 20-25 mcg/mL. When serum streptomycin concentrations are not available, dosage may be based on creatinine clearance. Streptomycin should not be used in patients with documented hypersensitivity, for long term therapy, or in patients suffering from non-dialysis-dependent renal failure. Streptomycin should be used with caution in patients with myasthenia gravis, hypocalcemia, and other conditions that depress neuromuscular transmission (AHFS Drug Information, 2006(a)).
            • Complication: The first few days of streptomycin rarely may induce a Jarish-Herxheimer-like reaction, with an increase in symptoms and a transient drop of the serum agglutination titer. Nephrotoxicity may be increased if streptomycin is coadministered with other aminoglycosides, cephalosporins, penicillins, amphotericin B, and loop diuretics. Aminoglycosides enhance neuromuscular blocking agents potentially causing respiratory depression (Penn, 2005).
            • Success Rate: The rate of cure for streptomycin was 97%, with no relapses (Enderlin et al., 1994). Antibiotic therapy of tularemia has been determined empirically; streptomycin treatment exhibits a 100% cure rate (Maurin et al., 2002).
            • Drug Resistance: A fully virulent streptomycin-resistant strain of Francisella tularensis was developed in the past for use in biologic warfare (AHFS Drug Information, 2006(a)).
          • Antimicrobial Therapy: Gentamycin: Gentamycin is given intravenously at a dose of 3 to 5 mg/kg/day in divided doses for 7 to 14 days, with desired peak serum levels of a least 5.0 mcg/mL. The efficacy of single-daily dosing has not been studied. The doses of both streptomycin and gentamycin need to be adjusted for renal insufficiency. Penetration of these drugs into CSF is poor and erratic and may be inadequate in tularemia menningitis (Penn, 2005).
            • Applicable: Gentamycin has proved to be effective therapy. In pediatric patients, gentamycin was shown to be effective for treatment of tularemia without relapse or failure (Penn, 2005).
            • Contraindicator: Gentamicin should not be used for long term therapy, in patients suffering from non-dialysis-dependent renal failure, or in patients with myasthenia gravis, hypocalcemia, and other conditions that depress neuromuscular transmission (AHFS Drug Information, 2006(b)).
            • Complication: Serious adverse reactions including ototoxicity and nephrotoxicity have occurred in patients receiving systemic gentamycin therapy. Coadministration of gentamicin with other aminoglycosides, cephalosporins, penicillin, and amphotericin B may increase nephrotoxicity; aminoglycosides enhance neuromuscular blocking agents potentially causing respiratory depression. Coadministration with loop diuretics may increase auditory toxicity of aminoglycosides with possible irreversible hearing loss of varying degrees (AHFS Drug Information, 2006(b)).
            • Success Rate: A review of the literature revealed that gentamycin was effective for treatment except that the relapse and failure rates were high with gentamycin (Penn, 2005).
          • Antimicrobial Therapy: Tetracyclines: Tetracycline is most effective in adults when given a 2 g/day in divided doses for at least 14 days, a suggested oral regimen in children is 30 mg/kg/day, to a maximum 2/g/day, in divided doses for the same duration. Docycycline may also be used and provides the convenience of twice daily dosing (Penn, 2005).
            • Applicable: Tetracycline is bacteriostatic for F. tularensis (Penn, 2005). Tetracyclines (usually doxycycline) are used as alternative agents for the treatment of tularemia caused by Francisella tularensis (AHFS Drug Information, 2006(c)). Tetracycline has been used to treat tularemia; however relapses and primary treatment failures occur at a higher rate than with aminoglycosides (Dennis et al., 2001).
            • Contraindicator: Tetracycline should not be used in children younger than 8 years of age, during pregnancy, or during lactation. It should not be coadministered with antacids containing aluminum, calcium, magnesium, iron, or bismuth subsalicylate; oral contraceptives; or anticoagulants (Penn, 2005).
            • Complication: Photosensitivity may occur with prolonged exposure to sunlight or tanning equipment. Fanconi-like syndrome can occur with outdated tetracyclines. Tetracycline can decrease the effects of oral contraceptives, causing breakthrough bleeding and increased risk of pregnancy. It can also increase hypoprothrombinemic effects of anticoagulants (AHFS Drug Information, 2006(c)).
            • Success Rate: Tetracycline and chloramphenicol are bacteriostatic for F. tularensis, and this accounts for the high rate of relapse after treatment with these agents. Doxycycline has a higher relapse rate compared with the aminoglycosides (Penn, 2005).
          • Antimicrobial Therapy: Chloramphenicol: In general choloramphenicol should not be used to treat tularemia because of its potentially serious toxicity and the availability of more effective alternatives with less dangerous potential side effects. However, chloramphenicol, 50 to 100 mg/kg/day intravenously in divided doses may be added to streptomycin to treat menningitis. When used in the past for other forms of tularemia, the oral dose of chloramphenicol has been 30 to 50 mg/kg/day in three or four divided doses for at least 14 days. However, the oral preparation is no longer available in the United States (Penn, 2005).
            • Applicable: Alternatives for the treatment of tularemia include tetracyclines (doxycycline, chloramphenicol, or ciprofloxacin (AHFS Drug Information, 2006(d)).
            • Contraindicator: Chloramphenicol is contraindicated in patients with a history of hypersensitivity and/or toxic reactions to the drug (AHFS Drug Information, 2006(d)).
            • Success Rate: Chloramphenicol has been used to treat tularemia; however, relapses and primary failures occur at a higher rate than with aminoglycosides, and they should be given for at least 14 day to reduce the chance of relapse (Dennis et al., 2001).
          • Antimicrobial Therapy: Fluoroquinolones except cinoxacin: Fluoroquinolones, which have intracellular activity, are promising candidates for treating tularemia. Ciprofloxacin, which is not labeled for use in tularemia, has been shown to be active in vitro and in animals and has been used successfully to treat tularemia in both adults and children (Dennis et al., 2001). Ciprofloxacin has been found to be effective in treating tularemia in mice and in a recent outbreak in Spain, ciprofloxacin was the antibiotic with the lowest level of therapeutic failure and fewest side effects. Ciprofloxacin was also shown to be suitable for the treatment of tularemia in a case where relapse was evident after initial gentamicin therapy (Ellis et al., 2002).
            • Applicable: Recent in vitro susceptibility studies have found that the fluoroquinolones are active against F. tularensis subsp. tularensis as well as subsp. holarctica. In mice, liposome-encapsulated ciprofloxacin delivered by aerosol inhalation was highly effective in the treatment of respiratory F. tularensis infection (Penn, 2005).
            • Contraindicator: Fluoroquinolones (including ciprofloxacin) have been reported to cause cartilage damage in immature animals and are not approved for use in patients under 18 years old (Dennis et al., 2001).
            • Success Rate: Clinical experience with the fluoroquinolones as therapy for tularemia caused by F. tularensis subsp. holarctica is growing and has been favorable even in immunocompromised hosts. A patient with a knee prosthesis chronically infected by F. tularensis subsp. holarctica was cured following a prolong course of ciprofloxacin and rifampin. However, the outcome with fluoroquinolone therapy may be suboptimal and there is minimal experience using these agents for infections caused by the more virulent F. tularensis subsp. tularensis. During the initial Spanish tularemia outbreak, therapy with ciprofloxacin was overall statistically equivalent to that with streptomycin and superior to doxycycline. However relapses occurred in 7 of 14 patients at one Spanish hospital following ciprofloxacin given as either primary or secondary treatment. Ciprofloxacin also have been effective in children with tularemia. Johansson and colleagues described 12 children, ranging in age from 1 to 10 years, with tularemia given ciprofloxacin 15 to 20 mg/kg daily in two divided doses. The two patients who completed only 3.5 and 7 days of treatment relapsed but all 12 were cured after completing 10 to 14 days of uninterrupted therapy (Penn, 2005).
          • Surgical therapy: Surgical therapies are limited to drainage of abscessed lymph nodes and chest tube drainage of empyemas (Penn, 2005).

          • Other Information:
            • Recommendations for Therapy of Contained Casualties after Intentional Release of Francisella tularensis: ADULTS (Serious Disease): Streptomycin 1 g IM q 12 hours for 10 days. Gentamycin 5 mg/kg IM or IV qd for 10 days. (Alternatives for Less Serious Disease): Streptomycin or gentamycin in doses listed above. Doxycycline 100 mg IV BID for 14-21 days. Ciprofloxacin 400 mg IV BID for 10 days. Chloramphenicol 15 mg/kg IV QID for 14-21 days (Mitchell and Penn, 2005). CHILDREN (Serious Disease): Streptomycin 15 mg/kg IM q 12 hours for 10 days, not to exceed 2 g/day. Gentamycin 2.5 mg/kg IM or IV q 8 hours for 10 days. (Alternatives for Less Serious Disease): Streptomycin or gentamycin in doses listed above. Doxycycline 100 mg IV q 12 for 14-21 days if weight is equal or greater than 45 kg; 2.2 mg/kg IV q 12 hours if weight <45 kg. Ciprofloxacin 15 mg/kg IV q 12 hour for 10 days (Mitchell and Penn, 2005). PREGNANCY (Serious Disease): Gentamycin 5 mg/kg IM or IV qd for 10 days. Streptomycin 1 g IM q 12 hours for 10 days. (Alternatives for Less Serious Disease): Gentamycin or Streptomycin in doses listed above. Doxycycline 100 mg IV q 12 hours for 14-21 days. Ciprofloxacin 400 mg IV q 12 hours for 10 days. Chloramphenicol 15 mg/kg IV QID for 14-21 days (Mitchell and Penn, 2005). IMMUNOSUPPRESSED PERSONS: Minimum of 10 days of treatment. Gentamycin 5 mg/kg IM or IV in divided doses. Streptomycin 1 g IM q 12 hours (Mitchell and Penn, 2005).
            • Recommendations for Therapy of Mass Casualties and for Postexposure Prophylaxis after Intentional Release of Francisella tularensis: ADULTS: Doxycycline 100 mg PO BID for 14 days. Ciprofloxacin 500 mg PO BID for 14 days (Mitchell and Penn, 2005). CHILDREN: Doxycycline 100 mg PO BID for 14 days if weight is equal or greater than 45 kg; 2.2 mg/kg PO BID if weight <45 kg. Ciprofloxacin 15 mg/kg PO BID for 14 days (Mitchell and Penn, 2005). PREGNANCY: Ciprofloxacin 500 mg PO BID for 14 days. Doxycycline 100 mg PO BID for 14 days (Mitchell and Penn, 2005). NOTE: Prior to determining treatment strategy, case clusters should be evaluated for mass casualty potential, wherein large numbers of potentially infected people prohibit individual medical management, as would be possible in a contained casualty situation. Hence the recommended regimens above differ for the two circumstances. Treatment using bacteriostatic drugs should be continued for a longer duration than the traditional 10-day course recommended for bacteriocidal drugs. When treating individuals with ciprofloxacin, doxycycline, or chloramphenicol, intravenous regimens can be changed to oral regimens after a substantial clinical improvement is noted. Note that in mass casualty situations a minimum of 14 days is recommended for all regimens; this is due to the excessive use of oral agents beginning from the initiation of therapy. The bacteriostatic agents are not recommended for immunosuppressed patients because of the higher rates of treatment failure generally observed with the agents. Futhermore, giving the entire minimum of 10 days of therapy parenterally should be considered for immunocompromised patients. Although quinolones and tetracyclines have been associated with adverse consequences in children and immature laboratory animals, short courses of these agents in children have not been detrimental in prospective studies. The risks should be weighed in proportion to the potential benefits in children with severe disease (Mitchell and Penn, 2005).

    4. Prevention:
      1. Immunization:
        • Ontology: UMLS:C0020971
        • Description: Initial efforts to develop a live attenuated tularemia vaccine began in the former Soviet Union prior to the Second World War. Attenuation of strains was achieved either by repeatedly subculturing fully virulent strains in media supplemented with antiserum or by drying the strains. In 1934, El'bert et al. inoculated animals with a weakly virulent tularemia culture. Protection was demonstrated when these immunized animals were challenged with a virulent culture, and it was suggested that the same immunization procedure might be applicable to humans. Strain Moscow was reported to show weakened virulence and high immunogenicity and was used as a live vaccine in humans in 1942. In subsequent years it was shown that strain 15 had become so attenuated that it was no longer virulent in mice. The strain was passaged in animals and a variant, strain 15 restored, was derived. Another attenuated vaccine, strain 155, was also developed at this time, and both strains were produced as live vaccines at the Gamaleya Institute in Moscow. These strains were transferred to the United States in 1956 (Ellis et al., 2002).
        • Efficacy:
          • Rate: The effectiveness of vaccination was successfully demonstrated in volunteers, and several thousand individuals were reportedly vaccinated before the strain was apparently lost (Ellis et al., 2002).
      2. Prophylaxis:
        • Ontology: UMLS:C0199176
        • Description: Antibiotic prophylaxis after potential exposures of unknown risk, such as tick bites, is not recommended. In the past intramuscular streptomycin was given for preemptive treatment of documented exposures from laboratory accidents because streptomycin successfully aborts illness when given in the incubation period after experimental inoculation. Gentamycin should be effective for this purpose as well but this has not been confirmed. Doxycycline and ciprofloxacin also were examined in murine tularemia model, and both can be effective as preemptive therapy in mice after intraperitoneal challenge. Thus, currently either doxycycline or ciprofloxacin given orally for 14 days is recommended for adults with suspected or proven high-risk exposure to F. tularensis. Individuals with lower-risk exposures may be observed for fever or other signs of illness without antibiotics (Penn, 2005).
      3. Prophylaxis Recommendations for Therapy of Mass Casualties after Intentional Release of Tularemia:
        • Description: Prior to determining treatment strategy, case clusters should be evaluated for mass casualty potential, wherein large numbers of potentially infected people prohibit individual medical management, as would be possible in a contained casualty situation. Hence the recommended regimens above differ for the two circumstances. Treatment using bacteriostatic drugs should be continued for a longer duration than the traditional 10-day course recommended for bacteriocidal drugs. When treating individuals with ciprofloxacin, doxycycline, or chloramphenicol, intravenous regimens can be changed to oral regimens after a substantial clinical improvement is noted. Note that in mass casualty situations a minimum of 14 days is recommended for all regimens; this is due to the excessive use of oral agents beginning from the initiation of therapy. The bacteriostatic agents are not recommended for immunosuppressed patients because of the higher rates of treatment failure generally observed with the agents. Futhermore, giving the entire minimum of 10 days of therapy parenterally should be considered for immunocompromised patients. Although quinolones and tetracyclines have been associated with adverse consequences in children and immature laboratory animals, short courses of these agents in children have not been detrimental in prospective studies. The risks should be weighed in proportion to the potential benefits in children with severe disease (Mitchell and Penn, 2005).
      4. Avoidance of exposure:
        • Description: Avoiding exposure to the organism is the best prevention of tularemia. Wild animals should not be skinned or dressed using bare hands, or when the animal appeared ill. Gloves, masks, and protective eye covers should be worn when performing such tasks and when disposing of dead animals brought home by household pets. Wild game should be cooked thoroughly before ingestion. Wells or other waters that are contaminated by dead animals should not be used. Treatment of community water supplies with standard chlorination protects against waterborne tularemia. The most important measure to avoid tick bites in infected areas is wearing clothing that is tight at the wrists and ankles and that covers most of the body. Chemical tick repellants also may be of benefit. Frequent checks should be made for attached ticks so that they may be removed promptly; this must not be done with bare hands, and care should be taken not to crush the tick. Hospitalized patients with tularemia do not need special isolation because person-to-person spread does not occur, and even in pre-antibiotic era secondary cases were not found. Standard universal precautions for contaminated secretions are adequate when handling drainage from the wounds and eyes (Penn, 2005).

