Cryptosporidium parvum
I. Organism Information
A. Taxonomy Information
-
Species:
-
Cryptosporidium parvum (Website 1):
-
GenBank Taxonomy No.:
5807
-
Description:
Cryptosporidium parvum is a protozoan parasite belonging to the phylum Apicomplexa, subclass Coccidia. C. parvum causes a self-limiting infection of the small intestine in immunocompetent humans or animals, but it also can be persistent and life threatening in immunocompromised individuals, particularly those with AIDS. Even though C. parvum was described in 1907, it was not recognized as a pathogen of mammals until 1971 when the infection was linked to calf diarrhea. Chronic cryptosporidiosis became recognized with the emergence of the human immunodeficiency virus (HIV) and AIDS. Human cryptosporidiosis is attributed to two major genotypes, of which type 1 is found exclusively in humans, while type 2 is zoonotic and found in other mammals, including humans (Sestak et al., 2002).
Cryptosporidium parvum is zoonotic, apparently lacking host specificity among mammals (Fayer et al., 1997).
B. Lifecycle Information
:
-
Stage Information:
-
Oocyst: :
-
Size:
Oocysts recovered from different host species may vary in size and shape ranging from 4.5 to 7.9 um in length by 4.2 to 6.5 um in width and being ovoid to elliptical in shape with shape indices (length/width) ranging from 1.0 to 1.4 (O'Donoghue, 1995).
-
Shape:
Oocysts recovered from different host species may vary in size and shape ranging from 4.5 to 7.9 um in length by 4.2 to 6.5 um in width and being ovoid to elliptical in shape with shape indices (length/width) ranging from 1.0 to 1.4 (O'Donoghue, 1995).
-
Picture(s):
-
Stained Oocysts (Website 99):
Description: Oocysts of Cryptosporidium parvum stained by the modified acid-fast method. Against a blue-green background, the oocysts stand out in a bright red stain. Sporozoites are visible inside the two oocysts to the right. Copyright: CDC.
-
Other:
- Thin-walled oocyst
Two different types of oocysts are produced, the thick-walled, which is commonly excreted from the host, and the thin-walled oocyst, which is primarily involved in autoinfection (Website 100).
- Thick-walled oocyst
Two different types of oocysts are produced, the thick-walled, which is commonly excreted from the host, and the thin-walled oocyst, which is primarily involved in autoinfection (Website 100).
-
Description:
The oocyst is the stage transmitted from an infected host to a susceptible host by the fecal-oral route. Routes of transmission can be (1) person-to-person through direct or indirect contact, possibly including sexual activities, (2) animal-to-animal, (3) animal-to-human, (4) water-borne through drinking water or recreational water, (5) food-borne, and (6) possibly airborne. To determine how many oocysts of C. parvum were required for seronegative healthy persons to become infected, 29 volunteers ingested a single dose of 30 to 1 million oocysts from a calf. After ingesting 30 oocysts, one of five persons became infected. After ingesting 1000 or more oocysts seven of seven became infected. The median infective dose (ID50) was calculated to be 132 oocysts. With further data the ID50 was recalculated to be 87 oocysts and different isolates of C. parvum were found to have highly different ID50 values (Fayer et al., 2000).
The sporulated oocyst is the only exogenous stage. Consisting of four sporozoites within a tough two-layered wall, it is excreted from the body of an infected host in the feces. The endogenous phase begins after the oocyst is ingested by a suitable host (Fayer et al., 1997).
-
Sporozoite: :
-
Size:
Free sporozoites were fusiform and measured 3.5 to 4.2 x 0.53 to 0.6 um (Reduker et al., 1985).
-
Shape:
Free sporozoites were fusiform and measured 3.5 to 4.2 x 0.53 to 0.6 um (Reduker et al., 1985).
-
Other:
-
Description:
Sporozoites and merozoites of Cryptosporidium spp. appear similar to those of other coccidia with organelles typical of the phylum, such as the pellicle, rhoptries, micronemes, electron-dense granules, nucleus, ribosomes, subpellicular microtubules, and apical rings. However, they lack other organelles such as typical polar rings, mitochondria, micropores, and the conoid. Posterior to the apical rings, sporozoites and merozoites have a cylindrical collar that appears to be the site of origin for the inner membrane complex and the subpellicular microtubules (Fayer et al., 1997).
Unlike other coccidia, the sporozoites are free within the oocysts and not surrounded by sporocysts (Spano and Crisanti, 2000).
-
Trophozoite: :
-
Shape:
Spherical (Fayer et al., 1997)
-
Description:
Trophozoites contain a prominent nucleolus within a single nucleus surrounded by cytoplasm, and a well-developed attachment/feeder organelle. During nuclear division of schizogony, division spindles, nuclear plaques, and centrioles have been observed (Fayer et al., 1997).
The trophozoite stage is intracellular beneath the host cell membrane but is extracytoplasmic (Marshall et al., 1997).
Upon attachment to an enterocyte and discharge of secretory molecules from the zoite apical organelles, C. parvum does not simply induce the typical invagination of the host plasma membrane (described, for example, in Plasmodium, Toxoplasma and Eimeria), but additionally initiates a profound structural rearrangement of the enterocyte microvilli, which elongate and eventually fuse around the invading zoite. The parasite thereby establishes itself intracellularly within a parasitophorous vacuole that is delimited by a host-derived membrane, but which lies in a singular extra-cytoplasmic position, giving the impression of being attached to the apical surface of the enterocyte. As a consequence of this peripheral location with respect to the host cell cytoplasm, all C. parvum intracellular stages (trophozoites, type I and type II meronts, gametocytes, zygotes and immature oocysts) develop the so-called feeder organelle, another peculiarity of the Cryptosporidium genus. This unique organelle has a multilamellar structure and is situated at the base of the parasitophorous vacuole. It is believed to mediate the uptake of nutrients from the host cell (Spano and Crisanti, 2000).
