Eastern Equine Encephalitis Virus

I. Organism Information

A. Taxonomy Information
  1. Species:
    1. Eastern Equine Encephalitis virus (Website 13):
      1. GenBank Taxonomy No.: 11021
      2. Description: EEE is a member of the Alphavirus genus, family Togaviridae. It is related to but antigenically distinct from a sympatric member of the western equine encephalomyelitis (WEE) virus complex, Highlands J (HJ) virus. Epidemiologically, EEE has many similarities to WEE in that both viruses cause encephalitis in horses and man, have wild avian hosts, and are transmitted from birds to mammals by mosquitoes. EEE and HJ virus are most closely related epidemiologically in that they share geographic distributions, are transmitted by the mosquito Cs. melanura, and infect a wide spectrum of wild avians, especially passerines (Morris, 1988). Venezuelan equine encephalitis, eastern equine encephalitis, and western equine encephalitis are all members of the Alphavirus genus of the family Togaviridae. As with all the alphavirus group, VEE, EEE, and WEE are transmitted in nature by mosquitoes and are maintained in cycles with various vertebrate hosts. Thus, the natural epidemiology of these viruses is controlled by environmental factors that affect the relevant mosquito and reservoir host populations and their interactions. Of the 28 viruses currently classified within this group, VEE, EEE, and WEE are the only viruses regularly associated with encephalitis. Although these encephalitic strains are restricted to the Americas, as a group, alphaviruses have worldwide distribution and include other epidemic human pathogens such as chikungunya virus (Asia and Africa), Mayaro virus (South America), O'nyong-nyong virus (Africa), Ross River virus (Australia), and Sindbis virus (Africa, Europe, and Asia). These viruses cause an acute febrile syndrome often associated with debilitating polyarthritic syndromes (Website 15). Eastern equine encephalitis virus (EEEV), the sole species in the EEE antigenic complex, is divided into North and South American antigenic varieties based on hemagglutination inhibition tests. All North American isolates comprised a single, highly conserved lineage with strains grouped by the time of isolation and to some extent by location. An EEEV strain isolated during a 1996 equine outbreak in Tamaulipas State, Mexico was closely related to recent Texas isolates, suggesting southward EEEV transportation beyond the presumed enzootic range (Brault et al., 1999). The North American subtype of this virus includes all isolates from all hosts from the area between Massachusetts and the Caribbean (Morris, 1988) (Morris, 1988). Nucleotide sequencing and phylogenetic analyses revealed additional genetic diversity within the South American variety; 3 major South/Central American lineages were identified including one represented by a single isolate from eastern Brazil, and 2 lineages with more widespread distributions in Central and South America (Brault et al., 1999) (Brault et al., 1999). The South American subtype of this virus includes all isolates from all hosts in the South American Continent (Morris, 1988).
B. Lifecycle Information :
  1. Virion :
    1. Size: The alphavirus virion is approximately 60 to 65 nm in diameter (Website 15).
    2. Shape: The alphavirus virion, a spherical particle approximately 60 to 65 nm in diameter is typically composed of three different structural proteins enclosing a single molecule of single-stranded RNA (Website 15).
    3. Picture(s):
      1. Surface of an Alphavirus (Website 21):



        Description: This image is a computer-generated model of the surface of an alphavirus derived by cryoelectron microscopy. The spike-like structures on the virion surface are trimers composed of heterodimers of the virion surface glycoproteins E1 and E2. These spikes are used by the virus to attach to susceptible animal cells. Copyright: CDC.
C. Genome Summary:
  1. Genome of Eastern Equine Encephalitis virus
    1. Description: Eastern equine encephalitis (EEE) is a single-stranded RNA positive strand virus and a member of the Alphavirus genus and the family Togaviridae. It has no DNA stage (Website 15).
    2. Chromosome (Website 14):
      1. GenBank Accession Number: NC_003899
      2. Size: 11675 bp (Website 14)
      3. Gene Count: 7 genes (Website 14)
      4. Description: The viral genome is a positive-stranded RNA of approximately 11,700 nucleotides and has the structural features of messenger RNA (ie, mRNA, a 5 ' methylated cap [m7GpppA] and a poly-A tract at the 3 ' end). As a complete and functional mRNA, genomic RNA purified from virions is fully infectious when artificially introduced (ie, transfected) into susceptible cells. Similarly, RNA transcribed from a full-length complementary DNA (cDNA) clone of an alphavirus is also infectious, and it is this property that allows genetic manipulation of these viruses. Mutations introduced into a cDNA clone by site-directed mutagenesis will be reflected in the RNA transcribed from the altered clone and in the virus obtained from transfected cells. These procedures are being utilized to develop improved vaccines, but conceivably could be used also to enhance specific characteristics required for weaponization (Website 15). The 5' two-thirds of the genome encodes four nonstructural proteins (nsP1 to 4) that are involved in viral replication. After virus entry into the cytoplasm of cells, a nonstructural polyprotein is translated and utilized in the production of full-length negative-sense RNA. The negative-sense RNA is used for the generation of genomic RNA as well as a subgenomic mRNA (26S) that is homologous to the 3' one-third of the genome. The subgenomic RNA is translated directly into a structural polyprotein that is proteolytically cleaved into the capsid, E2, and E1 envelope glycoproteins (Brault et al., 2002).

II. Epidemiology Information

A. Outbreak Locations:
  1. Outbreaks of EEE virus have occurred in most eastern states and in southeastern Canada but have been concentrated along the eastern and Gulf coasts (Website 15).
B. Transmission Information:
  1. From: Birds To: Culicidae , With Destination: Culicidae (Website 15, Website 16):
    Mechanism: The ability of alphaviruses to infect mosquitoes efficiently with spread to and replication in the salivary glands is essential for maintaining the natural cycle of transmission. Not all mosquitoes taking a blood meal from a viremic host will become infected, and not all infected mosquitoes develop salivary gland infection and the ability to transmit the virus (Griffin, 2001). The initial isolation of EEE virus from a bird and from Culiseta melanura mosquitoes, the two major components of the EEE natural cycle, were both reported in 1951 (Website 15).

  2. From: Culicidae To: Birds , With Destination: Birds (Website 15, Griffin, 2001):
    Mechanism: The primary mode of alphavirus transmission to vertebrates is through the bite of an infected mosquito. Mosquitoes salivate during feeding and deposit virus-infected saliva extravascularly. Saliva virus titers are highest early after the mosquito is infected, but decline, along with transmission rates, after 1 to 2 weeks, but mosquitoes remain infected for life (Griffin, 2001). The mosquito injects the agent of EEE into the subcutaneous and cutaneous tissues of the host (Website 16).