    5. Model System:
      1. Mouse:
        1. Ontology: UMLS:C0025919
        2. Model Host: BALB/c mouse (Piercy et al., 2005).
        3. Model Pathogens:
        4. Description: The in vivo efficacy of ciprofloxacin, gatifloxacin and moxifloxacin were assessed in an experimental Francisella tularensis Schu S4 infection in the BALB/c mouse model. Mice were given 100 mg/kg of antibiotic by oral administration twice daily commencing at 6, 24 or 48 h post-exposure and continued for 14 days post-exposure. All mice were challenged subcutaneously with 1 x 10(6) cfu F. tularensis Schu S4 and observed for a period of 56 days. Treatment initiated 6 h post-exposure resulted in 94, 100 and 100% survival for ciprofloxacin, gatifloxacin and moxifloxacin, respectively. When treatment was delayed until 24 h post-exposure the survival rates were ciprofloxacin 67%, gatifloxacin 96% and moxifloxacin 100%. Treatment initiated at 48 h post-exposure resulted in a significant reduction in the survival rate of the ciprofloxacin-treated mice, with 0% survival compared with 84 and 62% for gatifloxacin and moxifloxacin, respectively. Non-treated infected control mice died within 96 h post-exposure. Dexamethasone given at day 42 for 7 days to suppress the animals' immune system caused relapse in all of the treatment groups. Both gatifloxacin and moxifloxacin were more effective at preventing mortality than ciprofloxacin and could be considered as alternative antibiotics in the treatment of systemic F. tularensis infection (Piercy et al., 2005).
      2. AKR/J mouse:
        1. Ontology: UMLS:C1515841
        2. Model Host: AKR/J mouse (Eigelsbach et al., 1975)
        3. Model Pathogens:
        4. Description: An experimental model was developed in which passively transferred spleen cells from immunized AKR/J mice enabled nonimmume syngeneic recipients to survive an otherwise fatal infection with fully virulent Francisella tularensis. Donor immunization was achieved by administering live attenuated tularemia vaccine and, subsequently, the virulent streptomycin-sensitive SCHU S4 strain of F. tularensis. At selected intervals after immunization, donor spleen cells were transferred to streptomycin-treated recipients challenged subcutaneously, intravenously, or intraperitoneally with 25 to 50 minimal lethal doses of virulent streptomycin-resistant F. tularensis SCHU S5. The protection afforded by immune spleen cells was maximal (essentially 100%) 12 days after the SCHU S4 secondary immunization (Eigelsbach et al., 1975).
      3. Vole:
        1. Ontology: UMLS:C1013156
        2. Model Host: Common vole (M. arvalis) (Shlygina et al., 1987).
        3. Model Pathogens:
        4. Description: The possibility of the atypical course of tularemia with the prolonged persistence of Francisella tularensis strain 165 in common voles (M. arvalis), the twin species of East European voles (M. rossiaemeridionalis), was studied. 7 out of 33 voles showed the atypical course of tularemia: in 3 voles the disease took a prolonged course with bacteriuria and death on days 25-34; 3 other voles with bacteriuria registered before days 33, 66 and 172 (the term of observation) survived. The surviving animals were killed on day 183, and the presence of bacteria in their organs and seroconversion were established. One vole excreted no bacteria with urine and had no bacteria in its organs (the animal was examined on day 156), but in its blood specific antibodies were detected. Thus, M. arvalis, like M. rossiaemeridionalis, can harbor F. tularensis at the period between epizootics. When voles of the former species penetrate stacks of straw and hayricks, conditions appear for the transfer of the infection to the latter species, M. rossiaemeridionalis. Therefore, in the foci of the meadow-field type each of these two species of voles may be not only of epizootic, but also of epidemic importance (Shlygina et al., 1987). Common voles (Microtus subarvalis) were infected with tularemia by feeding them with the corpses of animals infected with a Francisella tularensis strain of decreased virulence. This resulted in non-lethal infection in 14 out of 433 voles. A considerable part of the animals having had the infection developed bacterial carriership (11 out of 13 animals) with bacteriuria (8 out of 11 animals) lasting up to 2 months. The persistence of Francisella tularensis in the body of the animals having had the infection could last as long as 6-11 months (Shlygina and Olsuf'ev, 1982).
  2. Non human vertebrates:
    1. Taxonomy Information:
      1. Species:
        1. Black-and-red tamarin :
          • Ontology: UMLS:C0324808
          • GenBank Taxonomy No.: 9489
          • Scientific Name: Saguinus nigricollis (NCBI Taxonomy)
          • Description: In an episode of tularemia in a Canadian zoologic garden, three black and red tamarins (Sanguinus nigricollis) and one talapoin (Cercopithecus talapoin) died. A second talapoin developed abscesses in the tongue and submandibular area; this animal recovered with treatment. Francisella tularensis was isolated from lung, liver, and spleen from each dead monkey and from pus collected from the tongue abscess of the sick talapoin. The attending veterinarian contracted the disease from a tamarin bite. The source of the disease was identified as wild ground squirrels, and the causative organism was recovered from the liver and spleen of one squirrel and from fleas found on it (Nayar et al., 1979).
        2. Gold-and-black lion tamarin :
          • Ontology: UMLS:C1020092
          • GenBank Taxonomy No.: 57374
          • Scientific Name: Leontopithecus chrysomelas (NCBI Taxonomy)
          • Description: Tularaemia in a captive golden-headed lion tamarin (Leontopithecus chrysomelas) in Switzerland (Hoelzle et al., 2004).
        3. Squirrel monkey :
          • Ontology: UMLS:C0999517
          • GenBank Taxonomy No.: 190117
          • Scientific Name: Saimiri sciureus sciureus (NCBI Taxonomy)
          • Description: A 3-year-old female squirrel monkey (Saimiri sciureus sciureus) was examined because of sudden onset of lethargy and fever (Beckwith, 2006). Following collection, blood samples were slow to clot. During the next week, the monkey developed anemia and thrombocytopenia; Francisella tularensis was isolated from blood samples (Beckwith, 2006). Francisella tularensis was isolated from blood samples of a 3-year-old female squirrel monkey (Saimiri sciureus sciureus) (Beckwith, 2006).
        4. Talapoin :
          • Ontology: UMLS:C0026445
          • GenBank Taxonomy No.: 36231
          • Scientific Name: Cercopithecus talapoin (NCBI Taxonomy)
          • Description: In an episode of tularemia in a Canadian zoologic garden, three black and red tamarins (Sanguinus nigricollis) and one talapoin (Cercopithecus talapoin) died. A second talapoin developed abscesses in the tongue and submandibular area; this animal recovered with treatment. Francisella tularensis was isolated from lung, liver, and spleen from each dead monkey and from pus collected from the tongue abscess of the sick talapoin. The attending veterinarian contracted the disease from a tamarin bite. The source of the disease was identified as wild ground squirrels, and the causative organism was recovered from the liver and spleen of one squirrel and from fleas found on it (Nayar et al., 1979).
        5. American beaver :
          • Ontology: UMLS:C0004900
          • GenBank Taxonomy No.: 51338
          • Scientific Name: Castor canadensis (NCBI Taxonomy)
          • Description: F. tularensis subsp. holarctica, found in Europe, North America, and Japan, is often associated with lagomorphs in Scandinavia, continental Europe, and Japan, ground voles in the former USSR, and beavers and muskrats in North America (Johansson et al., 2000 (b)). Type B is reported to have a mainly water-borne cycle with aquatic rodents as reservoirs, e.g. muskrats (Ondatra zibethicus) and beaver (Castor canadensis) in North America (Morner, 1992).
        6. Bank vole :
          • Ontology: UMLS:C0686895
          • GenBank Taxonomy No.: 51090
          • Scientific Name: Clethrionomys glareolus (NCBI Taxonomy)
          • Description: Studies on Lyme borreliosis and other tick-borne zoonoses in the Austrian and Slovakian borderland, a region endemic for tularemia, revealed a relatively high prevalence of infection with Borrelia burgdorferi s.l. and Francisella tularensis in small terrestrial mammals, as well as in the ticks, during a one-year survey (Vyrostekova et al., 2002). Infection with B. burgdorferi s.l. and also with F. tularensis was found in all the most abundant rodent species. A significant difference was observed in the time period of isolation of these agents. Borrelia was cultured from May to January (PCR detected borrelia up to April), while F. tularensis was isolated from August to December. Coinfection was seen in two species of voles, Clethrionomys glareolus trapped in August and Microtus arvalis in October. The Borrelia strains isolated from these animals were identified as B. garinii. Isolates of F. tularensis belonged to the subspecies holarctica, biovar II (Vyrostekova et al., 2002).
        7. Black-tailed prairie dog :
          • Ontology: UMLS:C0032898
          • GenBank Taxonomy No.: 45480
          • Scientific Name: Cynomys ludovicianus (NCBI Taxonomy)
          • Description: Oropharyngeal tularemia was identified as the cause of a die-off in captured wild prairie dogs at a commercial exotic animal facility in Texas. From this point source, Francisella tularensis-infected prairie dogs were traced to animals distributed to the Czech Republic and to a Texas pet shop. F. tularensis culture isolates were recovered tissue specimens from 63 prairie dogs, including one each from the secondary distribution sites. All seropositive animals remained culture positive, suggesting that prairie dogs may act as chronic carriers of F. tularensis (Petersen et al., 2004).
        8. Common vole :
          • Ontology: UMLS:C1013156
          • GenBank Taxonomy No.: 47230
          • Scientific Name: Microtus arvalis (NCBI Taxonomy)
          • Description: A five-year ecological study of the largest tularemia natural focus in Croatia (Yugoslavia) has revealed that the focus is of a meadow-field type and that the common vole is the crucial member of the local tularemia pathobiocenosis (Borcic et al., 1976). During the tularemia epizooty of 1981-1982 the population of common voles (Microtus arvalis) was very numerous, while the population of house mice (Mus musculus) was comparatively scarce. Francisella tularensis strains were isolated from different species of rodents (Microtus arvalis, Mus musculus, Apodemus sylvanicus, Rattus norvegicus, Lepus, etc.), from fleas and ticks, as well as from environmental objects (well-water, hay) (Nekrasov et al., 1985).
        9. Eurasian pygmy shrew :
          • Ontology: UMLS:C1023350
          • GenBank Taxonomy No.: 62280
          • Scientific Name: Sorex minutus (NCBI Taxonomy)
          • Description: A total of 155 F. tularensis strains were examined in biological tests, including 65 strains isolated in Slovakia from different species of small mammals and 90 strains isolated from ectoparasites (Gurycova, 1998). Survey of F. tularensis strains isolated from animals in Slovakia. Species: Sorex minutus. Number of isolates: 1. Years of Isolation: 1978. District: Senica (Gurycova, 1998).
        10. European woodmouse; long-tailed field mouse :
          • Ontology: UMLS:C0999696
          • GenBank Taxonomy No.: 10129
          • Scientific Name: Apodemus sylvaticus (NCBI Taxonomy)
          • Description: In a survey of F. tularensis strains isolated from animals in Slovakia, a total of twelve isolates of F. tularensis was isolated from the long-tailed field mouse (Apodemus sylvaticus) in the districts of Dunajska Streda and Senica between 1978 and 1996 (Gurycova, 1998).
        11. Ground vole, European water vole :
          • Ontology: UMLS:C0999654
          • GenBank Taxonomy No.: 10050
          • Scientific Name: Arvicola terrestris (NCBI Taxonomy)
          • Description: Two subspecies of F. tularensis are most commonly associated with human and animal disease: tularensis (Type A) and holarctica (Type B). Type A is found almost exclusively in North America and is associated with a severe form of disease in humans and rabbits (Lepus spp.). It is commonly differentiated from Type B by its ability to produce acid from glycerol. Type B is found throughout the Northern Hemisphere (holarctic region); it does not produce acid from glycerol and rarely causes death in humans. Type B is most frequently isolated from rodent species, including muskrats (Ondatra zibethicus), mice (Mus musculus), beaver (Castor canadensis), voles (Microtus spp.), and water voles (Arvicola terrestris) (Petersen et al., 2004).