-
Type I Meront: :
-
Description:
Asexual multiplication, called schizogony or merogony, results when the trophozoite nucleus divides. C. parvum has two types of schizonts or meronts. For C. parvum, type I schizonts develop six or eight nuclei, and each is incorporated into a merozoite, a stage structurally similar to the sporozoite (Fayer et al., 1997).
Type I meronts form 8 merozoites which are liberated from the parasitophorous vacuole when mature (O'Donoghue, 1995).
Upon attachment to an enterocyte and discharge of secretory molecules from the zoite apical organelles, C. parvum does not simply induce the typical invagination of the host plasma membrane (described, for example, in Plasmodium, Toxoplasma and Eimeria), but additionally initiates a profound structural rearrangement of the enterocyte microvilli, which elongate and eventually fuse around the invading zoite. The parasite thereby establishes itself intracellularly within a parasitophorous vacuole that is delimited by a host-derived membrane, but which lies in a singular extra-cytoplasmic position, giving the impression of being attached to the apical surface of the enterocyte. As a consequence of this peripheral location with respect to the host cell cytoplasm, all C. parvum intracellular stages (trophozoites, type I and type II meronts, gametocytes, zygotes and immature oocysts) develop the so-called feeder organelle, another peculiarity of the Cryptosporidium genus. This unique organelle has a multilamellar structure and is situated at the base of the parasitophorous vacuole. It is believed to mediate the uptake of nutrients from the host cell (Spano and Crisanti, 2000).
-
Merozoite from Type I Meront: :
-
Description:
Sporozoites and merozoites of Cryptosporidium spp. appear similar to those of other coccidia with organelles typical of the phylum, such as the pellicle, rhoptries, micronemes, electron-dense granules, nucleus, ribosomes, subpellicular microtubules, and apical rings. However, they lack other organelles such as typical polar rings, mitochondria, micropores, and the conoid. Posterior to the apical rings, sporozoites and merozoites have a cylindrical collar that appears to be the site of origin for the inner membrane complex and the subpellicular microtubules (Fayer et al., 1997).
Each mature merozoite, theoretically, leaves the schizont to infect another host cell and develop into another type I or type II schizont which produces four merozoites. It is thought that only merozoites from type II schizonts initiate sexual multiplication (gametogony) upon infecting new host cells by differentiating into either a microgamont (male) or macrogamont (female) stage (Fayer et al., 1997).
Type I meronts form 8 merozoites which are liberated from the parasitophorous vacuole when mature. The merozoites then invade other epithelial cells where they undergo another cycle of type I merogony or develop into type II meronts (O'Donoghue, 1995).
-
Type II Meront: :
-
Description:
Each mature merozoite, theoretically, leaves the schizont to infect another host cell and develop into another type I or type II schizont which produces four merozoites. It is thought that only merozoites from type II schizonts initiate sexual multiplication (gametogony) upon infecting new host cells by differentiating into either a microgamont (male) or macrogamont (female) stage (Fayer et al., 1997).
The type II meronts form 4 merozoites which do not undergo further merogony but produce sexual reproductive stages (called gamonts) (O'Donoghue, 1995).
Upon attachment to an enterocyte and discharge of secretory molecules from the zoite apical organelles, C. parvum does not simply induce the typical invagination of the host plasma membrane (described, for example, in Plasmodium, Toxoplasma and Eimeria), but additionally initiates a profound structural rearrangement of the enterocyte microvilli, which elongate and eventually fuse around the invading zoite. The parasite thereby establishes itself intracellularly within a parasitophorous vacuole that is delimited by a host-derived membrane, but which lies in a singular extra-cytoplasmic position, giving the impression of being attached to the apical surface of the enterocyte. As a consequence of this peripheral location with respect to the host cell cytoplasm, all C. parvum intracellular stages (trophozoites, type I and type II meronts, gametocytes, zygotes and immature oocysts) develop the so-called feeder organelle, another peculiarity of the Cryptosporidium genus. This unique organelle has a multilamellar structure and is situated at the base of the parasitophorous vacuole. It is believed to mediate the uptake of nutrients from the host cell (Spano and Crisanti, 2000).
-
Merozoite from Type II Meront: :
-
Description:
Sporozoites and merozoites of Cryptosporidium spp. appear similar to those of other coccidia with organelles typical of the phylum, such as the pellicle, rhoptries, micronemes, electron-dense granules, nucleus, ribosomes, subpellicular microtubules, and apical rings. However, they lack other organelles such as typical polar rings, mitochondria, micropores, and the conoid. Posterior to the apical rings, sporozoites and merozoites have a cylindrical collar that appears to be the site of origin for the inner membrane complex and the subpellicular microtubules (Fayer et al., 1997).
The type II meronts form 4 merozoites which do not undergo further merogony but produce sexual reproductive stages (called gamonts) (O'Donoghue, 1995).
-
Microgamont: :
-
Description:
Microgamonts have been found less frequently than other stages. Immature microgamonts resemble schizonts but contain small, compact nuclei. The single surface membrane later doubles at sites around the margin where microgametes form (Fayer et al., 1997).
Microgamonts develop into microgametocytes which produce up to 16 non-flagellated microgametes (O'Donoghue, 1995).