  3. From: Culicidae To: Human , With Destination: Human (Griffin, 2001, Website 16):
    Mechanism: The primary mode of alphavirus transmission to vertebrates is through the bite of an infected mosquito. Mosquitoes salivate during feeding and deposit virus-infected saliva extravascularly. Saliva virus titers are highest early after the mosquito is infected, but decline, along with transmission rates, after 1 to 2 weeks, but mosquitoes remain infected for life (Griffin, 2001). The mosquito injects the agent of EEE into the subcutaneous and cutaneous tissues of the host (Website 16).

  4. From: Human To: Culicidae , With Destination: Culicidae (Website 15, Website 16):
    Mechanism: The primary mode of alphavirus transmission to vertebrates is through the bite of an infected mosquito. Mosquitoes salivate during feeding and deposit virus-infected saliva extravascularly. Saliva virus titers are highest early after the mosquito is infected, but decline, along with transmission rates, after 1 to 2 weeks, but mosquitoes remain infected for life (Griffin, 2001). The mosquito injects the agent of EEE into the subcutaneous and cutaneous tissues of the host (Website 16).

  5. From: Human To: Human , With Destination: Human (Website 16):
    Mechanism: EEE is not transmitted by the aerosol route. It may cross the placenta and infect the fetus. Because of low viral titers in the donor's blood, EEE is unlikely to be transmitted by transfusion (Website 16).

  6. From: Culicidae To: Horse , With Destination: Horse (Griffin, 2001, Website 16):
    Mechanism: The primary mode of alphavirus transmission to vertebrates is through the bite of an infected mosquito. Mosquitoes salivate during feeding and deposit virus-infected saliva extravascularly. Saliva virus titers are highest early after the mosquito is infected, but decline, along with transmission rates, after 1 to 2 weeks, but mosquitoes remain infected for life (Griffin, 2001) (Griffin, 2001). The mosquito injects the agent of EEE into the subcutaneous and cutaneous tissues of the host (Website 16).

  7. From: Horse To: Culicidae , With Destination: Culicidae (Website 15, Website 16):
    Mechanism: The primary mode of alphavirus transmission to vertebrates is through the bite of an infected mosquito. Mosquitoes salivate during feeding and deposit virus-infected saliva extravascularly. Saliva virus titers are highest early after the mosquito is infected, but decline, along with transmission rates, after 1 to 2 weeks, but mosquitoes remain infected for life (Griffin, 2001). The mosquito injects the agent of EEE into the subcutaneous and cutaneous tissues of the host (Website 16).

C. Environmental Reservoir:
  1. Birds (Griffin, 2001):
    1. Description: Birds are the primary reservoir hosts, and many species are susceptible to infection, but often remain asymptomatic despite prolong viremia. The amplifying species for EEEV in North America are wading birds, migratory passerine birds, and starlings. Young birds in general are probably important for virus amplification because they are more susceptible to infection, have a prolonged viremia, and are less defensive towards mosquitoes (Griffin, 2001).
  2. Bats (Griffin, 2001):
    1. Description: In Central and South America, forest-dwelling rodents, bats, and marsuipials are frequently infected and may provide an additional reservoir, but these transmission cycles are not well characterized (Griffin, 2001).
  3. Rodents (Griffin, 2001):
    1. Description: In Central and South America, forest-dwelling rodents, bats, and marsuipials are frequently infected and may provide an additional reservoir, but these transmission cycles are not well characterized (Griffin, 2001).
  4. Marsuipials (Griffin, 2001):
    1. Description: In Central and South America, forest-dwelling rodents, bats, and marsuipials are frequently infected and may provide an additional reservoir, but these transmission cycles are not well characterized (Griffin, 2001).
D. Intentional Releases:
  1. Intentional Release information :
    1. Description: Although other encephalitic viruses could be considered as potential weapons (eg, the tick-borne encephalitis viruses), few possess as many of the required characteristics for strategic or tactical weapons development as the alphaviruses: These viruses can be produced in large amounts in inexpensive and unsophisticated systems; They are relatively stable and highly infectious for humans as aerosols; Strains are available that produce either incapacitating or lethal infections; and the existence of multiple serotypes of VEE and EEE viruses, as well as the inherent difficulties of inducing efficient mucosal immunity, confound defensive vaccine development (Website 15). The equine encephalomyelitis viruses remain as highly credible threats today, and intentional release as a small-particle aerosol, from a single airplane, could be expected to infect a high percentage of individuals within an area of at least 10,000 km2. As a further complication, these viruses are readily amenable to genetic manipulation by modern recombinant deoxyribonucleic acid (DNA) technology. This capability is being used to develop safer and more effective vaccines, but in theory, could also be used to increase the weaponization potential of these viruses (Website 15).
    2. Emergency contact: At the national level, the division of Vector-borne Infectious Diseases (DVBID), Centers for Disease Control and Prevention (CDC) collects information from the states on arboviral encephalitis. Although state and federal laws do not require physicians or hospitals to report human cases, there has been good cooperation between local, state, and federal agencies in reporting cases of arboviral encephalities. Standardized report forms and electronic reporting systems are used by state epidemiologists to report cases of arboviral encephalitis. Although routine reporting of human cases of encephalitis was discontinued in 1983, many states still report cases and other relevant data on an informal basis (Website 20).
    3. Containment: Vaccination of horses is not a useful public health tool for EEE, WEE, or enzootic VEE, however, since horses are not important as amplifying hosts for these diseases. Investigational formalin-inactivated vaccines for humans are available for WEE and EEE, but they require multiple injections and are poorly immunogenic. Insecticide measures of vector control may also have an impact on ameliorating epidemic transmission (Website 15).

III. Infected Hosts

  1. Human:
    1. Taxonomy Information:
      1. Species:
        1. Human (Website 5):
          • GenBank Taxonomy No.: 9606
          • Scientific Name: Homo sapiens (Website 5)
          • Description: People at greatest risk to EEE are children under 15 and adults over 55. Those age groups make up 70 to 90% of the cases in a given outbreak. Both sexes are equally affected, although typically there are more males than females. Unapparent infections are the same for all age groups and for both sexes. The disease is rural in distribution and most cases are associated with wooded areas adjacent to swamps and marshes (Morris, 1988). During vector-borne EEE epidemics, the incidence of human infection is low with less than 3% of the population at risk and the neurological attack rate in one outbreak was estimated as 1 in every 23 cases of human infection (Website 15).