        12. Hamsters :
          • Ontology: UMLS:C0018557
          • GenBank Taxonomy No.: 10026
          • Scientific Name: Cricetinae (NCBI Taxonomy)
          • Description: Pet hamsters are a potential source of tularemia (MMWR, 2005(b)).
        13. Lemmings :
          • Ontology: UMLS:C0023295
          • GenBank Taxonomy No.: 79948
          • Scientific Name: Lemmus (NCBI Taxonomy)
          • Description: Lemmings and beavers in Scandinavia might also play a role in the maintenance of Francisella tularensis in watercourses (Ellis et al., 2002).
        14. Microtus subterraneus, Pitymys subterraneus :
          • Ontology: UMLS:C1066623
          • GenBank Taxonomy No.: 37712
          • Scientific Name: Microtus subterraneus, Pitymys subterraneus (NCBI Taxonomy)
          • Description: A total of 155 F. tularensis strains were examined in biological tests, including 65 strains isolated in Slovakia from different species of small mammals and 90 strains isolated from ectoparasites (Gurycova, 1998). Survey of F. tularensis strains isolated from animals in Slovakia. Species: Pitymys subterraneus. Number of isolates: 1. Years of Isolation: 1978. District: Senica (Gurycova, 1998).
        15. Muskrat :
          • Ontology: UMLS:C1095815
          • GenBank Taxonomy No.: 10060
          • Scientific Name: Ondatra zibethicus (NCBI Taxonomy)
          • Description: Beavers and muskrats in North America and lemmings and beavers in Scandinavia might also play a role in the maintenance of the bacterium in watercourses (Ellis et al., 2002). F. tularensis subsp. holarctica, is often associated with beavers and muskrats in North America (Johansson et al., 2000 (b)).
        16. Southern water shrew :
          • Ontology: UMLS:C1016937
          • GenBank Taxonomy No.: 52814
          • Scientific Name: Neomys anomalus (NCBI Taxonomy)
          • Description: A total of 155 F. tularensis strains were examined in biological tests, including 65 strains isolated in Slovakia from different species of small mammals and 90 strains isolated from ectoparasites (Gurycova, 1998). Survey of F. tularensis strains isolated from animals in Slovakia. Species: Neomys anomalus. Number of isolates: 1. Years of Isolation: 1978. District: Senica (Gurycova, 1998).
        17. Water vole :
          • Ontology: UMLS:C1052789
          • GenBank Taxonomy No.: 111840
          • Scientific Name: Microtus richardsoni (NCBI Taxonomy)
          • Description: Shedding nephritis in voles with chronic tularemia is the probable source of frequent contamination of streams over wide areas of the northern hemisphere (Bell and Stewart, 1983).
        18. Yellow-necked field mouse :
          • Ontology: UMLS:C1017943
          • GenBank Taxonomy No.: 54292
          • Scientific Name: Apodemus flavicollis (NCBI Taxonomy)
          • Description: Marked activation of natural foci of tularemia in the known endemic area of Central Europe, comprising the borderland of Slovakia, Austria and the Czech Republic, led to an epidemic outbreak in western Slovakia and an increase in the number of human tularemia cases in the adjoining regions of northeastern Austria and southern Moravia from 1995 to 1997 (Gurycova et al., 2001). In four localities under investigation (three localities in western Slovakia and one in Austria), a nearly simultaneous flare-up of tularemia epizootics was recorded in the autumn of 1994. The highest mean prevalence of infection in small mammals was 3.9% in the last quarter of the year, which along with isolations of F. tularensis from Dermacentor reticulatus ticks collected from vegetation in the locality of Austria (1.3% positivity), indicated the high epizootic activity of foci. F. tularensis was isolated from five rodent species--Apodemus flavicollis, A. sylvaticus, Clethrionomys glareolus, Microtus arvalis and Sorex araneus (Gurycova et al., 2001). From 1978 to 1994, a total of twelve F. tularensis strains was isolated from the yellow-necked field mouse (Apodemus flavicollis) in Slovakia (Gurycova, 1998).
        19. Eastern cottontail :
          • Ontology: UMLS:C0999633
          • GenBank Taxonomy No.: 9988
          • Scientific Name: Sylvilagus floridanus (NCBI Taxonomy)
          • Description: Cottontail rabbits (Sylvilagus floridanus) usually are thought to succumb to infection with Francisella tularensis. Reports of a rabbit population from southern Illinois (USA) with a high prevalence of F. tularensis antibodies suggested that some cottontails survived infection with this typically fatal bacterium. Our goal was to examine the humoral response of cottontails from a study area in southern Illinois for which multiple serum samples existed. Multiple sera were collected from 79 cottontails from 1986 to 1990 and 63% gained, lost, or maintained ELISA titers of IgM and IgG isotype antibodies. The typical pattern of antibody response appeared to be IgM isotype antibodies first, followed by IgG isotype antibodies, with both generally increasing to high titers. Negative culture attempts of liver tissue from 51 cottontails with varying antibody responses suggested that chronic infection did not occur in rabbits that developed antibody. The significance of the cottontail antibody response in resolution or prevention of tularemia infection remains unclear (Shoemaker et al., 1997).
        20. European hare :
          • Ontology: UMLS:C0999631
          • GenBank Taxonomy No.: 9983
          • Scientific Name: Lepus europaeus (NCBI Taxonomy)
          • Description: To elucidate the importance of different causes of mortality which could explain the downward trend of the hare populations in Switzerland and for monitoring selected zoonoses, the health and reproductive status of 167 perished brown hares (Lepus europaeus) was assessed. Concerning causes of mortality, traumas were by far the most frequent diagnosis, 80% of the hares dying because of injuries. Animals killed by road traffic were highly represented. Predators (such as dogs, domestic cats, lynx, martens, buzzards, and golden eagles) killed 16% of the analysed animals. In juveniles, predation was significantly more frequent than in adults. Infectious diseases led to death in 15% of the animals, and cases of pasteurellosis, brucellosis, pseudotuberculosis, tularaemia, listeriosis, and toxoplasmosis were diagnosed (Haerer et al., 2004).
        21. Mountain hare :
          • Ontology: UMLS:C1023637
          • GenBank Taxonomy No.: 62621
          • Scientific Name: Lepus timidus (NCBI Genome)
          • Description: The occurrence of tularemia was studied in 1,500 hares submitted to the National Veterinary Institute, Uppsala, Sweden for postmortem examination during 1973 through 1985. A total of 109 tularemia cases was recorded based on the fluorescent antibody (FA) test for Francisella tularensis and on the gross and microscopic pathology. Tularemia was diagnosed only in the varying hare (Lepus timidus) and not in the European brown hare (Lepus europaeus) (Morner et al., 1988).
        22. American black bear :
          • Ontology: UMLS:C0325019
          • GenBank Taxonomy No.: 9643
          • Scientific Name: Ursus americanus (NCBI Taxonomy)
          • Description: Between 1988 and 1991, 644 serum samples were collected from 480 grizzly bears (Ursus arctos horribilis) and 40 black bears (Ursus americanus) from Alaska, United States of America, and were tested for selected canine viral infections and zoonoses. Antibody prevalence in grizzly bears was 0% for parvovirus, 8.3% (40/480) for distemper, 14% (68/480) for infectious hepatitis, 16.5% (79/480) for brucellosis, 19% (93/480) for tularaemia and 47% (225/478) for trichinellosis. In black bears, prevalence ranged from 0% for distemper and parvovirus to 27.5% for trichinellosis and 32% for tularaemia. Antibody prevalence for brucellosis (2.5%) and tularaemia (32%) were identical for grizzly bears and black bears from the geographical area of interior Alaska (Chomel et al., 1998).
        23. Cat; domestic cat; Korat cats :
          • Ontology: UMLS:C0007450
          • GenBank Taxonomy No.: 9685
          • Scientific Name: Felis catus; Felis domesticus; Felis silvestris catus (NCBI Taxonomy)
          • Description: Ten cases of naturally occurring tularemia in cats were positive both by isolation of F. tularensis and immunohistochemical identification of F. tularensis antigen. Nine additional cases with lesions typical of tularemia were positive for F. tularensis antigen, although bacterial cultures were not performed (DeBey et al., 2002). Cats living in Connecticut and New York State were naturally exposed to F. tularensis or a closely related organism. With exposure to ticks, other biting arthropods, mice, and rabbits, cats are at risk for acquiring F.tularensis infections and can be an important source of information on the presence of this agent in nature (Magnarelli et al., 2006).
        24. Coyote :
          • Ontology: UMLS:C0325005
          • GenBank Taxonomy No.: 9614
          • Scientific Name: Canis latrans (NCBI Taxonomy)
          • Description: Swift foxes (Vulpes velox) and coyotes (Canis latrans) are sympatric canids distributed throughout many regions of the Great Plains of North America. The prevalence of canid diseases among these two species where they occur sympatrically is presently unknown. From January 1997 to January 2001, we collected blood samples from 89 swift foxes and 122 coyotes on the US Army Pinon Canyon Maneuver Site, Las Animas County, SE Colorado (USA) (Gese et al., 2004). No swift foxes had antibodies against Francisella tularensis, whereas seroprevalence was 4% among both adult and juvenile coyotes (Gese et al., 2004).
        25. Least weasel :
          • Ontology: UMLS:C1006148
          • GenBank Taxonomy No.: 36239
          • Scientific Name: Mustela nivalis (NCBI Taxonomy)
          • Description: A total of 155 F. tularensis strains were examined in biological tests, including 65 strains isolated in Slovakia from different species of small mammals and 90 strains isolated from ectoparasites (Gurycova, 1998). Survey of F. tularensis strains isolated from animals in Slovakia. Species: Mustela nivalis. Number of isolates: 3. Years of Isolation: 1978. District: Senica (Gurycova, 1998).
        26. Ursus arctos horribilis :
          • Ontology: UMLS:C0325021
          • GenBank Taxonomy No.: 116960
          • Scientific Name: Ursus arctos horribilis (NCBI Taxonomy)
          • Description: Between 1988 and 1991, 644 serum samples were collected from 480 grizzly bears (Ursus arctos horribilis) and 40 black bears (Ursus americanus) from Alaska, United States of America, and were tested for selected canine viral infections and zoonoses. Antibody prevalence in grizzly bears was 0% for parvovirus, 8.3% (40/480) for distemper, 14% (68/480) for infectious hepatitis, 16.5% (79/480) for brucellosis, 19% (93/480) for tularaemia and 47% (225/478) for trichinellosis. In black bears, prevalence ranged from 0% for distemper and parvovirus to 27.5% for trichinellosis and 32% for tularaemia. Antibody prevalence for brucellosis (2.5%) and tularaemia (32%) were identical for grizzly bears and black bears from the geographical area of interior Alaska (Chomel et al., 1998).
        27. European shrew :
          • Ontology: UMLS:C1010036
          • GenBank Taxonomy No.: 42254
          • Scientific Name: Sorex araneus (NCBI Taxonomy)
          • Description: Marked activation of natural foci of tularemia in the known endemic area of Central Europe, comprising the borderland of Slovakia, Austria and the Czech Republic, led to an epidemic outbreak in western Slovakia and an increase in the number of human tularemia cases in the adjoining regions of northeastern Austria and southern Moravia from 1995 to 1997 (Gurycova et al., 2001). In four localities under investigation (three localities in western Slovakia and one in Austria), a nearly simultaneous flare-up of tularemia epizootics was recorded in the autumn of 1994. The highest mean prevalence of infection in small mammals was 3.9% in the last quarter of the year, which along with isolations of F. tularensis from Dermacentor reticulatus ticks collected from vegetation in the locality of Austria (1.3% positivity), indicated the high epizootic activity of foci. F. tularensis was isolated from five rodent species--Apodemus flavicollis, A. sylvaticus, Clethrionomys glareolus, Microtus arvalis and Sorex araneus (Gurycova et al., 2001).