Upon attachment to an enterocyte and discharge of secretory molecules from the zoite apical organelles, C. parvum does not simply induce the typical invagination of the host plasma membrane (described, for example, in Plasmodium, Toxoplasma and Eimeria), but additionally initiates a profound structural rearrangement of the enterocyte microvilli, which elongate and eventually fuse around the invading zoite. The parasite thereby establishes itself intracellularly within a parasitophorous vacuole that is delimited by a host-derived membrane, but which lies in a singular extra-cytoplasmic position, giving the impression of being attached to the apical surface of the enterocyte. As a consequence of this peripheral location with respect to the host cell cytoplasm, all C. parvum intracellular stages (trophozoites, type I and type II meronts, gametocytes, zygotes and immature oocysts) develop the so-called feeder organelle, another peculiarity of the Cryptosporidium genus. This unique organelle has a multilamellar structure and is situated at the base of the parasitophorous vacuole. It is believed to mediate the uptake of nutrients from the host cell (Spano and Crisanti, 2000).
-
Microgamete: :
-
Size:
Microgametes are rod shaped (1.4 x 0.5 um for C. parvum), with a flattened anterior end (Fayer et al., 1997).
-
Shape:
Microgametes are rod shaped (1.4 x 0.5 um for C. parvum), with a flattened anterior end (Fayer et al., 1997).
-
Description:
Microgametes are rod shaped (1.4 x 0.5 um for C. parvum), with a flattened anterior end and lack both flagellae and mitochondria typically observed in microgametes of other coccidia. Most of the microgamete consists of a condensed nucleus. A plasmalemma completely surrounds the body. Beneath it a single membrane extends approximately two thirds the body length. Originating at an anterior conical structure, eight microtubules extend posterior in close proximity to the surface of the nucleus. Three to five concentric lamellae extend outward at 90 degrees to the long axis at the posterior margin of the apical cap. Electron-dense granules of undetermined function are found in the cytoplasm at midbody (Fayer et al., 1997).
-
Macrogamont: :
-
Size:
Macrogamonts of C. parvum are approximately 4 to 6 um (Fayer et al., 1997).
-
Shape:
Macrogamonts of C. parvum are spherical to ovoid (Fayer et al., 1997).
-
Description:
Macrogamonts of C. parvum are approximately 4 to 6 um and spherical to ovoid, have a large central nucleus with a prominent nucleolus, and contain lipid bodies, amylopectin granules, and unique wall-forming bodies in the cytoplasm (Fayer et al., 1997).
Upon attachment to an enterocyte and discharge of secretory molecules from the zoite apical organelles, C. parvum does not simply induce the typical invagination of the host plasma membrane (described, for example, in Plasmodium, Toxoplasma and Eimeria), but additionally initiates a profound structural rearrangement of the enterocyte microvilli, which elongate and eventually fuse around the invading zoite. The parasite thereby establishes itself intracellularly within a parasitophorous vacuole that is delimited by a host-derived membrane, but which lies in a singular extra-cytoplasmic position, giving the impression of being attached to the apical surface of the enterocyte. As a consequence of this peripheral location with respect to the host cell cytoplasm, all C. parvum intracellular stages (trophozoites, type I and type II meronts, gametocytes, zygotes and immature oocysts) develop the so-called feeder organelle, another peculiarity of the Cryptosporidium genus. This unique organelle has a multilamellar structure and is situated at the base of the parasitophorous vacuole. It is believed to mediate the uptake of nutrients from the host cell (Spano and Crisanti, 2000).
-
Zygote: :
-
Other:
-
Description:
The fertilized macrogamont, or zygote, develops into an oocyst with either a thin or a thick wall (Fayer et al., 1997).
The resultant zygotes undergo further asexual development (sporogony) leading to the production of sporulated oocysts containing 4 sporozoites (O'Donoghue, 1995).
Upon attachment to an enterocyte and discharge of secretory molecules from the zoite apical organelles, C. parvum does not simply induce the typical invagination of the host plasma membrane (described, for example, in Plasmodium, Toxoplasma and Eimeria), but additionally initiates a profound structural rearrangement of the enterocyte microvilli, which elongate and eventually fuse around the invading zoite. The parasite thereby establishes itself intracellularly within a parasitophorous vacuole that is delimited by a host-derived membrane, but which lies in a singular extra-cytoplasmic position, giving the impression of being attached to the apical surface of the enterocyte. As a consequence of this peripheral location with respect to the host cell cytoplasm, all C. parvum intracellular stages (trophozoites, type I and type II meronts, gametocytes, zygotes and immature oocysts) develop the so-called feeder organelle, another peculiarity of the Cryptosporidium genus. This unique organelle has a multilamellar structure and is situated at the base of the parasitophorous vacuole. It is believed to mediate the uptake of nutrients from the host cell (Spano and Crisanti, 2000).
-
Thin-walled oocyst: :
-
Other:
-
Description:
The fertilized macrogamont, or zygote, develops into an oocyst with either a thin or a thick wall. Those that develop into thick-walled oocysts have type I and II wall-forming bodies similar to other coccidia. Those that develop into thin-walled oocysts lack the characteristic wall-forming bodies. Initially, two unit membranes form simultaneously external to the plasmalemma, while the sporont separates from the feeder/attachment organelle. Then, wall-forming body material is transported or exocytosed across the oocyst pellicle (i.e. plasmalemma and inner membrane), where it forms a thin, moderately coarse outer layer and a finely granular inner layer. Between these two layers of the oocyst wall is an electron-lucent zone that consists of the two oocyst membranes sandwiched between the outer and inner layers of the oocyst wall. The outer layer of the wall is continuous and of uniform thickness. The inner layer contains a suture at one pole which spans 1/3 to 1/2 the circumference of the oocyst (Fayer et al., 1997).
Some reports suggest that oocysts with thin walls release sporozoites that autoinfect the host, whereas those with thicker walls leave the body to infect other hosts (Fayer et al., 1997).