    2. Infection Process:
      1. Infectious Dose: Unknown
      2. Description: Bite of infected mosquito (Website 15)

    3. Disease Information:
      1. Encephalitis (i.e., Encephalitis) (Website 15):
        1. Pathogenesis Mechanism: In humans viremia occurs soon after infection and may be accompanied by a febrile prodrome. In a relatively high proportion (estimated in one study as one in 23), virus gains access to the nervous system and results in severe encephalitis. Viremia is usually undetectable and HI or neutralizing antibody is present in samples taken during the first 3 to 5 days of encephalitis. Despite this evidence of an effective humoral immune response, virus is not eradicated from the brain and neuronal destruction continues through direct CPE, inflammatory damage, and vasculitis (Johnston and Peters, 1996). The primary pathological features of EEE are confined to the CNS. Lesions are scattered throughout the cortex, hippocampus, and pons and are particularly severe in basal ganglia and thalamus; cerebellum and spinal cord are minimally involved. There is extensive neuronal necrosis as well as thrombosis of arterioles and venules. Inflammatory cells are widespread in lesions, perivascular areas, and meninges. The cells are predominantly polymorphonuclear in the first week, but later mononuclear cells may predominate (Johnston and Peters, 1996).

          • Infected Vero Cell Culture (Website 22):



            Description: This is an ultra-thin section of a Vero cell culture infected for 24 hours. Virions have accumulated in the space between cells as a result of budding from the surface membrane of infected cells. In this infection very large numbers of the 60 nm (nanometer) spherical virions are produced quickly and as quickly the cells are destroyed. Magnification approximately x70,000. Micrograph from F. A. Murphy, School of Veterinary Medicine, University of California, Davis.


        2. Incubation Period: The incubation period in humans varies from 5 to 15 days (Website 15).


        3. Prognosis: The prognosis for the infected patient is extremely poor; 50-70% of patients die. The morbidity rate is approximately 90%, representing a wide range of mild to severe impairment. Only 10% of patients fully recover. The average duration of hospitalization is 16-20 days. Most patients die within a few days (Website 16). Children younger than 10 years of age are most susceptible, with one of eight infections in children resulting in encephalitis compared to one encephalitis case in 23 infections in adults. The case fatality rate was 60% to 70% in earlier studies and 30% to 40% in more recent studies, with the highest rates in children and the elderly (Griffin, 2001).


        4. Symptom Information :
          • Syndrome -- Eastern Equine Encephalitis:
            • Description: Neurologic symptoms/CNS Impairment (Website 16)
            • Observed: During vector-borne EEE epidemics, the incidence of human infection is low (less than 3% of the population at risk), and the neurological attack rate in one outbreak was estimated as 1 in every 23 cases of human infection (Website 15).
          • Headache:
          • Nausea or vomiting:
            • Description: Nausea or vomiting. The illness is characterized by rapid onset of high fever, vomiting, stiff neck, and drowsiness (Website 16, Website 15).
            • Observed: Present in both prodromal and active stages of the infection (Website 16). 61% prevalence of vomiting and nausea in EEE cases has been reported (Deresiewicz et al., 1997).
          • Confusion:
          • Seizures:
            • Description: Seizures (Website 16)
            • Observed: Approximately 50% (Website 16). Up to 30% of survivors are left with neurological sequelae such as seizures, spastic paralysis, and cranial neuropathies (Website 15).
          • Somnolence:
          • Neck stiffness:
            • Description: Neck stiffness. The illness is characterized by rapid onset of high fever, vomiting, stiff neck, and drowsiness (Website 16, Website 15).
            • Observed: 36% of patients report neck stiffness (Deresiewicz et al., 1997).
          • Malaise and weakness:
          • Cranial nerve palsies:
            • Description: Cranial nerve palsies, with cranial nerves VI, VII, and occasionally XII being the most commonly affected (Website 16).
            • Observed: Up to 30% of survivors are left with neurological sequelae such as seizures, spastic paralysis, and cranial neuropathies (Website 15).
          • Photophobia:
          • Autonomic disturbances:
            • Description: Autonomic disturbances (Website 16)
          • Fever:
            • Description: Fever (Website 16, Deresiewicz et al., 1997)
            • Observed: The illness is characterized by rapid onset of high fever, vomiting, stiff neck, and drowsiness (Deresiewicz et al., 1997, Website 15). Adults typically exhibit a febrile prodrome for up to 11 days before the onset of neurological disease; however, illness in children exhibits a more sudden onset. Viremia occurs during the febrile prodrome, but is usually undetectable by the time clinical encephalitis develops, when HI and neutralizing antibodies become evident (Deresiewicz et al., 1997, Website 15). 83% prevalence of fever has been reported (Deresiewicz et al., 1997).
          • Chills:
          • Abdominal pain:
          • Sore throat:
          • Athralgia or myalgia:
          • Respiratory difficulty:
            • Description: Respiratory difficulty (Website 16)
          • Mental retardation:
          • Paralysis:
            • Description: Paralysis (Website 16)
            • Observed: Up to 30% of survivors are left with neurological sequelae such as seizures, spastic paralysis, and cranial neuropathies (Website 15).
          • Behavioral changes:
          • Permanent focal neurologic deficits:
            • Description: Permanent focal neurologic deficits (Website 15)
            • Observed: Up to 30% of survivors are left with neurological sequelae such as seizures, spastic paralysis, and cranial neuropathies (Website 15).
          • Seizure disorders:
            • Description: Seizure disorders (Website 16)
            • Observed: Up to 30% of survivors are left with neurological sequelae such as seizures, spastic paralysis, and cranial neuropathies (Website 15). Seizures have been in 25% of patients (Deresiewicz et al., 1997).