    2. Infection Process:

      No infection process information is currently available here.

    3. Disease Information:

      No disease information is currently available here.

    4. Prevention:

      No prevention information is currently available here.

    5. Model System:

      No model system information is currently available here.

  3. Arthropods:
    1. Taxonomy Information:
      1. Species:
        1. American dog tick :
          • Ontology: UMLS:C0011596
          • GenBank Taxonomy No.: 34621
          • Scientific Name: Dermacentor variabilis (NCBI Taxonomy)
          • Description: In the United States, several blood-feeding arthropods serve as vectors for F. tularensis, including ticks (Ixodidae) and biting flies (Tabanidae). Three ixodid tick species are important vectors in the United States: the American dog tick (Dermacentor variabilis), the Rocky Mountain wood tick (D. andersoni), and the Lone Star tick (Amblyomma americanum) (Farlow et al., 2005).
        2. Castor bean tick :
          • Ontology: UMLS:C0282509
          • GenBank Taxonomy No.: 34613
          • Scientific Name: Ixodes ricinus (NCBI Taxonomy)
          • Description: F. tularensis subsp. tularensis isolates in North America are often associated with tick-borne tularemia in lagomorphs and are highly virulent for many mammalian species, including primates (Johansson et al., 2000 (b)). Dermacentor reticulatus revealed a significantly higher infection rate (2.6%) than I. ricinus (0.2%). This tick species acts as principal vector for tularemia in the enzootic focus (Hubalek et al., 1996).
        3. Dermacentor reticulatus :
          • Ontology: UMLS:C0323438
          • GenBank Taxonomy No.: 57047
          • Scientific Name: Dermacentor reticulatus (NCBI Taxonomy)
          • Description: Twenty-one isolates of Francisella tularensis were recovered from two haematophagous arthropods. Dermacentor reticulatus revealed a significantly higher infection rate (2.6%) than I. ricinus (0.2%). This tick species acts as principal vector for tularemia in the enzootic focus (Hubalek et al., 1996).
        4. Haemaphysalis concinna :
          • Ontology: UMLS:C0323449
          • Scientific Name: Haemaphysalis concinna (Gurycova, 1998)
          • Description: A total of 155 F. tularensis strains were examined in biological tests, including 65 strains isolated in Slovakia from different species of small mammals and 90 strains isolated from ectoparasites (Gurycova, 1998). Survey of F. tularensis strains isolated from ectoparasites in Slovakia. Species: Haemaphysalis concinna. Number of isolates: 3. Years of Isolation: 1984-1987. District: Bratislava, Senica (Gurycova, 1998).
        5. Ixodes trianguliceps :
          • Ontology: UMLS:C1639687
          • GenBank Taxonomy No.: 347913
          • Scientific Name: Ixodes trianguliceps (NCBI Taxonomy)
          • Description: A total of 155 F. tularensis strains were examined in biological tests, including 65 strains isolated in Slovakia from different species of small mammals and 90 strains isolated from ectoparasites (Gurycova, 1998). Survey of F. tularensis strains isolated from ectoparasites in Slovakia. Species: Ixodes trianguliceps. Number of isolates: 14. Years of Isolation: 1984-1996. District: Bratislava, Bratislava-surroundings, Levice, Nitra, Nove Zamky, Trnava (Gurycova, 1998).
        6. Lone Star tick :
          • Ontology: UMLS:C0323498
          • GenBank Taxonomy No.: 6943
          • Scientific Name: Amblyomma americanum (NCBI Taxonomy)
          • Description: In the United States, several blood-feeding arthropods serve as vectors for F. tularensis, including ticks (Ixodidae) and biting flies (Tabanidae). Three ixodid tick species are important vectors in the United States: the American dog tick (Dermacentor variabilis), the Rocky Mountain wood tick (D. andersoni), and the Lone Star tick (Amblyomma americanum) (Farlow et al., 2005).
        7. Rocky Mountain wood tick; Rocky Mountain tick :
          • Ontology: UMLS:C0323431
          • GenBank Taxonomy No.: 34620
          • Scientific Name: Dermacentor andersoni (NCBI Taxonomy)
          • Description: Common wood ticks (Dermacentor andersoni) collected from Saskatchewan Landing Provincial Park, Saskatchewan in the spring of 1982 transmitted a lethal tularaemia infection to four of six rabbits. Francisella tularensis organisms were isolated from tissues taken from the dead rabbits and identified from subcultures using an indirect immunofluorescent antibody assay. One human associated with the animals developed symptoms of tularaemia and, after successful therapy, had a significant increase in titre of specific antibodies to F. tularensis. This is the first time tick-transmitted tularaemia has been reported in Saskatchewan in more than 25 years (Gordon et al., 1983).
        8. Androlaelaps fahrenholzi :
          • Scientific Name: Androlaelaps fahrenholzi (Gurycova, 1998)
          • Description: A total of 155 F. tularensis strains were examined in biological tests, including 65 strains isolated in Slovakia from different species of small mammals and 90 strains isolated from ectoparasites (Gurycova, 1998). Survey of F. tularensis strains isolated from ectoparasites in Slovakia. Species: Androlaelaps fahrenholzi. Number of isolates: 1. Years of Isolation: 1988. District: Bratislava-surroundings (Gurycova, 1998).
        9. Euryparasitus emarginatus :
          • Scientific Name: Euryparasitus emarginatus (Gurycova, 1998)
          • Description: A total of 155 F. tularensis strains were examined in biological tests, including 65 strains isolated in Slovakia from different species of small mammals and 90 strains isolated from ectoparasites (Gurycova, 1998). Survey of F. tularensis strains isolated from ectoparasites in Slovakia. Species: Euryparasitus emarginatus. Number of isolates: 1. Years of Isolation: 1988. District: Bratislava-surroundings (Gurycova, 1998).
        10. Laelaps agilis :
          • Scientific Name: Laelaps agilis (Gurycova, 1998)
          • Description: A total of 155 F. tularensis strains were examined in biological tests, including 65 strains isolated in Slovakia from different species of small mammals and 90 strains isolated from ectoparasites (Gurycova, 1998). Survey of F. tularensis strains isolated from ectoparasites in Slovakia. Species: Laelaps agilis. Number of isolates: 2. Years of Isolation: 1988-1992. District: Bratislava, Senica (Gurycova, 1998).
        11. Ctenophthalmus agyrtes :
          • Ontology: UMLS:C1677952
          • GenBank Taxonomy No.: 309191
          • Scientific Name: Ctenophthalmus agyrtes (NCBI Taxonomy)
          • Description: A total of 155 F. tularensis strains were examined in biological tests, including 65 strains isolated in Slovakia from different species of small mammals and 90 strains isolated from ectoparasites (Gurycova, 1998). Survey of F. tularensis strains isolated from ectoparasites in Slovakia. Species: Ctenophthalmus agyrtes. Number of isolates: 6. Years of Isolation: 1986. District: Bratislava (Gurycova, 1998).
        12. Ctenophthalmus assimilis :
          • Scientific Name: Ctenophthalmus assimilis (Gurycova, 1998)
          • Description: A total of 155 F. tularensis strains were examined in biological tests, including 65 strains isolated in Slovakia from different species of small mammals and 90 strains isolated from ectoparasites (Gurycova, 1998). Survey of F. tularensis strains isolated from ectoparasites in Slovakia. Species: Ctenophthalmus assimilis. Number of isolates: 2. Years of Isolation: 1986. District: Bratislava, Bratislava-surroundings (Gurycova, 1998).
        13. Megabothris turbidus :
          • Scientific Name: Megabothris turbidus (Gurycova, 1998)
          • Description: A total of 155 F. tularensis strains were examined in biological tests, including 65 strains isolated in Slovakia from different species of small mammals and 90 strains isolated from ectoparasites (Gurycova, 1998). Survey of F. tularensis strains isolated from ectoparasites in Slovakia. Species: Megabothris turbidus. Number of isolates: 7. Years of Isolation: 1979-1986. District: Bratislava (Gurycova, 1998).
        14. Nosopsyllus fasciatus :
          • Ontology: UMLS:C0323233
          • Scientific Name: Nosopsyllus fasciatus (Gurycova, 1998)
          • Description: A total of 155 F. tularensis strains were examined in biological tests, including 65 strains isolated in Slovakia from different species of small mammals and 90 strains isolated from ectoparasites (Gurycova, 1998). Survey of F. tularensis strains isolated from ectoparasites in Slovakia. Species: Nosopsyllus fasciatus. Number of isolates: 1. Years of Isolation: 1994. District: Senica (Gurycova, 1998).
        15. Mosquitos, mosquitoes :
          • Ontology: UMLS:C0026584
          • GenBank Taxonomy No.: 7157
          • Scientific Name: Culicidae (NCBI Taxonomy)
          • Description: Tularemia is a zoonotic disease which, in Scandinavia, is usually acquired through a mosquito bite (Karhukorpi and Karhukorpi, 2001). A widespread outbreak of tularemia in Sweden in 2000 was investigated in a case-control study in which 270 reported cases of tularemia were compared with 438 controls. The outbreak affected parts of Sweden where tularemia had hitherto been rare, and these "emergent" areas were compared with the disease-endemic areas. Multivariate regression analysis showed mosquito bites to be the main risk factor, with an odds ratio (OR) of 8.8 (Eliasson et al., 2002).
        16. Deer flies :
          • Ontology: UMLS:C0323005
          • GenBank Taxonomy No.: 27458
          • Scientific Name: Chrysops (NCBI Taxonomy)
          • Description: Tularemia epidemic has been associated with the deerfly (Klock et al., 1973).

    2. Infection Process:

      No infection process information is currently available here.

    3. Disease Information:

      No disease information is currently available here.

    4. Prevention:

      No prevention information is currently available here.

    5. Model System:

      No model system information is currently available here.

  4. Acanthamoeba:
    1. Taxonomy Information:
      1. Species:
        1. Acanthamoeba castellanii :
          • Ontology: UMLS:C0320458
          • GenBank Taxonomy No.: 5755
          • Scientific Name: Acanthamoeba castellanii (NCBI Taxonomy)
          • Description: Francisella tularensis is a highly infectious, facultative intracellular bacterium which causes epidemics of tularemia in both humans and mammals at regular intervals. The natural reservoir of the bacterium is largely unknown, although it has been speculated that protozoa may harbor it. To test this hypothesis, Acanthamoeba castellanii was cocultured with a strain of F. tularensis engineered to produce green fluorescent protein (GFP) in a nutrient-rich medium. GFP fluorescence within A. castellanii was then monitored by flow cytometry and fluorescence microscopy. In addition, extracellular bacteria were distinguished from intracellular bacteria by targeting with monoclonal antibodies. Electron microscopy was used to determine the intracellular location of F. tularensis in A. castellanii, and viable counts were obtained for both extracellular and intracellular bacteria. The results showed that many F. tularensis cells were located intracellularly in A. castellanii cells. The bacteria multiplied within intracellular vacuoles and eventually killed many of the host cells. F. tularensis was found in intact trophozoites, excreted vesicles, and cysts. Furthermore, F. tularensis grew faster in cocultures with A. castellanii than it did when grown alone in the same medium. This increase in growth was accompanied by a decrease in the number of A. castellanii cells. The interaction between F. tularensis and amoebae demonstrated in this study indicates that ubiquitous protozoa might be an important environmental reservoir for F. tularensis (Abd et al., 2003).

    2. Infection Process:

      No infection process information is currently available here.

    3. Disease Information:

      No disease information is currently available here.

    4. Prevention:

      No prevention information is currently available here.

    5. Model System:

      No model system information is currently available here.


IV. Labwork Information

A. Biosafety Information:
  1. General biosafety information :
    • Biosafety Level: Biosafety level 2 practices and containment should be used for routine diagnostic activities with clinical materials. Biosafety level 3 practices, containment, and facilities should be used for all manipulations of cultures and for experimental studies involving infectious materials with a potential for aerosol and droplet production (centrifuging, grinding, vigorous shaking, growing cultures in volume, and animal studies) (Dennis et al., 2001).
    • Applicable: The cultivation of F. tularensis poses a considerable risk of laboratory-acquired infection. Laboratory work should therefore be performed under biosafety level 3 (BSL-3) conditions (Fujita et al., 2006).
    • Precautions:
      • Laboratory coat, impervious gloves, and gown (with tight wrists and a tie in the back) should be worn when working with Francisella tularensis. Face masks should be worn when working with infectious material in biosafety cabinet. Bodies of patients who die of tularemia should be handled using standard precautions. Autopsy procedures likely to cause aerosols, such as bone sawing, should be avoided. Clothing or linens contaminated with body fluids of patients infected with F. tularensis should be disinfected per standard precaution protocols such as steam sterilization. Persons handling animals, especially rabbits, should wear impervious gloves. F. tularensis is susceptible to 1% sodium hypochlorite (10% bleach) and standard levels of chlorine in municipal water sources should be protective (Dennis et al., 2001).
    • Disposal:
      • Decontamination before disposal, incineration of animal carcasses, steam sterilization of other laboratory waste
B. Culturing Information:
  1. Thayer-Martin agar plate culture :
    1. Description: Thayer-Martin agar plates, were incubated at 37 C in 5% CO(2) for 6 days. Growth of F. tularensis was confirmed by the slide agglutination test with a commercial antiserum, biochemical analysis, and DNA amplification by PCR (Sjostedt et al., 1997).

    2. Medium:
      1. Thayer-Martin agar
    3. Optimal Temperature: 37 C
    4. Note:
  2. Mueller-Hinton broth culture :
    1. Description: F. tularensis cells (no. 29684; American Type Culture Collection) were grown and quantitated essentially as described with the following modifications: the bacterial stock was streaked on a Mueller-Hinton broth agar plate containing 1% ferric pyrophosphate, 10% glucose, and 2.5% fetal calf serum and incubated at 37 C in 5% CO(2) for 4 days. A single colony was used to inoculate M-H broth and incubated with gentle shaking at 37 C under 5% CO(2) for approximately8 to 10 hours (Tomioka et al., 2005). Axenic culture in Mueller-Hinton Broth: Francisella tularensis can be grown axenically in modified Mueller-Hinton broth (Fortier et al., 1995). The addition of 0.025% ferric pyrophosphate appeared to enhance growth in this medium (Ellis et al., 2002).

    2. Medium:
      1. Mueller-Hinton broth agar plate containing 1% ferric pyrophosphate, 10% glucose, and 2.5% fetal calf serum (Tomioka et al., 2005). F. tularensis LVS (ATCC 29684; American Type Culture Collection) was cultured on Mueller-Hinton agar supplemented with ferric PPi and IsoVitaleX for 4 days at 37 C in 5% CO(2) at 95% humidity. Selected colonies were grown in modified Mueller-Hinton broth for 24 to 36 h until bacterial density reached 10(8) to 10(9) CFU/ml (Fortier et al., 1995).
    3. Optimal Temperature: 37 C (Tomioka et al., 2005)
    4. Optimal Humidity: 95% (Fortier et al., 1995)
    5. Note: The culture was monitored at OD (600nm) and stopped when it reached 0.15 to 0.2 (approximately 1 x 10(8) cells per ml.) indicating early to mid-log phase
  3. Cysteine heart agar culture :
    1. Description: F. tularensis can be grown from such things as pharyngeal washings, sputum specimens, blood, and fasting gastric aspirates. Although growth may be visible as early as 24-48 hours after inoculation, growth may be delayed and cultures should be held for at least 10 days before discarding. Under ideal conditions, bacterial colonies on cysteine-enriched agar are typically 1 mm in diameter after 24-48 hours of incubation, white to gray to bluish-gray, opaque, flat with an entire edge, smooth, and may have a shiny surface. By 96 hours, the colonies are typically 3-5 mm in diameter. On cysteine heart agar, F. tularensis colonies are characteristically opalescent and do not discolor the medium (Dennis et al., 2001).

    2. Medium:
      1. F. tularensis grows best in cysteine-enriched broth and thioglycollate broth. It grows best on cysteine heart blood agar, sheep blood agar, and on cysteine-supplemented agar such as buffered charcoal-yeast agar, Thayer-Martin agar, and chocolate agar. Selective agar may be useful when culturing materials from nonsterile sites, such as sputum (Dennis et al., 2001).
    3. Optimal Temperature: 37 C (Dennis et al., 2001)
  4. Axenic culture in thioglycollate broth :
    1. Description: Francisella tularensis can be grown axenically in thioglycollate broth. In static thioglycollate broth, growth is first seen as a dense band near the top which diffuses throughout as growth progresses (Ellis et al., 2002).

    2. Medium:
      1. Thioglycollate broth (Ellis et al., 2002)
  5. Dulbecco Modified Eagle Medium (DMEM) :
    1. Description: Murine macrophages support exponential intracellular growth of Francisella tularensis LVS where it remains in a vacuolar compartment throughout its growth cycle. Macrophages (from a peritoneal cell preparation) are adjusted to 1 million cells per ml and incubated as cell pellets in polypropylene tubes in 5% CO(2) at 37 C before exposure to the bacteria. The macrophages are subsequently exposed to F. tularensis LVS at a multiplicity of infection of 1 for 2 hours at 37 C in 5% CO(2) in a humid environment (Fortier et al., 1995).