Approximately 20% of the zygotes develop into thin-walled oocysts, which represent auto-infective life cycle forms that can maintain the parasite in the host. This stage and the persistent meronts are believed to be responsible for the life-threatening disease in immunodeficient persons who do not have repeated exposure to environmentally resistant forms (Marshall et al., 1997).
-
Thick-walled oocyst: :
-
Size:
Oocysts recovered from different host species may vary in size and shape ranging from 4.5 to 7.9 um in length by 4.2 to 6.5 um in width and being ovoid to elliptical in shape with shape indices (length/width) ranging from 1.0 to 1.4 (O'Donoghue, 1995).
-
Shape:
Oocysts recovered from different host species may vary in size and shape ranging from 4.5 to 7.9 um in length by 4.2 to 6.5 um in width and being ovoid to elliptical in shape with shape indices (length/width) ranging from 1.0 to 1.4 (O'Donoghue, 1995).
-
Other:
-
Description:
The fertilized macrogamont, or zygote, develops into an oocyst with either a thin or a thick wall. Those that develop into thick-walled oocysts have type I and II wall-forming bodies similar to other coccidia. Those that develop into thin-walled oocysts lack the characteristic wall-forming bodies. Initially, two unit membranes form simultaneously external to the plasmalemma, while the sporont separates from the feeder/attachment organelle. Then, wall-forming body material is transported or exocytosed across the oocyst pellicle (i.e. plasmalemma and inner membrane), where it forms a thin, moderately coarse outer layer and a finely granular inner layer. Between these two layers of the oocyst wall is an electron-lucent zone that consists of the two oocyst membranes sandwiched between the outer and inner layers of the oocyst wall. The outer layer of the wall is continuous and of uniform thickness. The inner layer contains a suture at one pole which spans 1/3 to 1/2 the circumference of the oocyst. Some reports suggest that oocysts with thin walls release sporozoites that autoinfect the host, whereas those with thicker walls leave the body to infect other hosts (Fayer et al., 1997).
-
Progression Information:
-
oocyst --
From stage:
Oocyst
, To stage:
Sporozoite:
-
Description:
The oocyst is the stage transmitted from an infected host to a susceptible host by the fecal-oral route. Routes of transmission can be (1) person-to-person through direct or indirect contact, possibly including sexual activities, (2) animal-to-animal, (3) animal-to-human, (4) water-borne through drinking water or recreational water, (5) food-borne, and (6) possibly airborne (Fayer et al., 2000).
The sporulated oocyst is the only exogenous stage. Consisting of four sporozoites within a tough two-layered wall, it is excreted from the body of an infected host in the feces. The endogenous phase begins after the oocyst is ingested by a suitable host. The oocyst wall of Cryptosporidium spp., like that of other coccidia, has distinct inner and outer layers but is unique in having a suture at one end. The suture dissolves during excystation, opening the wall through which the sporozoites leave the oocyst. Sporozoites excyst from the oocyst and parasitize epithelial cells of the gastrointestinal or respiratory tract (Fayer et al., 1997).
-
sporozoite --
From stage:
Sporozoite
, To stage:
Trophozoite:
-
Description:
Sporozoites excyst from the oocyst and parasitize epithelial cells of the gastrointestinal or respiratory tract (Fayer et al., 1997). Invasion of a host cell by coccidian sporozoites is a dynamic event of considerable interest as the attachment and entry processes involve the sequential secretion of the contents of discrete compartments from within the sporozoite. The released materials are thought to participate in a number of ways, including the penetration event itself and the formation of the vacuolar membrane which initially surround the intracellular parasite. The machinery mediating this invasion process is collectively housed in the anterior region of the sporozoite and is known as the apical complex (Tetley et al., 1988). Each sporozoite differentiates into a spherical trophozoite (Fayer et al., 1997). Freed sporozoites attach to epithelial cells where they become enclosed within parasitophorous vacuoles and develop attachment organelles (stages generally referred to as trophozoites) (O'Donoghue, 1995).
-
trophozoite --
From stage:
Trophozoite
, To stage:
Type I Meront:
-
Description:
Asexual multiplication, called schizogony or merogony, results when the trophozoite nucleus divides (Fayer et al., 1997). C. parvum has two types of schizonts or meronts. For C. parvum, type I schizonts develop six or eight nuclei, and each is incorporated into a merozoite, a stage structurally similar to the sporozoite (Fayer et al., 1997).
-
MerontI --
From stage:
Type I Meront
, To stage:
Merozoite from Type I Meront:
-
Description:
Type I meronts form 8 merozoites which are liberated from the parasitophorous vacuole when mature. The merozoites then invade other epithelial cells where they undergo another cycle of type I merogony or develop into type II meronts (O'Donoghue, 1995). Each mature merozoite, theoretically, leaves the schizont to infect another host cell and develop into another type I or type II schizont which produces four merozoites. It is thought that only merozoites from type II schizonts initiate sexual multiplication (gametogony) upon infecting new host cells by differentiating into either a microgamont (male) or macrogamont (female) stage (Fayer et al., 1997).
-
merozoite --
From stage:
Merozoite from Type I Meront
, To stage:
Type II Meront:
-
Description:
Each mature merozoite, theoretically, leaves the schizont to infect another host cell and develop into another type I or type II schizont which produces four merozoites (Fayer et al., 1997). The type II meronts form 4 merozoites which do not undergo further merogony but produce sexual reproductive stages (called gamonts) (O'Donoghue, 1995).