        5. Treatment Information:
          • Anticonvulsants (Website 16): May act in motor cortex where may inhibit spread of seizure activity. Activity of brain stem centers responsible for tonic phase of grand mal seizures also may be inhibited (Website 16).
            • Applicable: Anticonvulsants like dilantin/phenytoin (Website 16).
            • Contraindicator: Persons with the following conditions should not use this drug. These include delayed hypersensitivity, sinoatrial block, second- and third-degree AV block, sinus bradycardia, Adams-Stokes syndrome, and pregnancy (Website 16).
            • Complication: Complications may include: blood dyscrasia; exfoliative, bulbous, or purpuric skin rash; death from cardiac arrest marked by QRS widening following a rapid IV infusion; elevation of blood sugar in diabetics or in acute intermittent porphyria; hepatic dysfunction; sedation; and hypotension (Website 16).
          • Corticosteroids (Website 16): Dexamethasone (Decadron, AK-Dex, Alba-Dex) decreases inflammation by suppressing migration of polymorphonuclear leukocytes and reducing capillary permeability. Usually administered by IV for various allergic and inflammatory diseases (Website 16).
            • Applicable: Corticosteroids like dexamethasone (Decadron, AK-Dex, Alba-Dex) can be used by both adults and children (Website 16).
            • Contraindicator: Safety in pregnancy has not been established. Do not use this drug if you have any of the following conditions: documented hypersensitivity; an active bacterial infection; an active fungal infection; or an active tubercular skin infection (Website 16).
            • Complication: Use of this drug may result in the following complications: an increased risk of severe infections; adrenal crisis following an abrupt discontinuation of glucocorticoids; hyperglycemia; edema; osteonecrosis; myopathy; peptic ulcer disease; hypokalemia; osteoporosis; euphoria; psychosis; myasthemia gravis; growth suppression; and infections (Website 16).

    4. Prevention:
      1. Vaccination (Website 15):
        • Description: Vaccine (Inactivated PE-6). The PE-6 strain of EEE virus was passed in primary chick-embryo cell cultures, and then was formalin-treated and lyophilized to produce an inactivated vaccine for EEE.174 This vaccine is administered as a 0.5-mL dose subcutaneously on days 0 and 28, with 0.1-mL intradermal booster doses given as needed to maintain neutralizing antibody titers (Website 15).
        • Efficacy:
          • Rate: 58%. A long-term follow-up study of 573 recipients indicated a 58% response rate after the primary series, and a 25% chance of failing to maintain adequate titers for 1 year. Response rates and persistence of titers increased with the administration of additional booster doses (Website 15).
          • Duration: 75% of those inoculated maintained adequate titers for one year (Website 15).
        • Complication: Mild reactions to the vaccine were observed, and immunogenicity was demonstrated in initial clinical trials (Website 15).
      2. Mosquito avoidance (Website 16):
        • Description: Limit exposure to mosquitoes. Warn individuals who live in high-risk areas to take the necessary precautions. This includes wearing appropriate clothing (eg, long pants, long-sleeved shirts), wearing mosquito repellant, avoiding areas with high mosquito activity, and avoiding outside activity during times of day when mosquitoes are active. Mosquito netting at nighttime also can be used if appropriate (Website 16).
      3. Environmental animal control (Website 16, MMWR, 2003):
        • Description: Environmental animal control. The potential exists for monitoring the sources of infection by assessing serology of antibodies to EEE in certain wild birds or caged flocks of sentinel birds (eg, chickens). The virus also may be recovered from adult mosquitoes and may provide an opportunity for screening in possible vector habitats. Officials should control the vector mosquito population in areas where the virus has been isolated or where a high risk of infection exists (Website 16). Ground and aerial applications of insecticides are used to control populations of adult mosquitoes, which spread such diseases as West Nile virus and related illness, eastern equine encephalitis, and dengue fever (MMWR, 2003). When insecticides are used, public health agencies should inform the public when and where spraying will occur and communicate how to reduce the likelihood of exposure. To avoid direct exposure from passing spray trucks, public health agencies should ensure that visible and audible warnings are made before spraying. Persons with exposure-related health concerns should consult their health-care providers. To prevent exposures from improper application methods, insecticide handlers and applicators should be trained in proper insecticide handling and application methods and in the use of appropriate personal protective equipment (MMWR, 2003).
        • Complication: Of the 133 reported cases of pesticide-related illness, 95 (71.4%) cases were associated with organophosphates, primarily malathion. Malathion alone was associated with 64 (67.4%) of the 95 cases; 37 (27.8%) cases were associated with pyrethoids, primarily sumithrin (24 cases) and resmethrin (10 cases). Illness severity was categorized for all cases. One exposure was associated with illness of high severity. When her neighborhood was sprayed, a woman aged 54 years was exposed to sumithrin, which passed through operating window fans and a window air conditioner. She had exacerbation of her asthma and chronic obstructive pulmonary disease. The majority of the remaining cases were of low (65.4%) or moderate (33.8%) severity. The majority of cases were associated either with respiratory (66.2%) or neurologic (60.9%) dysfunction. Other systems affected were gastrointestinal (45.1%), ocular (36.1%), dermal (27.1%), cardiovascular (12.0%), renal-genitourinary (3.0%), and miscellaneous (28.6%) (MMWR, 2003).

    5. Model System:
      1. Rodent:
        1. Model Host: Mus musculus (Johnston and Peters, 1996)
        2. Model Pathogens:
        3. Description: Isolation of alphaviruses from vertebrate sera during acute disease or from postmortem brain samples, as well as isolation from invertebrate hosts, has been accomplished most often by intracerebral inoculation of neonatal mice, an animal model that is extremely susceptible to most, if not all, alphaviruses (Johnston and Peters, 1996). Newborn mice show extensive neuronal damage and rapid death. At age 3 to 4 weeks, mice become relatively reisistant to peripherla, but not intracerebral inoculation of the virus (Griffin, 2001).
      2. Rhesus monkey:
        1. Model Host: Rhesus monkey (Griffin, 2001, Nathanson et al., 1969)
        2. Model Pathogens:
        3. Description: Laboratory studies of monkeys, mice, guinea pigs, and hamsters confirm the neurovirulence of EEEV for mammals (Griffin, 2001).
      3. Guinea pig:
        1. Model Host: Guinea pig (Griffin, 2001, Sorrention et al., 1968)
        2. Model Pathogens:
        3. Description: Laboratory studies of monkeys, mice, guinea pigs, and hamsters confirm the neurovirulence of EEEV for mammals (Griffin, 2001).
      4. Hamster:
        1. Model Host: Hamster (Griffin, 2001)
        2. Model Pathogens:
        3. Description: Laboratory studies of monkeys, mice, guinea pigs, and hamsters confirm the neurovirulence of EEEV for mammals. Hamsters develop encephalitis, hepatitis, and lymphatic organ infection (Griffin, 2001).
  2. Mosquito:
    1. Taxonomy Information:
      1. Species:
        1. Mosquito (Website 9):
          • GenBank Taxonomy No.: 174825
          • Scientific Name: Culiseta (Website 9)
          • Description: Enzootic transmission of EEE virus occurs almost exclusively between passerine birds (ie, the perching songbirds) and the mosquito Culiseta melanura (Website 15). EEEV isolations have been reported in the literature from 23 species in six genera, and more than 80% of these have been from Culiseta melanura (Morris, 1988). Culiseta melanura is the primary enzootic vector for EEEV in North America (Griffin, 2001).
        2. Mosquitoes (Website 7):
          • GenBank Taxonomy No.: 7157
          • Scientific Name: Culicidae (Website 7)
          • Description: Enzootic transmission of EEE virus occurs almost exclusively between passerine birds (ie, the perching songbirds) and the mosquito Culiseta melanura. Because of the strict ornithophilic feeding behavior of this mosquito, human and equine disease requires the involvement of more general feeders, known as bridging vectors, such as members of the genera Aedes and Coquillettidia. Mosquito vectors belonging to Culex species are thought to play a role in maintaining and transmitting South American EEE strains (Website 15). EEEV isolations have been reported in the literature from 23 species of mosquitoes in six genera (Morris, 1988).