    2. Medium:
      1. Murine macrophages and associated F. tularensis bacteria were grown in Dulbecco Modified Eagle Medium (DMEM) with 10% heat-inactivated fetal bovine serum (Fortier et al., 1995).
    3. Optimal Temperature: 37 C (Fortier et al., 1995)
    4. Optimal Humidity: Humid environment (Fortier et al., 1995)
    5. doubling-time: 4 to 6 hours (Fortier et al., 1995)
  6. Tryptic soy broth (TSB) culture :
    1. Description: Axenic culture in TSB-C. Anthony et al. showed that Francisella tularensis grew in a cell-free medium of tryptic soy broth supplemented with 0.1% cysteine (Anthony et al., 1991). However, growth is slow and requires a large inoculum to obtain visible growth within 24 hours (Ellis et al., 2002).

    2. Medium:
      1. Francisella tularensis can be cultured in tryptic soy broth supplemented with 0.1% cysteine (TSB-C) (Anthony et al., 1991).
  7. Sheep Blood Agar (SBA) :
    1. Description: F. tularensis grows in commercial blood culture media. These organisms require cysteine supplementation; therefore, F. tularensis may at first grow on SBA, but upon subsequent passage will fail to grow on standard SBA. On cysteine supplemented agar plates, it is a gray-white, opaque colony, usually too small to be seen at 24 h on most general media such as Chocolate agar (CA), Thayer-Martin (TM) agar, and buffered charcoal yeast extract (BCYE). After incubation for 48 h or more, colonies are about 1-2 mm in diameter, white to grey to bluish-grey, opaque, flat, with an entire edge, smooth, and have a shiny surface. F. tularensis will not grow on MacConkey agar or eosin methylene blue (EMB) plates (CDC et al., 2001).

C. Diagnostic Tests :
  1. Organism Detection Tests:
    1. Light Microscopy:
      1. Time to Perform: unknown
      2. Description: By light microscopy, the organism is characterized by its small size (0.2 um x 0.2-0.7 um), pleomorphism, and faint staining. It does not show the bipolar staining characteristics of Yersinia pestis, the agent of plague, and is easily distinguished from the large gram-positive rods characteristic of vegetative forms of Bacillus anthracis. Microscopic demonstration of F tularensis using fluorescent-labeled antibodies is a rapid diagnostic procedure performed in designated reference laboratories in the National Public Health Laboratory Network; test results can be made available within several hours of receiving the appropriate specimens if the laboratory is alerted and prepared (Dennis et al., 2001).

  2. Immunoassay Tests:
    1. Enzyme Immunoassay (EIA):
      1. Ontology: UMLS:C0086231
      2. Time to Perform: 1-to-2-days
      3. Description: For EIA, microplates were coated with a carbohydrate-protein complex of F. tularensis. Serum samples diluted twofold from 1/16 were assayed for immunoglobulin G (IgG) and IgM antibodies. The upper limit of the reference range for IgG and IgM titers was 64. A fourfold increase in titer or a titer of greater or equal 256 was considered to confirm the diagnosis (Sjostedt et al., 1997).
    2. Enzyme-Linked Immunosorbent Assay (ELISA):
      1. Ontology: UMLS:C0014441
      2. Time to Perform: 1-to-2-days
      3. Description: The conditions of the enzyme-linked immunosorbent assay (ELISA) for the detection of Francisella tularensis were worked out. In the study of 27 strains differing in their biological characteristics, the sensitivity of the assay was determined, varying within the range of 1 X 10(4) - 5 X 10(4) million cells/ml and exceeding the sensitivity of the currently used methods for the immunodiagnosis of tularemia by 1-2 orders. ELISA also proved to be a highly effective technique for the detection of the specific antigen in the organs of infected animals. The antigen was regularly detected in the organs of white mice, beginning from day 3 after their infection with the minimal doses of F. tularensis. The method may be recommended both for the identification of isolated cultures and for the early diagnosis of tularemia infection (Meshcheriakova et al., 1988).
    3. Capture Enzyme-Linked Immunosorbent Assay (cELISA):
      1. Time to Perform: 1-to-2-days
      2. Description: A new capture enzyme-linked immunosorbent assay (cELISA) based on monoclonal antibodies specific for lipopolysaccharide (LPS) of Francisella tularensis subsp. holarctica and Francisella tularensis subsp. tularensis. No cross-reactivity with Francisella tularensis subsp. novicida, Francisella philomiragia, and a panel of other possibly related bacteria, including Brucella spp., Yersinia spp., Escherichia coli, and Burkholderia spp., was observed. The detection limit of the assay was 10(3) to 10(4) bacteria/ml. This sensitivity was achieved by solubilization of the LPS prior to the cELISA. In addition, a novel immunochromatographic membrane-based handheld assay (HHA) and a PCR, targeting sequences of the 17-kDa protein (TUL4) gene of F. tularensis, were used in this study. Compared to the cELISA, the sensitivity of the HHA was about 100 times lower and that of the PCR was about 10 times higher. Whereas all infected samples were recognized by the cELISA, those with relatively low bacterial load were partially or not detected by PCR and HHA, probably due to inhibitors or lack of sensitivity. In conclusion, the HHA can be used as a very fast and simple approach to perform field diagnosis to obtain a first hint of an infection with F. tularensis, especially in emergent situations. In any suspect case, the diagnosis should be confirmed by more sensitive techniques, such as the cELISA and PCR (Grunow et al., 2000).

  3. Nucleic Acid Detection Tests: :
    1. Real-time PCR:
      1. Ontology: UMLS:C1709846
      2. Time to Perform: 1-hour-to-1-day
      3. Description: Tomaso and colleagues have developed a highly sensitive and specific assay that can be integrated into real-time PCR-based identification procedures for biological agents. The specificity of the assay was determined using a comprehensive panel of Francisella strains, clinically relevant bacteria, and DNA preparations of potential hosts. F. tularensis subsp. tularensis was specifically detected but no other organisms. The range of linearity was determined to be 100 fg to 10 ng, the lower limit of detection was 25 fg of DNA (13 genome equivalents). An internal amplification control PCR system targeting lambda phage DNA was included. Neither the internal amplification control nor host DNA influenced the cycle threshold values obtained for F. tularensis subsp. tularensis. This is a major diagnostic improvement, as all other methods for the specific identification of F. tularensis subsp. tularensis are more time consuming (Tomaso et al., 2006).
      4. Primers:
        • pdpDL_F, pdpDL_R
          • Forward: pdpDL_F: 5'-TGGGTTATTCAATGGCTCAG-3'
          • Reverse: pdpDL_R: 5'-TCTTGCACAGCTCCAAGAGT-3'
          • Real-time-probe: pdpD_FL: AGCAATACCTTATAATGAAGGTCTTCTAGAAAAT FL, and pdpD_LC: 640-CTGCTCAGCAGGATTTTGATTTG p Oligonucleotide primers and hybridization probes used in the PCR assays (FL, Fluorescein; 640, LightCycler-Red 640; 705, LightCycler-Red 705; p, 3'-phosphate)
        • Internal control: Lambda_F, Lambda_R
          • Forward: Lambda_F: 5'-ATGCCACGTAAGCGAAACA-3'
          • Reverse: Lambda_R: 5'-GCATAAACGAAGCAGTCGAGT-3'
          • Real-time-probe: Lambda_FL: CACTTCCCGAATAAC FL and Lambda_LC: 705-GGATATTTTTGATCTGACCGAAGCG p Oligonucleotide primers and hybridization probes used in the PCR assays (FL, Fluorescein; 640, LightCycler-Red 640; 705, LightCycler-Red 705; p, 3'-phosphate) An amplification control utilizing bacteriophage lambda DNA was used (Tomaso et al., 2006).
    2. Multiplex PCR Microarray Assay:
      1. Time to Perform: 1-hour-to-1-day
      2. Description: Tomioka and coworkers developed and optimized a multiplex polymerase chain reaction microarray assay to screen blood for three potential bioterror bacterial pathogens and a human ribosomal RNA gene internal control. The analytical sensitivity of the assay was demonstrated to be 50 colony-forming units/ml for Bacillus anthracis, Francisella tularensis, and Yersinia pseudotuberculosis (surrogate for Yersinia pestis). The absence of any false-positives demonstrated high analytical specificity. Screening B. anthracis-infected mouse blood samples and uninfected controls demonstrated effectiveness and specificity in a preclinical application. This study represents proof of the concept of microarray technology to screen simultaneously for multiple bioterror pathogens in blood samples (Tomioka et al., 2005).
      3. Primers:
        • TUL4-435, TUL4-863
          • Forward: TUL4-435: 5'-GCT GTA TCA TCA TTT AAT AAA CTG CTG-3'
          • Reverse: TUL4-863: 5'-TTGGGAAGCTTGTATCATGGCACT-3'
          • Product
            • Size: 407 bp
        • Internal control - primary (Human): HrRNAF, HrRNAR
          • Forward: HrRNAF: 5'-CGAAGACGATCAGATACCGT-3'
          • Reverse: HrRNAR: 5'-CAGCTTTGCAACCATACTCC-3'
        • Internal control -secondary (Human): HrRNAF, HrRNAL
          • Forward: HrRNAF: 5'-CGAAGACGATCAGATACCGT-3'
          • Reverse: HrRNAL: 5'-TTGCAACCATACTCCCCCCG-3'
        • Nested PCR (F. tularensis): FTf2, FTL
          • Forward: FTf2: 5'-CGCAGGTTTAGCGAGCTGTTC-3'
          • Reverse: FTL: 5'-GAAGCTTGTATCATGGCACTTAGA-3'
          • Product
            • Size: 265 bp
    3. Nested PCR:
      1. Ontology: UMLS:C0242574
      2. Time to Perform: 1-hour-to-1-day
      3. Description: A highly sensitive method for detection of Francisella tularensis in clinical samples based on a nested polymerase chain reaction (PCR) for the FopA gene have been developed. In this procedure, the best results were obtained when DNA was purified by binding to silica in the presence of the nuclease inhibitor guanidine thiocyanate. Using pure cultures of F. tularensis, the nested PCR could detect 100 colony forming units (CFU) / ml. When mice were infected with F. tularensis LVS, the nested PCR could detect F. tularensis in 9/9 spleen samples and 8/9 blood samples. The PCR-negative blood sample was also culture negative (Fulop et al., 1996).
      4. Primers:
        • FNA8L, FNB2L
          • Forward: FNA8L: 5'-CGA-GGA-GTC-TCA-ATG-TAC-TAA-GGT-TTG-CCC-3'
          • Reverse: FNB2L: 5'-CAC-CAT-TAT-CCT-GGA-TAT-TAC-CAG-TGT-CAT-3'
          • Product
            • Size: 900 bp
        • Nested Primers: FNA7L, FNB1L
          • Forward: FNA7L: 5'-CTT-GAG-TCT-TAT-GTT-TCG-GCA-TGT-GAA-TAG-3'
          • Reverse: FNB1L: 5'-CCA-ACT-AAT-TGG-TTG-TAC-TGT-ACA-GCG-AAG-3'
          • Product
            • Size: 409 bp
    4. Polymerase Chain Reaction (PCR):
      1. Ontology: UMLS:C0032520
      2. Time to Perform: 1-hour-to-1-day
      3. Description: The diagnosis of human cases of tularemia is usually confirmed by the demonstration of an antibody response to Francisella tularensis, which occurs about 2 weeks after the onset of disease. Due to a high risk of infection in the laboratory, cultivation of the causative agent tends to be avoided. During an outbreak in Sweden, the use of PCR for diagnosing the ulceroglandular form of tularemia was evaluated. Extraction and preparation of F. tularensis DNA from swab samples from the wounds of patients with tularemia involved the use of the nuclease inhibitor guanidine thiocyanate. The DNA was detected by multiplex PCR targeting the 16S rRNA gene and a 17-kDa lipoprotein gene of F. tularensis LVS. In 29 of 40 (73%) patients with serologically confirmed tularemia, F. tularensis DNA was successfully amplified. Considering the limitations of current diagnostic procedures, PCR may become useful for the early diagnosis of tularemia (Sjostedt et al., 1997).
      4. Primers:
        • 16S rRNA gene: FT5; FT11
          • Forward: FT5: 5'-CCTTTTTGAGTTTCGCTCC-3'
          • Reverse: FT11: 5'-TACCAGTTGGAAACGACTGT-3'
          • Product
            • Size: 1.1 kb
        • 17 kDa: TUL4-435; TUL4-863
          • Forward: TUL4-435: 5'-GCT GTA TCA TCA TTT AAT AAA CTG CTG-3'
          • Reverse: TUL4-863: 5'-TTG GGA AGC TTG TAT CAT GGC ACT-3'
          • Real-time-probe: To confirm the identity of the 17-kDa lipoprotein gene product, Southern blotting was performed. A fragment encompassing nucleotides 614 to 813 of the gene was used as the probe. The probe was labeled by random priming by incorporating digoxigenin-11-dUTP, according to the instructions of the manufacturer (Sjostedt et al., 1997).
          • Product
            • Size: 0.4-kb
    5. Polymerase Chain Reaction (PCR):
      1. Ontology: UMLS:C0032520
      2. Time to Perform: 1-hour-to-1-day
      3. Description: PCR offers a safe way to rapidly confirm diagnosis of tularemia. A 9-y-old boy with ulceroglandular tularemia was rapidly diagnosed with DNA amplification from a pus specimen. The result was obtained 4 h after the sample had been taken (Karhukorpi and Karhukorpi, 2001). A retrospective analysis to evaluate the clinical use of a diagnostic PCR for Francisella tularensis in patients with suspected ulceroglandular tularemia was performed. 154 samples, 129 from patients with definitive tularemia and 25 from patients where tularemia could be ruled out, were analyzed. The diagnostic PCR had a specificity of 96%, a sensitivity of 78.3%, and a Positive Predictive Value of 99%. Especially samples from encrusted lesions, even up to 4 weeks old, in patients with tularemia, were PCR positive to a high degree when taken properly. The diagnostic PCR is useful in suspected ulceroglandular tularemia, giving a fast and accurate diagnosis (Eliasson et al., 2005).
      4. Primers:
        • FT393, FT642
          • Forward: FT393: 5'-ATG GCG AGT GAT ACT GCT TG-3'
          • Reverse: FT642: 5'-GCA TCA TCA GAG CCA CCT AA-3'
          • Product
            • Size: 250 bp
    6. Real-time PCR:
      1. Ontology: UMLS:1709846
      2. Time to Perform: 1-hour-to-1-day
      3. Description: Fujita and coworkers established a real-time PCR assay using the LightCycler (LC) system to detect a Francisella-specific sequence of the outer membrane protein (fopA) gene. Twenty-five F. tularensis strains including 16 Japanese isolates were subjected to this LC-PCR assay, and were tested positive, whereas Francisella philomiragia and other bacteria species did not show any specific fluorescent signal. A linear response was observed using F. tularensis genomic DNAs of between 20 fg and 2 ng, corresponding to 1.2 to 1.2 x 10(5) bacteria. The newly established real-time PCR allows the detection of the F. tularensis genome specifically, sensitively, and rapidly. This assay may contribute to the standardization of the laboratory diagnosis of tularemia (Fujita et al., 2006).
      4. Primers:
        • Ft-F, FT-R
          • Forward: Ft-F: 5'-GGCAAATCTAGCAGGTCA-3' [824-841]
          • Reverse: FT-R: 5'-GCTGTAGTCGCACCATTATC-3' [1052-1073]
          • Real-time-probe: Ft-Flu: 5'-ATGGCAGAGCGGGTACTAACATGATTG-[FL]-3' [961-987] Ft-LcR: 5-[Red640]-TGCTGGTTTAACATGGTTCTTTGGTGG-Ph]-3' [989-1015] The two hybridization probes, Ft-Flu and Ft-LcR labeled with fluorescein (FL) or LightCycler Red640 (LcR) dye, respectively were designed to bind neighbored on the target DNA. NOTE: ([FL], Fluorescein; [Red640], LightCycler(Lc)-Red 640-N-hydroxy-succinimide ester; [Ph], 3'-phosphorylation) (Fujita et al., 2006).
          • Product
            • Size: 249 bp
    7. TaqMan PCR:
      1. Time to Perform: 1-hour-to-1-day
      2. Description: Versage and co-workers have developed a multitarget real-time TaqMan PCR assay capable of rapidly and accurately detecting F. tularensis in complex specimens. Targeted regions included the ISFtu2 element and the 23kDa, fopA, and tul4 genes. Analysis of the four TaqMan assays demonstrated that three (ISFtu2, 23kDa, and tul4) performed within an established criterion of a detection limit of one organism. The combined use of the three assays was highly specific, displaying no cross-reactivity with the non-Francisella bacteria tested and capable of differentially diagnosing both F. tularensis and Francisella philomiragia. When the multitarget TaqMan assay (ISFtu2, 23kDa, and tul4) was compared to culturing, using environmentally contaminated specimens, the TaqMan PCR assay was significantly more sensitive than culturing (P </= 0.05). The sensitive and specific nature of this rapid multitarget TaqMan assay provides a valuable new tool that with future evaluations can be used for analyzing clinical specimens, field samples during bioterrorism threat assessment, and samples from outbreaks (Versage et al., 2003).
      3. Primers:
        • ISFtu2 gene target: ISFtu2F, ISFtu2R
          • Forward: ISFtu2F: 5'-TTGGTAGATCAGTTGGTGGGATAAC-3'
          • Reverse: ISFtu2R: 5'-TGAGTTTTACCTTCTGACAACAATATTTC-3'
          • Real-time-probe: ISFtu2P: 5'-AAAATCCATGCTATGACTGATGCTTTAGGTAATCCA-3'
          • Product
            • Size: 97 bp
        • 23kDa gene target: 23kDaF, 23kDaR
          • Forward: 23kDaF: 5'-TGAGATGATAACAAGACAACAGGTAACA-3'
          • Reverse: 23kDaR: 5'-GGATGAGATCCTATACATGCAGTAGG-3'
          • Real-time-probe: 23kDaP: 5'-TCAGTTCTCACATGAATGGTCTCGCCA-3'
          • Product
            • Size: 84 bp
        • tul4 gene target: Tul4F, Tul4R
          • Forward: Tul4F: 5'-ATTACAATGGCAGGCTCCAGA-3'
          • Reverse: Tul4R: 5'-TGCCCAAGTTTTATCGTTCTTCT-3'
          • Real-time-probe: Tul4P: 5'-TTCTAAGTGCCATGATACAAGCTTCCCAATTACTAAG-3'
          • Product
            • Size: 91 bp
        • fopA gene target: FopAF, FopAR
          • Forward: FopAF: 5'-ATCTAGCAGGTCAAGCAACAGGT-3'
          • Reverse: FopAR: 5'-GTCAACACTTGCTTGAACATTTCTAGATA-3'
          • Real-time-probe: FopAP: 5'-CAAACTTAAGACCACCACCCACATCCCAA-3'
          • Product
            • Size: 87 bp