-
MerontII --
From stage:
Type II Meront
, To stage:
Merozoite from Type II Meront:
-
Description:
It is thought that only merozoites from type II schizonts initiate sexual multiplication (gametogony) upon infecting new host cells by differentiating into either a microgamont (male) or a macrogamont (female) stage (Fayer et al., 1997).
-
merozoite2 --
From stage:
Merozoite from Type II Meront
, To stage:
Macrogamont:
-
Description:
Each mature merozoite, theoretically, leaves the schizont to infect another host cell and develop into another type I or type II schizont which produces four merozoites. It is thought that only merozoites from type II schizonts initiate sexual multiplication (gametogony) upon infecting new host cells by differentiating into either a microgamont (male) or macrogamont (female) stage (Fayer et al., 1997). Macrogamonts of C. parvum are approximately 4 to 6 um and spherical to ovoid, have a large central nucleus with a prominent nucleolus, and contain lipid bodies, amylopectin granules, and unique wall-forming bodies in the cytoplasm (Fayer et al., 1997).
-
merozoite2 --
From stage:
Merozoite from Type II Meront
, To stage:
Microgamont:
-
Description:
Each mature merozoite, theoretically, leaves the schizont to infect another host cell and develop into another type I or type II schizont which produces four merozoites. It is thought that only merozoites from type II schizonts initiate sexual multiplication (gametogony) upon infecting new host cells by differentiating into either a microgamont (male) or macrogamont (female) stage (Fayer et al., 1997). Microgamonts have been found less frequently than other stages. Immature microgamonts resemble schizonts but contain small, compact nuclei. The single surface membrane later doubles at sites around the margin where microgametes form (Fayer et al., 1997).
-
microgamont --
From stage:
Microgamont
, To stage:
Microgamete:
-
Description:
Each microgamont becomes multinucleate, and each nucleus is incorporated into a microgamete, a sperm cell equivalent (Fayer et al., 1997).
-
microgamete macrogamont --
From stage:
Microgamete, Macrogamont
, To stage:
Zygote:
-
Description:
Little of the fertilization process of a macrogamont by a microgamete has been recorded, suggesting that the process is rapid. Microgametes attach at their apical cap to the surface of host cells harboring macrogamonts. Only the microgamete nucleus and associated microtubules have been observed within macrogamonts. Fusion of nuclei has not been observed (Fayer et al.,1997). It is assumed that only fertilized macrogamonts develop into oocysts that sporulate in situ and contain four sporozoites (Fayer et al., 1997). The fertilized macrogamont, or zygote, develops into an oocyst with either a thin or a thick wall (Fayer et al., 1997).
-
zygote --
From stage:
Zygote
, To stage:
Thin-walled oocyst, Thick-walled oocyst:
-
Description:
The fertilized macrogamont, or zygote, develops into an oocyst with either a thin or a thick wall (Fayer et al., 1997). Some reports suggest that oocysts with thin walls release sporozoites that autoinfect the host, whereas those with thicker walls leave the body to infect other hosts (Fayer et al., 1997). Approximately 20% of the zygotes develop into thin-walled oocysts, which represent auto-infective life cycle forms that can maintain the parasite in the host. This stage and the persistent meronts are believed to be responsible for the life-threatening disease in immunodeficient persons who do not have repeated exposure to environmentally resistant forms (Fayer et al., 1997, Marshall et al., 1997).
-
Description:
C. parvum is an obligate intracellular parasite, transmitted as highly durable oocysts in feces. Ingested oocysts excyst in the ileum, releasing sporozoites which infect the intestinal epithelium. Subsequent development includes both a cyclic asexual reproduction and the production of gametes giving rise to further oocysts, which are either excreted or reinfect the host (Bankier et al., 2003). Cryptosporidium spp. have a monoxenous life cycles where all stages of development (asexual and sexual) occur within one host (O'Donoghue, 1995).
-
Illustration of lifecycle (Website 99):
Description: Life cycle of Cryptosporidium parvum and C. hominis.
(from: Juranek DD. Cryptosporidiosis. In: Strickland GT, Editor. Hunters Tropical Medicine, 8th edition.) Sporulated oocysts, containing 4 sporozoites, are excreted by the infected host through feces and possibly other routes such as respiratory secretions (1). Transmission of Cryptosporidium parvum and C. hominis occurs mainly through contact with contaminated water (e.g., drinking or recreational water). Occasionally food sources, such as chicken salad, may serve as vehicles for transmission. Many outbreaks in the United States have occurred in waterparks, community swimming pools, and day care centers. Zoonotic and anthroponotic transmission of C. parvum and anthroponotic transmission of C. hominis occur through exposure to infected animals or exposure to water contaminated by feces of infected animals (2). Following ingestion (and possibly inhalation) by a suitable host (3), excystation occurs. The sporozoites are released and parasitize epithelial cells (b,c) of the gastrointestinal tract or other tissues such as the respiratory tract. In these cells, the parasites undergo asexual multiplication (schizogony or merogony) (d, e, f) and then sexual multiplication (gametogony) producing microgamonts (male)(g) and macrogamonts (female)(h). Upon fertilization of the macrogamonts by the microgametes (i), oocysts (j, k) develop that sporulate in the infected host. Two different types of oocysts are produced, the thick-walled, which is commonly excreted from the host (j), and the thin-walled oocyst (k), which is primarily involved in autoinfection. Oocysts are infective upon excretion, thus permitting direct and immediate fecal-oral transmission. Copyright: CDC.