    2. Infection Process:

      No infection process information is currently available here.

    3. Disease Information:

      No disease information is currently available here.

    4. Prevention:

      No prevention information is currently available here.

    5. Model System:

      No model system information is currently available here.

  3. Birds:
    1. Taxonomy Information:
      1. Species:
        1. Birds (Website 8):
          • GenBank Taxonomy No.: 8782
          • Scientific Name: Aves (Website 8)
          • Description: Birds are the primary reservoir host, and many species are susceptible to infection, but often remain asymptomatic despite prolonged viremia. The amplifying species for EEEV in North America are wading birds, migratory passerine songbirds, and starlings. Young birds in general are probably important for virus amplification because they are more susceptible to infection, have a prolonged viremia, and are less defensive towards mosquitoes (Griffin, 2001). Clinical signs of EEEV infection in domestic fowl (pheasants, chickens, chukars, ducks, turkeys) and wild birds have been described in detail (Morris, 1988). EEEV infection in wild birds may result in disease in introduced species such as the English sparrow, ring-necked pheasant, and domestic pigeons. Die-offs of native birds, especially small species, have been noted during EEV epizootics, but the causes of death was not conclusively identified as EEEV (Morris, 1988).

    2. Infection Process:

      No infection process information is currently available here.

    3. Disease Information:

      No disease information is currently available here.

    4. Prevention:

      No prevention information is currently available here.

    5. Model System:

      No model system information is currently available here.

  4. Horse:
    1. Taxonomy Information:
      1. Species:
        1. Domestic horse (Website 6):
          • GenBank Taxonomy No.: 9796
          • Scientific Name: Equus caballus (Website 6)
          • Description: The pattern of EEE infection of horses is similar to that of humans. There is viremia for 1 to 3 days, asymptomatic or associated with fever. Viremia ceases, and serum-neutralizing antibody appears. In some horses there then ensues a severe and usually fatal febrile encephalitis. The necrotizing pathological pattern seen in humans also occurs in equines, but the prominent polymorphonuclear response is only observed in animals dying in the first 2 days of illness (Johnston and Peters, 1996).

    2. Infection Process:

      No infection process information is currently available here.

    3. Disease Information:

      No disease information is currently available here.

    4. Prevention:

      No prevention information is currently available here.

    5. Model System:

      No model system information is currently available here.

  5. Bats:
    1. Taxonomy Information:
      1. Species:
        1. Bats (Website 11):
          • GenBank Taxonomy No.: 9397
          • Scientific Name: Chiroptera (Website 11)
          • Description: In Central and South America, forest-dwelling rodents, bats, and marsupials are frequently infected and may provide an additional reservoir, but these transmission cycles are not well characterized (Griffin, 2001).

    2. Infection Process:

      No infection process information is currently available here.

    3. Disease Information:

      No disease information is currently available here.

    4. Prevention:

      No prevention information is currently available here.

    5. Model System:

      No model system information is currently available here.

  6. Rodents:
    1. Taxonomy Information:
      1. Species:
        1. Rodents (Website 10):
          • GenBank Taxonomy No.: 9989
          • Scientific Name: Rodentia (Website 10)
          • Description: In Central and South America, forest-dwelling rodents, bats, and marsupials are frequently infected and may provide an additional reservoir, but these transmission cycles are not well characterized (Griffin, 2001).

    2. Infection Process:

      No infection process information is currently available here.

    3. Disease Information:

      No disease information is currently available here.

    4. Prevention:

      No prevention information is currently available here.

    5. Model System:

      No model system information is currently available here.

  7. Marsuipial:
    1. Taxonomy Information:
      1. Species:
        1. Marsupials (Website 12):
          • GenBank Taxonomy No.: 9263
          • Scientific Name: Metatheria (Website 12)
          • Description: In Central and South America, forest-dwelling rodents, bats, and marsupials are frequently infected and may provide an additional reservoir, but these transmission cycles are not well characterized (Griffin, 2001).

    2. Infection Process:

      No infection process information is currently available here.

    3. Disease Information:

      No disease information is currently available here.

    4. Prevention:

      No prevention information is currently available here.

    5. Model System:

      No model system information is currently available here.