  4. Other Types of Diagnostic Tests:

    No other tests available here.


V. References

A. Journal References:
Abd et al., 2003: Abd H, Johansson T, Golovliov I, Sandstrom G, Forsman M. Survival and growth of Francisella tularensis in Acanthamoeba castellanii. Appl Environ Microbiol. 2003; 69(1): 600 - 606. [PubMed: 12514047].
Abd et al., 2003: Abd H, Johansson T, Golovliov I, Sandstrom G, Forsman M. Survival and growth of Francisella tularensis in Acanthamoeba castellanii. Appl Environ Microbiol. 2003; 69(1): 600 - 606. [PubMed: 12514047].
Al Dahouk et al., 2005: Al Dahouk S, Nockler K, Tomaso H, Splettstoesser WD, Jungersen G, Riber U, Petry T, Hoffmann D, Scholz HC, Hensel A, Neubauer H. Seroprevalence of brucellosis, tularemia, and yersiniosis in wild boars (Sus scrofa) from north-eastern Germany. J Vet Med B Infect Dis Vet Public Health. 2005; 52(10): 444 - 455. [PubMed: 16364020].
Anthony and Kongshavn, 1987: Anthony LS, Kongshavn PA. Experimental murine tularemia caused by Francisella tularensis, live vaccine strain: a model of acquired cellular resistance. Microb Pathog. 1987; 2(1): 3 - 14. [PubMed: 3507552].
Anthony et al., 1991: Anthony LD, Burke RD, Nano FE. Growth of Francisella spp. in rodent macrophages. Infect Immun. 1991; 59(9): 3291 - 3296. [PubMed: 1879943].
Arikan et al., 2003: Arikan OK, Koc C, Bozdogan O. Tularemia presenting as tonsillopharyngitis and cervical lymphadenitis: a case report and review of the literature. Eur Arch Otorhinolaryngol. 2003; 260(6): 298 - 200. [PubMed: 12883950].
Avashia et al., 2004: Avashia SB, Petersen JM, Lindley CM, Schriefer ME, Gage KL, Cetron M, DeMarcus TA, Kim DK, Buck J, Montenieri JA, Lowell JL, Antolin MF, Kosoy MY, Carter LG, Chu MC, Hendricks KA, Dennis DT, Kool JL. First reported prairie dog-to-human tularemia transmission, Texas, 2002. Emerg Infect Dis. 2004; 10(3): 483 - 486. [PubMed: 15109417].
Beckwith, 2006: Beckwith CS. Tularemia as a cause of fever in a squirrel monkey. J Am Vet Med Assoc. 2006; 229(2): 269 - 273. [PubMed: 16842053].
Beckwith, 2006: Beckwith CS Tularemia as a cause of fever in a squirrel monkey. J Am Vet Med Assoc. 2006; 229(2): 269 - 273. [PubMed: 16842053].
Bell and Stewart, 1983: Bell JF, Stewart SJ. Quantum differences in oral susceptibility of voles, Microtus pennsylvanicus, to virulent Francisella tularensis type B, in drinking water: implications to epidemiology. Ecol Dis. 1983; 2(2): 151 - 155. [PubMed: 6381031].
Berdal et al., 1996: Berdal BP, Mehl R, Meidell NK, Lorentzen-Styr AM, Scheel O. Field investigations of tularemia in Norway. FEMS Immunol Med Microbiol. 1996; 13(3): 191 - 195. [PubMed: 8861027].
Bevanger et al., 1988: Bevanger L, Maeland JA, Naess AI. Agglutinins and antibodies to Francisella tularensis outer membrane antigens in the early diagnosis of disease during an outbreak of tularemia. J Clin Microbiol. 1988; 26(3): 433 - 437. [PubMed: 3356786].
Borcic et al., 1976: Borcic B, Hrabar A, Dulic B, Tvrtkovic N, Bilic V, Mikacic D. Ecological features of the tularemia natural focus in central Posavina (Croatia). Folia Parasitol (Praha). 1976; 23(3): 257 - 265. [PubMed: 795754].
Chen et al., 2004: Chen W, KuoLee R, Shen H, Busa M, Conlan JW. Toll-like receptor 4 (TLR4) does not confer a resistance advantage on mice against low-dose aerosol infection with virulent type A Francisella tularensis. Microb Pathog . 2004; 37(4): 185 - 191. [PubMed: 15458779].
Choi, 2002: Choi E. Tularemia and Q fever. Med Clin North Am. 2002; 86(2): 393 - 416. [PubMed: 11982309].
Chomel et al., 1998: Chomel BB, Kasten RW, Chappuis G, Soulier M, Kikuchi Y. Abstract Serological survey of selected canine viral pathogens and zoonoses in grizzly bears (Ursus arctos horribilis) and black bears (Ursus americanus) from Alaska. Rev Sci Tech. 1998; 17(3): 756 - 766. [PubMed: 9850547].
Christenson, 1984: Christenson B. An outbreak of tularemia in the northern part of central Sweden. Scand J Infect Dis. 1984; 16(3): 285 - 290. [PubMed: 6149615].
Christova et al., 2004: Christova I, Velinov T, Kantardjiev T, Galev A. Tularaemia outbreak in Bulgaria. Scand J Infect Dis. 2004; 36(11-12): 785 - 789. [PubMed: 15764161].
Collison and Adams, 2003: Collison PJ, Adams B. Glandular tularemia in a Native American child. Ear Nose Throat J. 2003; 82(11): 851 - 854. [PubMed: 14661434].
DeBey et al., 2002: DeBey BM, Andrews GA, Chard-Bergstrom C, Cox L. Immunohistochemical demonstration of Francisella tularensis in lesions of cats with tularemia. J Vet Diagn Invest. 2002; 14(2): 162 - 164. [PubMed: 11939340].
de la Puente-Redondo et al., 2000: de la Puente-Redondo VA, del Blanco NG, Gutierrez-Martin CB, Garcia-Pena FJ, Rodriguez Ferri EF. Comparison of different PCR approaches for typing of Francisella tularensis strains. J Clin Microbiol. 2000; 38(3): 1016 - 1022. [PubMed: 10698989].
Dennis et al., 2001: Dennis DT, Inglesby TV, Henderson DA, Bartlett JG, Ascher MS, Eitzen E, Fine AD, Friedlander AM, Hauer J, Layton M, Lillibridge SR, McDade JE, Osterholm MT, O'Toole T, Parker G, Perl TM, Russell PK, Tonat K. Tularemia as a biological weapon: medical and public health management. JAMA. 2001; 285(21): 2763 - 2773. [PubMed: 11386933].
D'iakov et al., 2000: D'iakov SI, Bubnov VP, Lebedeva IK, Sidorenko SV, Moskalenko VI. [The chemotherapeutic efficacy of ciprofloxacin and lomefloxacin in the inhalation method of infecting white mice with tularemia]. Antibiot Khimioter. 2000; 45(6): 17 - 20. [PubMed: 10904804].
Drabick et al., 1994: Drabick JJ, Narayanan RB, Williams JC, Leduc JW, Nacy CA. Passive protection of mice against lethal Francisella tularensis (live tularemia vaccine strain) infection by the sera of human recipients of the live tularemia vaccine. Am J Med Sci. 1994; 308(2): 83 - 87. [PubMed: 8042659].
Eigelsbach et al., 1951: Eigelsbach HT, Braun W, Herring RD. Studies on the variation of Bacterium tularense. J Bacteriol. 1951; 61(5): 557 - 569. [PubMed: 14832199].
Eigelsbach et al., 1975: Eigelsbach HT, Hunter DH, Janssen WA, Dangerfield HG, Rabinowitz SG. Murine model for study of cell-mediated immunity: protection against death from fully virulent Francisella tularensis infection. Infect Immun. 1975; 12(5): 999 - 1005. [PubMed: 1193736].
Eliasson et al., 2002: Eliasson H, Lindback J, Nuorti JP, Arneborn M, Giesecke J, Tegnell A. The 2000 tularemia outbreak: a case-control study of risk factors in disease-endemic and emergent areas, Sweden. Emerg Infect Dis. 2002; 8(9): 956 - 960. [PubMed: 12194773].
Eliasson et al., 2005: Eliasson H, Sjostedt A, Back E. Clinical use of a diagnostic PCR for Francisella tularensis in patients with suspected ulceroglandular tularaemia. Scand J Infect Dis. 2005; 37(11-12): 833 - 837. [PubMed: 16308216].
Ellis et al., 2002: Ellis J, Oyston PC, Green M, Titball RW. Tularemia. Clin Microbiol Rev. 2002; 15(4): 631 - 646. [PubMed: 12364373].
Enderlin et al., 1994: Enderlin G, Morales L, Jacobs RF, Cross JT. Streptomycin and alternative agents for the treatment of tularemia: review of the literature. Clin Infect Dis. 1994; 19(1): 42 - 47. [PubMed: 7948556].
Farlow et al., 2005: Farlow J, Wagner DM, Dukerich M, Stanley M, Chu M, Kubota K, Petersen J, Keim P. Francisella tularensis in the United States. Emerg Infect Dis. 2005; 11(12): 1835 - 1841. [PubMed: 16485467].
Feldman, 2003: Feldman KA Tularemia. J Am Vet Med Assoc. 2003; 222(6): 725 - 730. [PubMed: 12675294].
Feldman et al., 2001: Feldman KA., Enscore RE, Lathrop SL, Matyas BT, McGuill M, Schriefer ME, Stiles-Enos D, Dennis DT, Petersen LR, Hayes EB. An outbreak of primary pneumonic tularemia on Martha's Vineyard. N Engl J Med. 2001; 345(22): 1601 - 1606. [PubMed: 11757506].
Forsman et al., 1994: Forsman M, Sandstrom G, Sjostedt A. Analysis of 16S ribosomal DNA sequences of Francisella strains and utilization for determination of the phylogeny of the genus and for identification of strains by PCR. Int J Syst Bacteriol. 1994; 44(1): 38 - 46. [PubMed: 8123561].
Fortier et al., 1991: Fortier AH, Slayter MV, Ziemba R, Meltzer MS, Nacy CA. Live vaccine strain of Francisella tularensis: infection and immunity in mice. Infect Immun. 1991; 59(9): 2922 - 2928. [PubMed: 1879918].
Fortier et al., 1995: Fortier AH, Leiby DA, Narayanan RB, Asafoadjei E, Crawford RM, Nacy CA, Meltzer MS. Growth of Francisella tularensis LVS in macrophages: the acidic intracellular compartment provides essential iron required for growth. Infect Immun. 1995; 63(4): 1478 - 1483. [PubMed: 7890413].
Fujita et al., 2006: Fujita O, Tatsumi M, Tanabayashi K, Yamada A. Development of a real-time PCR assay for detection and quantification of Francisella tularensis. Jpn J Infect Dis. 2006; 59(1): 46 - 51. [PubMed: 16495634].
Fulop et al., 1996: Fulop M, Leslie D, Titball R. A rapid, highly sensitive method for the detection of Francisella tularensis in clinical samples using the polymerase chain reaction. Am J Trop Med Hyg. 1996; 54(4): 364 - 366. [PubMed: 8615448].
Gavrilin et al., 2006: Gavrilin MA, Bouakl IJ, Knatz NL, Duncan MD, Hall MW, Gunn JS, Wewers MD. Internalization and phagosome escape required for Francisella to induce human monocyte IL-1beta processing and release. Proc Natl Acad Sci USA. 2006; 103(1): 141 - 146. [PubMed: 16373510].
Gese et al., 2004: Gese EM, Karki SM, Klavetter ML, Schauster ER, Kitchen AM. Serologic survey for canine infectious diseases among sympatric swift foxes (Vulpes velox) and coyotes (Canis latrans) in southeastern Colorado. J Wildl Dis. 2004; 40(4): 741 - 748. [PubMed: 15650093].
Gill and Cunha, 1997: Gill V, Cunha BA. Tularemia pneumonia. Semin Respir Infect. 1997; 12(1): 61 - 67. [PubMed: 9097380].
Gordon et al., 1983: Gordon JR, McLaughlin BG, Nitiuthai S. Tularaemia transmitted by ticks (Dermacentor andersoni) in Saskatchewan. Can J Comp Med. 1983; 47(4): 408 - 411. [PubMed: 6667429].
Green et al., 2005: Green M, Choules G, Rogers D, Titball RW. Efficacy of the live attenuated Francisella tularensis vaccine (LVS) in a murine model of disease. Vaccine. 2005; 23(20): 2680 - 2686. [PubMed: 15780452].
Grunow et al., 2000: Grunow R, Splettstoesser W, McDonald S, Otterbein C, O'Brien T, Morgan C, Aldrich J, Hofer E, Finke EJ, Meyer H. Detection of Francisella tularensis in biological specimens using a capture enzyme-linked immunosorbent assay, an immunochromatographic handheld assay, and a PCR. Clin Diagn Lab Immunol. 2000; 7(1): 86 - 90. [PubMed: 10618283].
Gurycova, 1998: Gurycova D. First isolation of Francisella tularensis subsp. tularensis in Europe. Eur J Epidemiol. 1998; 14(8): 797 - 802. [PubMed: 9928875].
Gurycova, 1998: Gurycova D. First isolation of Francisella tularensis subsp. tularensis in Europe. Eur J Epidemiol. 1998; 14(8): 797 - 802. [PubMed: 9928875].
Gurycova et al., 2001: Gurycova D, Vyrostekova V, Khanakah G, Kocianova E, Stanek G. Importance of surveillance of tularemia natural foci in the known endemic area of Central Europe, 1991-1997. Wien Klin Wochenschr.. 2001; 113((11-12)): 433 - 438. [PubMed: 11467089 ].
Gutierrez et al., 2003: Gutierrez MP, Bratos MA, Garrote JI, Duenas A, Almaraz A, Alamo R, Rodriguez Marcos H, Rodriguez Recio MJ, Munoz MF, Orduna A, Rodriguez-Torres A. Serologic evidence of human infection by Francisella tularensis in the population of Castilla y Leon (Spain) prior to 1997. FEMS Immunol Med Microbiol. 2003; 35(2): 165 - 169. [PubMed: 12628554].
Haerer et al., 2004: Haerer G, Nicolet J, Bacciarini L, Gottstein B, Giacometti M. Causes of death, zoonoses, and reproduction in the European brown hare in Switzerland. Schweiz Arch Tierheilkd. 2004; 143(4): 193 - 201. [PubMed: 11344944].