C. Genome Summary:
-
Genome of Cryptosporidium parvum
-
Description:
Electrophoretic analysis suggests that the C. parvum genome contains eight chromosomes of between 0.9 and 1.5 Mbp, giving a total genome size of 10.4 Mbp (Bankier et al., 2003) (Bankier et al., 2003). Three main sequencing projects are in progress, two in the US and one in the UK. An Expressed Sequence Tag (EST) project is being carried out at the University of California, with the objective of determining 300- to 600-bp-long single-pass sequences from about 1000 genes expressed in the sporozoite stage. The project involves sequencing the 5' ends of cDNA inserts randomly selected from three directionally cloned cDNA libraries, which were constructed in the phage vector Uni-ZAP XR using the mRNA of C. parvum sporozoites (Iowa isolate, genotype 2). Almost 600 ESTs have been analyzed so far, of which 68% represent unique sequences corresponding to about 265 kb of novel coding genetic information. Thirty-seven percent of the non redundant ESTs shared significant homology with GenBank sequences. A collaborative Gene Sequence Tag (GST) project is being conducted by researchers at the Universities of California and Minnesota. Unlike the EST approach, the GST project consists in the generation of short DNA sequences from random genomic inserts of the Iowa isolate, thus enabling identification of genes that are expressed in all developmental stages of the parasite, as well as genomic sequences devoid of coding function. Over 2000 GSTs have been characterized so far by sequencing about 500 bp from both ends of randomly sheared genomic DNA inserts derived from a pBlueScript II (SK-) plasmid library. Overall, the sequenced GSTs account for approximately 10% of the C. parvum genome, with about 20% of unique GSTs showing significant homology with sequences present in GenBank. A slightly different approach to the characterization of random C. parvum genomic sequences, a Sequence Tagged Sites project, has been undertaken by scientists at the MRC in Cambridge, UK Cryptosporidium parvum genomic DNA (Moredun isolate, genotype 2) was cut to completion with either AluI or RsaI and the fragments were cloned into the M13mp18 phage vector to obtain two distinct libraries. Randomly selected clones were analyzed by single-pass sequencing, yielding 161 Sequence Tagged Sites greater than 100 bp for a total of 43 kb of unique sequence information. The same group has recently commenced a new project aimed at determining the nucleotide sequence of the whole genome of the Iowa C. parvum isolate (Spano and Crisanti, 2000).
Cryptosporidium parvum appears to contain neither mitochondria (although they have been observed in other Cryptosporidium spp.) nor the plastid commonly found in apicomplexan parasites (Piper et al., 1998).
-
Chromosome 6 (Website 101):
-
GenBank Accession Number:
BX526834
-
Size:
1164703 bp for the complete sequence of C. parvum chromosome 6 (Website 101)
-
Gene Count:
A total of 474 protein-coding genes are predicted, giving a mean density of one per 2.46 kbp. Only 122 of the genes (25.7%) have predicted introns delimited by the usual eukaryotic GT...AG motifs at either end and these have an average of 2.7 exons per gene (Bankier et al., 2003). With a mean density of one predicted gene per 2.46 kb, chromosome 6 of C. parvum is particularly gene-dense. In comparison, the P. falciparum genome (approximately twice the size of that of C. parvum) contains one predicted gene per 4.3 kb and, among the fully sequenced eukaryotes, only S. cerevisiae and Encephalitozoon cuniculi have higher densities of predicted genes (Bankier et al., 2003).
-
Description:
The apicomplexan Cryptosporidium parvum is one of the most prevalent protozoan parasites of humans. We report the physical mapping of the genome of the Iowa isolate, sequencing and analysis of chromosome 6, and 0.9 Mbp of sequence sampled from the remainder of the genome. To construct a robust physical map, we devised a novel and general strategy, enabling accurate placement of clones regardless of clone artifacts. Analysis reveals a compact genome, unusually rich in membrane proteins. As in Plasmodium falciparum, the mean size of the predicted proteins is larger than that in other sequenced eukaryotes. We find several predicted proteins of interest as potential therapeutic targets, including one exhibiting similarity to the chloroquine resistance protein of Plasmodium. Coding sequence analysis argues against the conventional phylogenetic position of Cryptosporidium and supports an earlier suggestion that this genus arose from an early branching within the Apicomplexa. In agreement with this, we find no significant synteny and surprisingly little protein similarity with Plasmodium. Finally, we find two unusual and abundant repeats throughout the genome. Among sequenced genomes, one motif is abundant only in C. parvum, whereas the other is shared with (but has previously gone unnoticed in) all known genomes of the Coccidia and Haemosporida. These motifs appear to be unique in their structure, distribution and sequences (Bankier et al., 2003).
II. Epidemiology Information
A. Outbreak Locations:
-
The mean prevalence rate for Cryptosporidium infection is between 1 and 3% in Europe and North America but is considerably higher in underdeveloped continents, ranging from 5% in Asia to approximately 10% in Africa (Marshall et al., 1997). Cryptosporidiosis has now been reported from over 40 countries in six continents in both immunocompetent as well as immunocompromised patients around the world. In a review of over 130,000 presumably immunocompetent patients with diarrhea in 43 studies in developing areas (Asia, Africa and Latin America) and in 35 studies in industrialized countries (in Europe, North America and Australia), it was noted that 6.1% and 2.1% in developing and developed areas with diarrhea (vs. 1.5% and 0.15% in controls without diarrhea) had Cryptosporidium infections (Dillingham et al., 2002).
B. Transmission Information:
-
From:
Mammalia
To:
Homo sapiens
,
With Destination:
Homo sapiens
-- (at lifecycle progression level: oocyst)
Mechanism:
Cryptosporidium parvum has been identified in about 80 species of mammals, and cross-transmission has been demonstrated between a variety of host species. There is, therefore, a potentially large zoonotic reservoir for animals and humans (Casemore et al., 1997). While apparently not the case for genotype 1 C. parvum, genotype 2 C. parvum and other genotypes and Cryptosporidium species increasingly appear to have less stringent host species specificities. An impressive range of 152 different mammalian species have been reported to be infected with C. parvum or with a C. parvum-like organism (Dillingham et al., 2002). To initiate infection, oocysts must be ingested with food, water, or by close personal contact with infected people, animals or contaminated surfaces (Fayer et al., 2000).