IV. Labwork Information

A. Biosafety Information:
  1. Biosafety information for : Eastern Equine Encephalitis virus :
    • Biosafety Level: Level 2 for diagnostic, level 3 for propagation and animal work.
    • Precautions:
      • Biosafety Level 2 is similar to Biosafety Level 1 and is suitable for work involving agents of moderate potential hazard to personnel and the environment. It differs from BSL-1 in that (1) laboratory personnel have specific training in handling pathogenic agents and are directed by competent scientists; (2) access to the laboratory is limited when work is being conducted; (3) extreme precautions are taken with contaminated sharp items; and (4) certain procedures in which infectious aerosols or splashes may be created are conducted in biological safety cabinets or other physical containment equipment (Website 18). Biosafety Level 3 is applicable to clinical, diagnostic, teaching, research, or production facilities in which work is done with indigenous or exotic agents which may cause serious or potentially lethal disease as a result of exposure by the inhalation route. Laboratory personnel have specific training in handling pathogenic and potentially lethal agents, and are supervised by competent scientists who are experienced in working with these agents. All procedures involving the manipulation of infectious materials are conducted within biological safety cabinets or other physical containment devices, or by personnel wearing appropriate personal protective clothing and equipment. The laboratory has special engineering and design features. It is recognized, however, that some existing facilities may not have all the facility features recommended for Biosafety Level 3 (i.e., double-door access zone and sealed penetrations). In this circumstance, an acceptable level of safety for the conduct of routine procedures, (e.g., diagnostic procedures involving the propagation of an agent for identification, typing, susceptibility testing, etc.), may be achieved in a Biosafety Level 2 facility, providing 1) the exhaust air from the laboratory room is discharged to the outdoors, 2) the ventilation to the laboratory is balanced to provide directional airflow into the room, 3) access to the laboratory is restricted when work is in progress, and 4) the recommended Standard Microbiological Practices, Special Practices, and Safety Equipment for Biosafety Level 3 are rigorously followed. The decision to implement this modification of Biosafety Level 3 recommendations should be made only by the laboratory director (Website 18).
B. Culturing Information:
  1. EEE Culture Information :
    1. Description: Previously, the recovery of EEE was limited because only a few facilities had the resources to amplify the virus. Recent studies indicate excellent growth of the virus recovered from patient CSF in A549 and MRC-5 cell cultures, which are mediums that virology labs routinely use to recover adenovirus, herpes simplex virus (HSV), and enterovirus (Website 16). Virus can be isolated from CSF, blood, or CNS tissue by inoculation into newborn mice or onto a variety of tissue-culture cells, most commonly CSF or Vero cells (Griffin, 2001).

C. Diagnostic Tests :
  1. Organism Detection Tests:
    1. Electron Microscopy:
      1. Description: Enveloped Toga virus particles were demonstrated by means of an electron microscopy in the brain tissues of a 3-year-old girl with acute encephalitis. Areas of demyelinization and necrosis throughout the white matter and brainstem were revealed by light microscopy. These viral particles were identified as eastern equine encephalomyelitis virus in postmortem isolation of the virus utilizing young mice and complement-fixation studies. To the authors' knowledge, this is the first demonstration of eastern equine encephalomyelitis virus particles in human tissues by electron microscopy (Bastian et al., 1975).
    2. Indirect Fluorescent Antibody:
      1. Description: Tissues were tested for virus by intracerebral inoculation of suckling mice and by examination of frozen sections and impression smears by the indirect fluorescent antibody (FA) technique. The FA technique appears useful for the rapid diagnosis of fatal eastern equine encephalomyelitis and may be applicable in laboratories not equipped for isolation of viruses (Monath et al., 1981).
    3. Inoculation of neonatal mice:
      1. Description: Isolation of alphaviruses from vertebrate sera during acute disease or from postmortem brain samples, as well as isolation from invertebrate hosts, has been accomplished most often by intracerebral inoculation of neonatal mice, an animal model that is extremely susceptible to most, if not all, alphaviruses. Because alphaviruses produce an extensive cytopathic effect in almost all common vertebrate cell cultures examined, this also is an effective means of isolation (Johnston and Peters, 1996).

  2. Immunoassay Tests:
    1. Hemagglutination:
      1. Description: Biochemical assays are valuable for EEE diagnosis. With early suspicion, obtain sera at 2- to 3-day intervals. A potential drawback is the inability to rapidly receive these test results (Website 16). Hemagglutination inhibition, although cross-reactive throughout the alphavirus genus, nonetheless retains sufficient specificity to define six antigen complexes or serotypes, which include the antigenic complexes of Western equine encephalitis, Venezuelan equine enchephalitis, Eastern equine encephalitis, Semilik forest, Middleburg, Nduma, and Barmah Forest (Johnston and Peters, 1996). Identification of a specific virus or subtype usually requires neutralization tests or modified hemagglutination tests. The kinetic hemagglutination inhibition test, for example, is extremely useful in differentiating subtypes of Venezuelan equine encephalitis virus as well as geographic varieties of eastern equine encephalitis and Ross river virus (Johnston and Peters, 1996).
    2. Complement Fixation:
      1. Description: Biochemical assays are valuable for EEE diagnosis. With early suspicion, obtain sera at 2- to 3-day intervals. A potential drawback is the inability to rapidly receive these test results. Complement fixation titer of at least 1:128 occurs in convalescing patients (Website 16).
    3. IgM capture ELISA:
      1. Description: IgM capture ELISA is usually sufficiently specific and gives a rapid inexpensive assessment of recent infection using a single early convalescent serum sample (Johnston and Peters, 1996).
    4. ELISA to identify EEE in Mosquitoes:
      1. Description: Surveillance of mosquito populations for virus activity is not often performed by small, vector-control districts because they do not have the financial resources to use virus isolation, or newer methods such as the polymerase chain reaction. Consequently, development and refinements of rapid, sensitive, and simple enzyme-linked immunosorbent assays (ELISAs) applicable to a wide variety of public health settings are justified. We have developed an antigen-capture ELISA for the detection of eastern equine encephalitis (EEE) virus in mosquitoes that uses both monoclonal capture and detector antibodies. The sensitivity of this assay is 4.0-5.0 log10 plaque-forming units/ml, which is comparable to previously published EEE antigen-capture assays developed with polyclonal antibody reagents. This test identifies only North American strains of EEE virus and does not react with either western equine encephalitis or Highlands J viruses. Test sensitivity was enhanced by sonicating mosquito pools, treating them with Triton X-100, and increasing the time and temperature of antigen incubation. The conversion of this ELISA to a monoclonal antibody-based format should result in a readily standardizable and transferable assay that will permit laboratories lacking virus isolation facilities to conduct EEE virus surveillance (Brown et al., 2001).
    5. ELISA Information:
      1. Description: Biochemical assays are valuable for EEE diagnosis. With early suspicion, obtain sera at 2- to 3-day intervals. A potential drawback is the inability to rapidly receive these test results (Website 16). Enzyme-linked immunosorbent assay (ELISA) detects IgM, primarily during convalescent stages or prolonged courses. ELISA may detect antiarboviral immunoglobulin G (IgG), which has similar results to the neutralization assay, used primarily as an adjunct to the IgM ELISA. IgM antibodies can be detected 0-3 days after onset of clinical symptoms and usually decline to undetectable levels within four months of onset. Measurement of IgM in CSF is test of choice when CNS disease is suspected. It has very good sensitivity (Website 16).
    6. Neutralization test:
      1. Description: Identification of a specific virus or subtype usually requires neutralization tests or modified hemagglutination tests. The neutralization test has continued to provide the highest specificity for the infecting virus species (Johnston and Peters, 1996).
    7. Enzyme immunoassay:
      1. Description: Antibody to EEE is usually measured by enzyme immunoassay (EIA) with detection of IgM in serum and CSF particularly useful (Griffin, 2001).
    8. mAB-based Epitope Blocking Assay:
      1. Time to Perform: unknown
      2. Description: An epitope blocking assay using an EEEV glycoprotein E1-expressing recombinant Sindbis virus and virus-specific monoclonal antibodies (mAbs) binding to the E1 of EEEV (strain NJ/60) and the E1 of Sindbis virus was established using automated flow cytometry. The test was evaluated using sera of infected and vaccinated rabbits. A cut-off value of 30% inhibition for antigenic complex-specific seroconversion was found to be sufficient for the detection of the respective infection. By using three different mAbs in parallel, we were able to detect alphavirus genus-, EEEV- and WEEV-complex-specific serum antibodies. As this test is based on the inhibition of binding of virus-specific mAbs, sera of every origin other than mouse can be tested. Thus, this assay may prove useful in the serological screening of a variety of animal species during an outbreak investigation (Passler and Pfeffer, 2003).