Hatipoglu et al., 2005: Hatipoglu CA, Bayiz U, Firat SK, Erdinc FS, Tulek N, Gedikoglu S. [Case report: a case of tularemia with delayed diagnosis]. Mikrobiyol Bul. 2005; 39(1): 89 - 94. [PubMed: 15900842].
Hoelzle et al., 2004: Hoelzle LE, Corboz L, Ossent P, Wittenbrink MM. Tularaemia in a captive golden-headed lion tamarin (Leontopithecus chrysomelas) in Switzerland. Vet Rec. 2004; 155(2): 60 - 61. [PubMed: 15285287].
Hubalek et al., 1996: Hubalek Z, Treml F, Halouzka J, Juricova Z, Hunady M, Janik V. Frequent isolation of Francisella tularensis from Dermacentor reticulatus ticks in an enzootic focus of tularaemia. Med Vet Entomol. 1996; 10(3): 241 - 246. [PubMed: 8887334].
Johansson et al., 2000: Johansson A, Ibrahim A, Goransson I, Eriksson U, Gurycova D, Clarridge JE 3rd, Sjostedt A. Evaluation of PCR-based methods for discrimination of Francisella species and subspecies and development of a specific PCR that distinguishes the two major subspecies of Francisella tularensis. J Clin Microbiol. 2000; 38(11): 4180 - 4185. [PubMed: 11060087].
Johansson et al., 2000(a): Johansson A, Berglund L, Eriksson U, Goransson I, Wollin R, Forsman M, Tarnvik A, Sjostedt A. Comparative analysis of PCR versus culture for diagnosis of ulceroglandular tularemia. J Clin Microbiol. 2000; 38(1): 22 - 26. [PubMed: 10618057].
Johansson et al., 2000 (b): Johansson A, Ibrahim A, Goransson I, Eriksson U, Gurycova D, Clarridge JE 3rd, Sjostedt A. Evaluation of PCR-based methods for discrimination of Francisella species and subspecies and development of a specific PCR that distinguishes the two major subspecies of Francisella tularensis. J Clin Microbiol. 2000; 38(11): 4180 - 4185. [PubMed: 11060087].
Kantardjiev et al., 2006: Kantardjiev T, Ivanov I, Velinov T, Padeshki P, Popov B, Nenova R, Mincheff M. Tularemia outbreak, Bulgaria, 1997-2005. Emerg Infect Dis. 2006; 12(4): 678 - 680. [PubMed: 16704820].
Karhukorpi and Karhukorpi, 2001: Karhukorpi EK, Karhukorpi J. Rapid laboratory diagnosis of ulceroglandular tularemia with polymerase chain reaction. Scand J Infect Dis. 2001; 33(5): 383 - 385. [PubMed: 11440227].
Klock et al., 1973: Klock LE, Olsen PF, Fukushima T. Tularemia epidemic associated with the deerfly. JAMA. 1973; 226(2): 149 - 152. [PubMed: 4740907].
Larsson et al., 2005: Larsson P, Oyston PC, Chain P, Chu MC, Duffield M, Fuxelius HH, Garcia E, Halltorp G, Johansson D, Isherwood KE, Karp PD, Larsson E, Liu Y, Michell S, Prior J, Prior R, Malfatti S, Sjostedt A, Svensson K, Thompson N, Vergez L, Wagg JK, Wren BW, Lindler LE, Andersson SG, Forsman M, Titball RW. The complete genome sequence of Francisella tularensis, the causative agent of tularemia. Nat Genet. 2005; 37(2): 153 - 159. [PubMed: 15640799].
Lopez et al., 2004: Lopez MC, Duckett NS, Baron SD, Metzger DW. Early activation of NK cells after lung infection with the intracellular bacterium, Francisella tularensis LVS. Cell Immunol. 2004; 232(1-2): 75 - 85. [PubMed: 15922718].
Magee et al., 1989: Magee JS, Steele RW, Kelly NR, Jacobs RF. Tularemia transmitted by a squirrel bite. Pediatr Infect Dis J. 1989; 8(2): 123 - 125. [PubMed: 2704604].
Magnarelli et al., 2006: Magnarelli L, Levy S, Koski R. Detection of antibodies to Francisella tularensis in cats. Res Vet Sci. 2006; 82(1): 22 - 26. [PubMed: 16914176].
Markowitz et al., 1985: Markowitz1985 LE, Hynes NA, de la Cruz P, Campos E, Barbaree JM, Plikaytis BD, Mosier D, Kaufmann AF. Tick-borne tularemia. An outbreak of lymphadenopathy in children. JAMA. 1985; 254(20): 2922 - 2925. [PubMed: 4057512].
Maurin et al., 2002: Maurin M, Mersali NF, Raoult D. Bactericidal activities of antibiotics against intracellular Francisella tularensis. Antimicrob Agents Chemother. 2002; 44(12): 3428 - 3431. [PubMed: 11083651].
McLendon et al., 2006: McLendon MK, Apicella MA, Allen LA. Francisella tularensis: taxonomy, genetics, and Immunopathogenesis of a potential agent of biowarfare. Annu Rev Microbiol. 2006; 60: 167 - 185. [PubMed: 16704343].
Meshcheriakova et al., 1988: Meshcheriakova IS, Umnova NS, Shakhanina KL, Pavlova IP. [Use of the ELISA immunoenzyme method for the detection of the causative agent of tularemia]. Zh Mikrobiol Epidemiol Immunobiol. 1988; 2: 109 - 112. [PubMed: 2452535].
MMWR, 2005(b): Centers for Disease Control and Prevention (CDC). Tularemia associated with a hamster bite--Colorado, 2004. MMWR Morb Mortal Wkly Rep. 2005; 53(51): 1202 - 1203. [PubMed: 15635290].
MMWR et al., 2005: Centers for Disease Control and Prevention (CDC). Tularemia transmitted by insect bites--Wyoming, 2001-2003. MMWR Morb Mortal Wkly Rep. 2005; 54(7): 170 - 173. [PubMed: 15729218].
Morner, 1992: Morner T. The ecology of tularaemia. Rev Sci Tech. 1992; 11(4): 1123 - 1130. [PubMed: 1305858].
Morner et al., 1988: Morner T, Sandstrom G, Mattsson R, Nilsson PO. Infections with Francisella tularensis biovar palaearctica in hares (Lepus timidus, Lepus europaeus) from Sweden. J Wildl Dis. 1988; 24(3): 422 - 433. [PubMed: 2900904].
Nayar et al., 1979: Nayar GP, Crawshaw GJ, Neufeld JL. Tularemia in a group of nonhuman primates. J Am Vet Med Assoc. 1979; 175(9): 962 - 963. [PubMed: 118145].
Nekrasov et al., 1985: Nekrasov AA, Pilipenko VG, Mel'nikov VS, Likhonos AN, Popov VA. [Rise in the epizootic activity of a natural focus of steppe-type tularemia in Stavropol Territory and its epidemic consequences]. Zh Mikrobiol Epidemiol Immunobiol. 1985; (2): 88 - 92. [PubMed: 3158139].
Oyston et al., 2005: Oyston PC, Sjostedt A, Titball RW. Tularaemia: bioterrorism defence renews interest in Francisella tularensis. Nat Rev Microbiol. 2005; 2(12): 967 - 978. [PubMed: 15550942].
Petersen and Schriefer, 2005: Petersen JM, Schriefer ME. Tularemia: emergence/re-emergence. Vet Res. 2005; 36(3): 455 - 467. [PubMed: 15845234].
Petersen et al., 2004: Petersen JM, Schriefer ME, Carter LG, Zhou Y, Sealy T, Bawiec D, Yockey B, Urich S, Zeidner NS, Avashia S, Kool JL, Buck J, Lindley C, Celeda L, Monteneiri JA, Gage KL, Chu MC. Laboratory analysis of tularemia in wild-trapped, commercially traded prairie dogs, Texas, 2002. Emerg Infect Dis. 2004; 10(3): 419 - 425. [PubMed: 15109407].
Petrosino et al., 2006: Petrosino JF, Xiang Q, Karpathy SE, Jiang H, Yerrapragada S, Liu Y, Gioia J, Hemphill L, Gonzalez A, Raghavan TM, Uzman A, Fox GE, Highlander S, Reichard M, Morton RJ, Clinkenbeard KD, Weinstock GM. Chromosome rearrangement and diversification of Francisella tularensis revealed by the type B (OSU18) genome sequence. J Bacteriol. 2006; 188(19): 6977 - 6985. [PubMed: 16980500].
Piercy et al., 2005: Piercy T, Steward J, Lever MS, Brooks TJ. In vivo efficacy of fluoroquinolones against systemic tularaemia infection in mice. J Antimicrob Chemother. 2005; 56(6): 1069 - 1073. [PubMed: 16223941].
Plourde et al., 1992: Plourde PJ, Embree J, Friesen F, Lindsay G, Williams T. Glandular tularemia with typhoidal features in a Manitoba child. CMAJ. 1992; 146(11): 1953 - 1955. [PubMed: 1596844].
Pomerantsev et al., 2001(a): Pomerantsev AP, Obuchi M, Ohara Y. Nucleotide sequence, structural organization, and functional characterization of the small recombinant plasmid pOM1 that is specific for Francisella tularensis. Plasmid. 2001; 46(2): 86 - 94. [PubMed: 11591134].
Pomerantsev et al., 2001(b): Pomerantsev AP, Golovliov IR, Ohara Y, Mokrievich AN, Obuchi M, Norqvist A, Kuoppa K, Pavlov VM. Genetic organization of the Francisella plasmid pFNL10. Plasmid. 2001; 46(3): 210 - 222. [PubMed: 11735370].
Russell et al., 1998: Russell P, Eley SM, Fulop MJ, Bell DL, Titball RW. The efficacy of ciprofloxacin and doxycycline against experimental tularaemia. J Antimicrob Chemother. 1998; 41(4): 461 - 465. [PubMed: 9598777].
Sarria et al., 2003: Sarria JC, Vidal AM, Kimbrough RC, Figueroa JE. Fatal infection caused by Francisella tularensis in a neutropenic bone marrow transplant recipient. Ann Hematol. 2003; 82(1): 41 - 43. [PubMed: 12574964].
Shlygina and Olsuf'ev, 1982: Shlygina KN, Olsuf'ev NG. [Experimental latent tularemia in common voles]. Zh Mikrobiol Epidemiol Immunobiol. 1982; (4): 101 - 104. [PubMed: 7043979].
Shlygina et al., 1987: Shlygina KN, Baranovskii PM, Ananova EV, Olsuf'ev NG. [Possible atypical course of tularemia (persistence) in the common vole Microtus arvalis Pall.]. Zh Mikrobiol Epidemiol Immunobiol. 1987; (3): 26 - 29. [PubMed: 3296576].
Shoemaker et al., 1997: Shoemaker D, Woolf A, Kirkpatrick R, Cooper M. Humoral immune response of cottontail rabbits naturally infected with Francisella tularensis in southern Illinois. J Wildl Dis. 1997; 33(4): 733 - 737. [PubMed: 9391956].
Siret et al., 2006: Siret V, Barataud D, Prat M, Vaillant V, Ansart S, Le Coustumier A, Vaissaire J, Raffi F, Garre M, Capek I. An outbreak of airborne tularaemia in France, August 2004. Euro Surveill. 2006; 11(2): 58 - 60. [PubMed: 16525197].
Sjostedt et al., 1996: Sjostedt A, Tarnvik A, Sandstrom G. Francisella tularensis: host-parasite interaction. FEMS Immunol Med Microbiol. 1996; 13(3): 181 - 184. [PubMed: 8861025].
Sjostedt et al., 1997: Sjostedt A, Eriksson U, Berglund L, Tarnvik A. Detection of Francisella tularensis in ulcers of patients with tularemia by PCR. J Clin Microbiol. 1997; 35(5): 1045 - 1048. [PubMed: 9114378].
Staples et al., 2006: Staples JE, Kubota KA, Chalcraft LG, Mead PS, Petersen JM. Epidemiologic and molecular analysis of human tularemia, United States, 1964-2004. Emerg Infect Dis. 2006; 12(7): 1113 - 1118. [PubMed: 16836829].
Stenmark et al., 2003: Stenmark S, Lindgren H, Tarnvik A, Sjostedt A. Specific antibodies contribute to the host protection against strains of Francisella tularensis subspecies holarctica. Microb Pathog. 2003; 35(2): 73 - 80. [PubMed: 12901846].
Syrjala et al., 1985: Syrjala H, Kujala P, Myllyla V, Salminen A. Airborne transmission of tularemia in farmers. Scand J Infect Dis. 1985; 17(4): 371 - 375. [PubMed: 4089543].
Syrjala et al., 1991: Syrjala H, Schildt R, Raisainen S. In vitro susceptibility of Francisella tularensis to fluoroquinolones and treatment of tularemia with norfloxacin and ciprofloxacin. Eur J Clin Microbiol Infect Dis. 1991; 10(2): 68 - 70. [PubMed: 1864276].
Tarnvik et al., 1996: Tarnvik A, Sandstrom G, Sjostedt A. Epidemiological analysis of tularemia in Sweden 1931-1993. FEMS Immunol Med Microbiol. 1996; 13(3): 201 - 204. [PubMed: 8861029].
Thompson et al., 2001: Thompson S, Omphroy L, Oetting T. Parinaud's oculoglandular syndrome attributable to an encounter with a wild rabbit. Am J Ophthalmol. 2001; 131(2): 283 - 284. [PubMed: 11228320].
Tomaso et al., 2006: Tomaso H, Scholz HC, Neubauer H, Al Dahouk S, Seibold E, Landt O, Forsman M, Splettstoesser WD. Real-time PCR using hybridization probes for the rapid and specific identification of Francisella tularensis subspecies tularensis. Mol Cell Probes. 2006; 21(1): 12 - 16. [PubMed: 16893624].
Tomioka et al., 2005: Tomioka K, Peredelchuk M, Zhu X, Arena R, Volokhov D, Selvapandiyan A, Stabler K, Mellquist-Riemenschneider J, Chizhikov V, Kaplan G, Nakhasi H, Duncan R. A multiplex polymerase chain reaction microarray assay to detect bioterror pathogens in blood. J Mol Diagn. 2005; 7(4): 486 - 494. [PubMed: 16237218].
Twine et al., 2006: Twine SM, Shen H, Kelly JF, Chen W, Sjostedt A, Conlan JW. Virulence comparison in mice of distinct isolates of type A Francisella tularensis. Microb Pathog. 2006; 40(3): 133 - 138. [PubMed: 16448801].
Versage et al., 2003: Versage JL, Severin DD, Chu MC, Petersen JM. Development of a multitarget real-time TaqMan PCR assay for enhanced detection of Francisella tularensis in complex specimens. J Clin Microbiol. 2003; 41(12): 5492 - 5499. [PubMed: 14662930].
Vogel, 2003: Vogel G. Infectious diseases. An obscure weapon of the cold war edges into the limelight. Science. 2003; 302(5643): 222 - 223. [PubMed: 14551418].