-
From:
Mammals To:
Homo sapiens
,
With Destination:
Homo sapiens
-- (at lifecycle progression level: oocyst)
Mechanism:
Probably most common is waterborne transmission, whether in fully chlorinated drinking water (that has been contaminated usually via contaminated surface water) or by sewage effluent, since sewage treatment often does not kill the parasite. There have been some 50 waterborne outbreaks reported from throughout the US, UK, Canada and New Zealand, and the documentation of widespread fecal contamination with oocysts in wastewater, activated sludge, ground and surface water, and treated drinking water. Although questions remain about viability, species and sources of oocysts found in tap water, numerous outbreaks (including the huge Milwaukee outbreak) amply document the importance of waterborne transmission of C. parvum infections in humans (Dillingham et al., 2002).
All infections have presumably been acquired by the ingestion (or inhalation) of infective oocysts excreted by infected hosts (O'Donoghue, 1995).
Sporozoites excyst from the oocyst and parasitize epithelial cells of the gastrointestinal or respiratory tract (Fayer et al., 1997).
-
From:
Mammals To:
Homo sapiens
,
With Destination:
Homo sapiens
-- (at lifecycle progression level: oocyst)
Mechanism:
31 outbreaks affecting over 10,000 people have associated cryptosporidiosis with exposure to recreational water, often despite its full chlorination, and often related to frequent fecal accidents by diapered infants, toddlers, or incontinent individuals (Dillingham et al., 2002).
All infections have presumably been acquired by the ingestion (or inhalation) of infective oocysts excreted by infected hosts (O'Donoghue, 1995).
Sporozoites excyst from the oocyst and parasitize epithelial cells of the gastrointestinal or respiratory tract (Fayer et al., 1997).
-
From:
Mammals To:
Homo sapiens
,
With Destination:
Homo sapiens
-- (at lifecycle progression level: oocyst)
Mechanism:
Several documented food-associated outbreaks have implicated fresh pressed cider in Maine and New York, improperly pasteurized milk in the UK, chicken salad in Minnesota, uncooked green onions in Spokane, Washington, and an infected cook who cut fresh vegetables and fruit in a Washington, DC cafeteria (Dillingham et al., 2002).
All infections have presumably been acquired by the ingestion (or inhalation) of infective oocysts excreted by infected hosts (O'Donoghue, 1995).
Sporozoites excyst from the oocyst and parasitize epithelial cells of the gastrointestinal or respiratory tract (Fayer et al., 1997).
-
From:
Homo sapiens
To:
Homo sapiens
,
With Destination:
Homo sapiens
-- (at lifecycle progression level: oocyst)
Mechanism:
Person-to-person transmission occurred in households in 5.4% (of household contacts who developed symptomatic disease in the Milwaukee outbreak) to 19% (of family members of infected children in Fortaleza, Brazil developing disease or seroconversion) (Dillingham et al., 2002). Association with anal sexual exposure also likely reflects person-to-person direct spread as well (Dillingham et al., 2002).
All infections have presumably been acquired by the ingestion (or inhalation) of infective oocysts excreted by infected hosts (O'Donoghue, 1995).
To initiate infection, oocysts must be ingested with food, water, or by close personal contact with infected people, animals or contaminated surfaces (Fayer et al., 2000).
-
From:
Mammals To:
Homo sapiens
,
With Destination:
Homo sapiens
-- (at lifecycle progression level: oocyst)
Mechanism:
It was shown that C. parvum oocysts ingested by Canada geese (Branta canadensis) and Peking ducks (Anas platyrhynchos) passed through the gastrointestinal tract, were excreted in the feces for nearly 1 week, and were capable of infecting mice. Later, viable oocysts of C. parvum were recovered from feces of Canada geese in fields where they rested along their migration route (Fayer et al., 2000). What appeared to be oocysts of C. parvum were found in the intestinal tracts of cockroaches (Periplaneta americana) collected in the household where a child had cryptosporidiosis, suggesting that roaches had a role in disseminating the parasite. House flies, exposed under laboratory conditions to bovine feces containing oocysts of C. parvum and wild filth flies trapped in a barn where a calf had cryptosporidiosis, had oocysts both in their feces and on their external surfaces. Although most oocysts of C. parvum ingested by dung beetles were destroyed by digestion, some passed through the intestinal tract and appeared morphologically normal in beetle feces. Oocysts also were recovered from the external surfaces of beetles, suggesting they may be capable of disseminating oocysts in the environment. Six genera of rotifers (microscopic invertebrates found worldwide in lakes, ponds, puddles, moss, damp soil, or virtually anywhere water can accumulate) were observed ingesting oocysts of C. parvum; it was not determined whether oocysts were digested or rendered nonviable (Fayer et al., 2000).
All infections have presumably been acquired by the ingestion (or inhalation) of infective oocysts excreted by infected hosts (O'Donoghue, 1995).
Sporozoites excyst from the oocyst and parasitize epithelial cells of the gastrointestinal or respiratory tract (Fayer et al., 1997).
-
From:
Mammals To:
Homo sapiens
,
With Destination:
Homo sapiens
-- (at lifecycle progression level: oocyst)
Mechanism:
Although there have been no proven cases of airborne transmission in humans the concept was theorized by investigators in 1987. There are, however, numerous reports of high rates of cough or other pulmonary symptoms in children and immune compromised persons with cryptosporidiosis. Although lethal respiratory cryptosporidiosis has been reported for persons with AIDS, malignant lymphoma, and bone marrow transplantation, the occurrence of respiratory cryptosporidiosis is rarely reported (Fayer et al., 2000).