  3. Nucleic Acid Detection Tests: :
    1. PCR of Bird Brains:
      1. Description: Using homogenized bird brains as template, the EEE primers were able to detect EEE in RNA dilutions as high as 10(-8) (Website 19).
    2. PCR of Tissue Culture:
      1. Description: Homogenates of 100 mosquitoes were used, and EEE could be detected by RT-PCR at 100-fold dilution in tissue culture. Viral EEE could be detected at 1000-fold dilution using this method (Huang et al., 2001).
    3. PCR:
      1. Description: The EEE-specific assay described here was able to amplify the RNA of two EEE isolates from Brazil. This is in contrast to the EEE-specific assay described by Armstrong and coworkers, which failed to detect the RNA of EEE strains from Panama and Brazil. Optimal results were obtained with 0.1 uM concentrations each of primers EEE-4 (CTAGTTGAGCACAAACACCGCA) and cEEE-7 (CACTTGCAAGGTGTCGTCTGCCCTC), which were derived from the E2 gene (Linssen et al., 2000).
      2. Primers:
        • Pair of primers
          • Forward: CTAGTTGAGCACAAACACCGCA
          • Reverse: CACTTGCAAGGTGTCGTCTGCCCTC
    4. NASBA PCR, RT-PCR, and TaqMan amplification:
      1. Description: Nucleic acid sequence-based amplification (NASBA), standard reverse transcription PCR (RT-PCR), and TaqMan nucleic acid amplification assays for the rapid detection of North American eastern equine encephalitis (EEE) and western equine encephalitis (WEE) viral RNAs from samples collected in the field and clinical samples was developed. The sensitivities of these assays have been compared to that of virus isolation. While all three types of nucleic acid amplification assays provide rapid detection of viral RNAs comparable to the isolation of viruses in Vero cells, the TaqMan assays for North American EEE and WEE viral RNAs are the most sensitive. We have shown these assays to be specific for North American EEE and WEE viral RNAs by testing geographically and temporally distinct strains of EEE and WEE viruses along with a battery of related and unrelated arthropodborne viruses. In addition, all three types of nucleic acid amplification assays have been used to detect North American EEE and WEE viral RNAs from mosquito and vertebrate tissue samples. The sensitivity, specificity, and rapidity of nucleic acid amplification demonstrate the usefulness of NASBA, standard RT-PCR, and TaqMan assays, in both research and diagnostic settings, to detect North American EEE and WEE viral RNAs (Lambert et al., 2003).
      2. Primers:
        • EEE NASBA
          • Forward: EEE 9597 gatgcaaggtcgcatatgagCACATGGATGGCCGCACGAA
          • Reverse: EEE 9804 aattctaatacgactcactatagggagaaggCAGCAAAGTAACGCCAGGAGTA
          • Product
            • Size: 208 bp
        • EEE RT-PCR
          • Forward: EEE 5640 CGGCAGCGGAATTTGACGAG
          • Reverse: EEE 6072 ACTTTGACGGCCACTTCTGCTGATGA
          • Product
            • Size: 433 bp
        • EEE TaqMan
          • Forward: EEE 9391 ACACCGCACCCTGATTTTACA
          • Reverse: EEE 9459 CTTCCAAGTGACCTGGTCGTC
          • Product
            • Size: 69 bp
      3. False Positive: To evaluate the specificities of the North American EEE virus NASBA, standard RT-PCR, and TaqMan assays, 14 isolates of EEE virus including representatives of both North American and South American antigenic groups were tested. We also tested related alphaviruses (Highlands J, Venezuelan equine encephalitis [VEE], and WEE viruses) and unrelated arboviruses that circulate throughout the Americas (La Crosse, dengue 2, Powassan, and yellow fever viruses). The NASBA, standard RT-PCR, and TaqMan assays detected all of the North American EEE virus isolates tested. These assays were specific for North American EEE virus and did not detect South American EEE virus, related alphaviral, or unrelated arboviral RNAs (with the exception of the NASBA assay detection of one South American EEE virus strain, Ecuador 1974) (Lambert et al., 2003).

  4. Other Types of Diagnostic Tests:

    No other tests available here.