Vyrostekova et al., 2002: Vyrostekova V, Khanakah G, Kocianova E, Gurycova D, Stanek G. Prevalence of coinfection with Francisella tularensis in reservoir animals of Borrelia burgdorferi sensu lato. Wien Klin Wochenschr. 2002; 114((13-14)): 482 - 488. [PubMed: 12422587].
Whipp et al., 2003: Whipp MJ, Davis JM, Lum G, de Boer J, Zhou Y, Bearden SW, Petersen JM, Chu MC, Hogg G. Characterization of a novicida-like subspecies of Francisella tularensis isolated in Australia. J Med Microbiol. 2003; 52(Pt 9): 839 - 842. [PubMed: 12909664].
Wu et al., 2005: Wu TH, Hutt JA, Garrison KA, Berliba LS, Zhou Y, Lyons CR. Intranasal vaccination induces protective immunity against intranasal infection with virulent Francisella tularensis biovar A. Infect Immun. 2005; 73(5): 2644 - 2654. [PubMed: 15845466].
Zhang et al., 2006: Zhang F, Liu W, Chu MC, He J, Duan Q, Wu XM, Zhang PH, Zhao QM, Yang H, Xin ZT, Cao WC. Francisella tularensis in rodents, China. Emerg Infect Dis. 2006; 12(6): 994 - 996. [PubMed: 16707060].
B. Book References:
AHFS Drug Information, 2006(a): The American Society of Health-System Pharmacists. Streptomycin Sulfate. 71 - 73. In: McEvoy Gerald K. AHFS Drug Information Handbook 2006. The American Society of Health-System Pharmacists, Inc., Bethesda, MD, USA.
AHFS Drug Information, 2006(b): The American Society of Health-System Pharmacists. Gentamicin sulfate. 3383 - 3383. In: McEvoy Gerald K. AHFS Drug Information Handbook 2006. The American Society of Health-System Pharmacists, Inc., Bethesda, MD, USA.
AHFS Drug Information, 2006(c): The American Society of Health-System Pharmacists. Tetracyclines. 440 - 456. In: McEvoy Gerald K. AHFS Drug Information Handbook 2006. The American Society of Health-System Pharmacists, Inc., Bethesda, MD, USA.
AHFS Drug Information, 2006(d): The American Society of Health-System Pharmacists. Chloramphenicol Sodium Succinate. 211 - 216. In: McEvoy Gerald K. AHFS Drug Information Handbook 2006. The American Society of Health-System Pharmacists, Inc., Bethesda, MD, USA.
CDC et al., 2001: Centers for Disease Control and Prevention, American Society of Microbiology, Association of Public Health Laboratories. Basic Protocols For Level A Laboratories For The Presumptive identification of Francisella tularensis. 1 - 13. In: Morse Stephen A. Basic Protocols For Level A Laboratories 2001. Centers for Disease Control and Prevention, Atlanta, Georgia, USA.
Cross et al., 2000: Cross J Thomas, Jr., Penn Robert L. Francisella tularensis (Tularemia). 2393 - 2402. In: Mandell Gerald, Bennett John, Dolin Raphael. Principles and Practice of Infectious Diseases, 5th edition 2000. Churchill Livingstone, New York.
Mitchell and Penn, 2005: Mitchell Candace L., Penn Robert L. Francisella tularensis (Tularemia) as an Agent of Bioterrorism. 3607 - 3612. In: Mandell Gerald L, Bennett John E, Dolin Raphael. Principles and Practice of Infectious Diseases, 6th Edition 2005. Churchill Livingstone, New York.
Penn, 2005: Penn Robert L. Francisella tularensis (Tularemia). 2674 - 2685. In: Mandell Gerald L, Bennett John E, Dolin Raphael. Principles and Practice of Infectious Diseases, 6th Edition 2005. Churchill Livingstone, New York.
C. Website References:
Biological Warfare Defense Information Sheet: Biological Warfare Defense Information Sheet: Tularemia [ http://www.emergency.com/tularema.htm ].
Francisella tularensis - Material Safety Data Sheets: Material Safety Data Sheets - Infectious Substances [ http://www.phac-aspc.gc.ca/msds-ftss/msds68e.html ].
NCBI Taxonomy: Francisella tularensis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=263&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Francisella tularensis subsp. holarctica [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=119857&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Francisella tularensis subsp. holarctica FSC200 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=351581&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Francisella tularensis subsp. holarctica LVS [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=376619&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Francisella tularensis subsp. holarctica OSU18 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=393011&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Francisella tularensis subsp. mediasiatica [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=135248&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Francisella tularensis subsp. novicida [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=264&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Francisella tularensis subsp. tularensis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=119856&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Francisella tularensis subsp. tularensis FSC 198 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=393115&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Francisella tularensis subsp. tularensis SCHU S4 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=177416&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Cynomys [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=45480&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Felis catus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9685 ].
NCBI Entrez: Francisella tularensis subsp. tularensis FSC 198 [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&val=110669657 ].
NCBI Genome: Francisella tularensis subsp. novicida [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=16088 ].
NCBI Genome: Francisella tularensis subsp. tularensis strain Schu S4 [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=9 ].
NCBI Genome: Francisella tularensis subsp. holarctica FSC200 project at University of Washington [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=16087 ].
NCBI Genome: Francisella tularensis subsp. tularensis Schu 4, complete genome. [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genome&cmd=Retrieve&dopt=Overview&list_uids=563 ].
NCBI Genome: Francisella tularensis subsp. holarctica OSU18, complete genome. [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genome&cmd=Retrieve&dopt=Overview&list_uids=19819 ].
NCBI Genome: Francisella tularensis subsp. novicida plasmid pFNL10, complete sequence. [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genome&cmd=Retrieve&dopt=Overview&list_uids=17227 ].
NCBI Genome: Francisella tularensis subsp. tularensis FSC 198, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genome&cmd=Retrieve&dopt=Overview&list_uids=19668 ].
NCBI Genome: Francisella tularensis subsp. holarctica, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genome&cmd=Retrieve&dopt=Overview&list_uids=19299 ].
NCBI Genome: Francisella tularensis plasmid pOM1, complete sequence [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genome&cmd=Retrieve&dopt=Overview&list_uids=15203 ].
NCBI Taxonomy: Homo sapiens [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9606&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Apodemus flavicollis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=54292 ].
NCBI Taxonomy: Apodemus sylvaticus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=10129 ].
NCBI Taxonomy: Oryctolagus cuniculus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9986&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Sylvilagus floridanus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9988&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Genome: Lepus timidus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=62621 ].
NCBI Taxonomy: Dermacentor reticulatus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=57047 ].
NCBI Taxonomy: Ixodes ricinus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=34613 ].
NCBI Taxonomy: Culicidae [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=7157&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Amoeba [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=5774&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Castor canadensis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=51338 ].
NCBI Taxonomy: Ondatra zibethicus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=10060 ].
NCBI Taxonomy: Microtus agrestis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=29092 ].
NCBI Taxonomy: Microtus richardsoni [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=111840&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Scapteromys aquaticus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=241146 ].
NCBI Taxonomy: Chrysops [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=27458&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Scuirus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=10001&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Mammalia [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=40674&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Lemmus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=79948&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Cricetinae [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=10026&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Saimiri sciureus sciureus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=190117 ].
NCBI Taxonomy: Microtus arvalis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=47230 ].
NCBI Taxonomy: Dermacentor variabilis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=34621 ].
NCBI Taxonomy: Dermacentor andersoni [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=34620 ].
NCBI Taxonomy: Amblyomma americanum [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=6943 ].
NCBI Taxonomy: Saguinus nigricollis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9489 ].
NCBI Taxonomy: Miopithecus talapoin [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=36231 ].
NCBI Taxonomy: Saimiri sciureus sciureus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=190117 ].
NCBI Taxonomy: Leontopithecus chrysomelas [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=57374 ].
NCBI Taxonomy: Lepus europaeus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9983 ].
NCBI Taxonomy: Clethrionomys glareolus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=51090 ].
NCBI Taxonomy: Apodemus flavicollis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=54292 ].
NCBI Taxonomy: Sorex araneus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=42254 ].
NCBI Taxonomy: Acanthamoeba castellanii [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=5755 ].
NCBI Taxonomy: Ixodes trianguliceps [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=347913 ].
NCBI Taxonomy: Ctenophthalmus agyrtes [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=309191 ].
NCBI Taxonomy: Mustela nivalis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=36239 ].
NCBI Taxonomy: Neomys anomalus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=52814 ].
NCBI Taxonomy: Microtus subterraneus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=137712 ].
NCBI Taxonomy: Sorex minutus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=62280 ].
NCBI Taxonomy: Canis latrans [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9614 ].
NCBI Taxonomy: Ursus arctos horribilis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=116960 ].
NCBI Taxonomy: Ursus americanus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9643 ].
NCBI Genome: Francisella tularensis subsp. novicida U112, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genome&cmd=Retrieve&dopt=Overview&list_uids=118496615 ].
D. Thesis References:

No thesis or dissertation references used.


VI. Curation Information