V. References

A. Journal References:
Bastian et al., 1975: Bastian F.O. , Wende R.D. , Singer D.B. , Zeller RS. Eastern equine encephalomyelitis. Histopathologic and ultrastructural changes with isolation of the virus in a human case . Am J Clin Pathol . 1975 ; 64 ( 1 ): 10 - 13 . [PubMed: 1171613].
Brault et al., 1999: Brault A.C. , Powers A.M. , Chavez C.L. , Lopez RN, Cachon MF, Gutierrez LF, Kang W, Tesh RB, Shope RE, Weaver SC. Genetic and antigenic diversity among eastern equine encephalitis viruses from North, Central, and South America . American Journal of Tropical Medicine and Hygiene . 1999 ; 61 ( 4 ): 579 - 586 . [PubMed: 10548292].
Brault et al., 2002: Brault Aaron C. , Powers Ann M. , Holmes Edward C. , Woelk CH, Weaver SC. Positively charged amino acid substitutions in the E2 envelope glycoprotein are associated with the emergence of venezuelan equine encephalitis virus . Journal of Virology . 2002 ; 76 ( 4 ): 1718 - 1730 . [PubMed: 11799167].
Brown et al., 2001: Brown TM , Mitchell CJ , Nasci RS , Smith GC, Roehrig JT. Detection of eastern equine encephalitis virus in infected mosquitoes using a monoclonal antibody-based antigen-capture enzyme-linked immunosorbent assay. . Am J Trop Med Hyg. . 2001 ; 65 ( 3 ): 208 - 213 . [PubMed: 11561706].
Deresiewicz et al., 1997: Deresiewicz R.L. , Thaler S.J. , Hsu L. , Zamanii Clinical and neuroradiographic manifestations of eastern equine encephalitis . N Engl J Med . 1997 ; 336 ( 26 ): 1867 - 1874 . [PubMed: 9197215].
Huang et al., 2001: Huang Cinnia , Slater Brett , Campbell Wayne , Howard J, White D. Detection of arboviral RNA directly from mosquito homogenates by reverse-transcription polymerase chain reaction . Journal of Virological Methods . 2001 ; 94 ( 1-2 ): 121 - 128 . [PubMed: 11337046].
Lambert et al., 2003: Lambert AJ , Martin DA , Lanciotti RS Detection of North American eastern and western equine encephalitis viruses by nucleic acid amplification assays . J Clin Microbiol. . 2003 ; 41 ( 1 ): 379 - 385 . [PubMed: 12517876].
Linssen et al., 2000: Linssen Bettina , Kinney Richard M. , Aguilar Patricia , Russell KL, Watts DM, Kaaden OR, Pfeffer M. Development of Reverse Transcription-PCR Assays Specific for Detection of Equine Encephalitis Viruses . Journal of Clinical Microbiology . 2000 ; 38 ( 4 ): 1527 - 1535 . [PubMed: 10747138].
MMWR, 2003: Surveillance for acute insecticide-related illness associated with mosquito-control efforts--nine states, 1999-2002. . MMWR Morb Mortal Wkly Rep . 2003 ; 52 ( 27 ): 629 - 634 . [PubMed: 12855943].
Monath et al., 1981: Monath T.P. , McLean R.G. , Cropp C.P. , Parham GL, Lazuick JS, Calisher CH. Diagnosis of eastern equine encephalomyelitis by immunofluorescent staining of brain tissue . Am J Vet Res . 1981 ; 42 ( 8 ): 1418 - 1421 . [PubMed: 7027847].
Nathanson et al., 1969: Nathanson N. , Stolley P.D. , Boolukos P.J. Eastern equine encephalitis. Distribution of central nervous system lesions in man and Rhesus monkey . J Comp Pathol . 1969 ; 79 ( 1 ): 109 - 115 . [PubMed: 4975613].
Passler and Pfeffer, 2003: Passler S, Pfeffer M Detection of antibodies to alphaviruses and discrimination between antibodies to eastern and western equine encephalitis viruses in rabbit sera using a recombinant antigen and virus-specific monoclonal antibodies.. J Vet Med B Infect Dis Vet Public Health.. 2003; 50(6): 265 - 269. [PubMed: 14628996].
Sorrention et al., 1968: Sorrentino J.V. , Berman S. , Lowenthal J.P. , Cutchins E. The immunologic response of the guinea pig to Eastern equine encephalomyelitis vaccines. . Am J Trop Med Hyg . 1968 ; 17 ( 4 ): 619 - 624 . [PubMed: 5672792].
Stotmayor and Josephson, 1999: Stotomayor Edgar A. , Josephson Stephen L. Isolation of Eastern Equine Encephalitis virus in A549 and MRC-5 cell cultures . Clinical Infectious Diseases . 1999 ; 29 ( 1 ): 193 - 196 . [PubMed: 10433585].
B. Book References:
Griffin, 2001: Griffin Diane E. Alphaviruses . 917 - 962 . In: Knipe David M. , Howley Peter M. Field's Virology Fourth Edition Volume 1 2001 . Lippincott Williams and Wilkins , Philadelphia Pa .
Johnston and Peters, 1996: Johnston Robert E. , Peters C.J. Alphaviruses . 843 - 898 . In: Fields Bernard N. , Knipe David M. , Howley Peter M. Field's Virology Third Edition Volume 1 1996 . Lippincott-Raven Publishers , Philadelphia PA .
Morris, 1988: Morris Charles D. Eastern Equine Encephalitis . 2 - 120 . In: Monath Thomas P. The Arboviruses: Epidemiology and Ecology Volume III 1988 . CRC Press , Boca Raton, Florida .
C. Website References:
Website 1: Mus musculus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=10090&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
Website 2: Cricetinae [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=10026&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
Website 3: Macaca mulatta [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9544&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
Website 4: Cavia porcellus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=10141&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
Website 5: Homo sapiens [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Tree&id=9606&lvl=3&keep=1&srchmode=1&unlock ].
Website 6: Equus caballus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9796&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
Website 7: Culicidae [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=7157&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
Website 8: Aves [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=8782&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
Website 9: Culiseta [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=174825&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
Website 10: Rodentia [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9989&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
Website 11: Chiroptera [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9397&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
Website 12: Metatheria [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9263&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
Website 13: Eastern equine encephalitis virus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=11021&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
Website 14: Eastern equine encephalitis virus, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_uids=21218484&dopt;=GenBank ].
Website 15: Viral Encephalitides [ http://www.vnh.org/MedAspChemBioWar/chapters/chapter_28.htm ].
Website 16: Eastern Equine Encephalitis [ http://www.emedicine.com/med/topic3155.htm ].
Website 17: Guidelines for Arbovirus Surveillance Programs in the United States [ http://www.cdc.gov/od/ohs/pdffiles/attachment5.pdf ].
Website 18: BMBL Section III. Laboratory Biosafety Level Criteria [ http://www.cdc.gov/od/ohs/biosfty/bmbl4/bmbl4s3.htm ].
Website 19: Development of a Duplex Real Time RT-PCR test for surveillance of west nile and eastern equine encephalitis viruses using the smart cycler [ http://www.smartcycler.com/pdfs/west_nile_virus2.pdf ].
Website 20: Guidelines for Arboviral Surveillance Programs in the United States. [ http://www.cdc.gov/ncidod/dvbid/arbor/arboguid.pdf ].
Website 21: Division of Vector-Borne Infectious Diseases, CDC [ http://www.cdc.gov/ncidod/dvbid/arbor/alphavir.htm ].
Website 22: UCDavis School Of Veterinary Medicine Virus Images [ http://www.vetmed.ucdavis.edu/viruses/download.html ].
D. Thesis References:

No thesis or dissertation references used.


VI. Curation Information