All infections have presumably been acquired by the ingestion (or inhalation) of infective oocysts excreted by infected hosts (O'Donoghue, 1995).
Sporozoites excyst from the oocyst and parasitize epithelial cells of the gastrointestinal or respiratory tract (Fayer et al., 1997).
C. Environmental Reservoir:
-
Mammalian Reservoir
:
-
Description:
To date, C. parvum has been reported in some 79 mammalian species, and potentially all pose a health risk either by direct contact or indirectly through fecal contamination of food or water consumed by people (Tzipori and Griffiths, 2002).
An impressive range of 152 different mammalian species have been reported to be infected with C. parvum or with a C. parvum-like organism (Dillingham et al., 2002).
-
Survival Information:
Most oocysts are fully sporulated and infective when excreted from infected hosts and they are very resistant to a range of environmental conditions. Laboratory studies have shown that oocysts stored in aqueous solutions have remained viable for up to 3 months at ambient temperature (15 to 20 C) and for up to one year when refrigerated (4 to 6 C). Infectivity was lost after oocysts had been heated to 65 C for at least 30 min or when desiccated for at least 4 h. Snap freezing has been shown to kill oocysts whereas slow freezing was less effective and some oocysts have survived freezing at -22 C for up to 1 month (O'Donoghue, 1995).
D. Intentional Releases:
-
Intentional Release information
:
-
Description:
Deliberate sabotage of industrialized water supplies is possible, but there is no evidence it has ever occurred, despite countless threats to municipal water supplies (Khan et al., 2001). The potential for water to serve as a vehicle for an agent and to cause mass casualties in the modern era was verified by the largest documented waterborne disease outbreak in the United States since record-keeping began in 1920. An estimated 403,000 people developed cryptosporidiosis in Milwaukee in 1993, of whom 4,400 were hospitalized and at least 54 died, in association with water obtained from a municipal water plant. Although the treated water met all the state and federal quality standards that were then in effect, C. parvum oocysts were able to get through the treatment system in sufficient numbers to infect a large proportion of the population served. Information based on mathematical modeling suggested that some individuals might have become infected when exposed to only one oocyst (Khan et al., 2001).
-
Emergency contact:
Since 1971, CDC, the U.S. Environmental Protection Agency (EPA), and the Council of State and Territorial Epidemiologists have maintained a collaborative surveillance system consisting of the collection and periodic reporting of data on the occurrences and causes of waterborne-disease outbreaks (WBDOs) (Levy et al., 1998). State, territorial, and local public health agencies have the primary responsibility for detecting and investigating WBDOs and voluntarily reporting them to CDC on a standard form (CDC form 52.12). CDC annually requests reports from state and territorial epidemiologists or from persons designated as the WBDO surveillance coordinators. When needed, additional information about water quality and treatment is obtained from the state's drinking water agency (Levy et al., 1998).
-
Delivery mechanism:
The use of food-borne and waterborne agents would be less likely than airborne agents in a large-scale attack, because it is difficult to expose many people. Standard treatment of municipal water supplies would preclude survival of most biological agents (Moran, 2002). C. parvum can be spread by contamination of food or water and has been involved in outbreaks related to swimming pools. Because it is resistant to chlorine, C. parvum can survive in swimming pools and municipal water supplies (Moran, 2002).
-
Containment:
Standard body fluid precautions should prevent spread of these organisms. Patients should be instructed to be extra vigilant about handwashing after using the bathroom (Moran, 2002).
III. Infected Hosts
-
Humans:
-
Taxonomy Information:
-
Species:
-
Human (Website 2):
-
GenBank Taxonomy No.:
9606
-
Scientific Name:
Homo sapiens (Website 2)
-
Description:
Human infection with Cryptosporidium, first reported in two cases in 1976 and a further 11 cases over the next 6 years has now been reported from over 90 countries on six continents. Most data come from outbreaks or individual cases reported in scientific or medical journals. Except for outbreaks, most specimens in developed countries were submitted to diagnostic laboratories from persons with gastrointestinal illness. Estimates from United States public health records suggest that approximately 2% of all stools tested by health care providers are positive for Cryptosporidium. Estimating approximately 15 million annual visits for diarrhea, infection with Cryptosporidium might be expected in 300,000 persons annually (Fayer et al., 2000). Surveys in developing countries find a higher prevalence of infection than in industrialized countries. Better sanitation and cleaner drinking water in the more industrialized countries probably account most for this difference. Within these large populations are specific groups at greater risk of infection including children, malnourished persons, and a range of immunocompromised individuals including AIDS patients, transplant recipients, patients receiving chemotherapy for cancer, institutionalized patients, and patients with immunosuppressive infectious diseases (Fayer et al., 2000).
-
Infection Process:
-
Infectious Dose:
Volunteer transmission studies have shown that immunocompetent adults can be infected by as few as 30 oocysts, though reinfection 1 year later requires about an order of magnitude more oocysts. In this work, the median infective dose was 132 oocysts, 11 of 18 individuals had enteric symptoms, and 7 (39%) had clinical disease. Primates such as macaques can reliably be infected with as few as 10-30 oocysts. In a recent epidemic of cryptosporidiosis in Las Vegas, USA, adults with HIV were infected with Cryptosporidium after drinking unboiled tap water despite 'state of the art' water treatment including filtration, and an inability to detect any oocysts in treated water. In summary, these experimental and epidemiological data strongly suggest that the minimum infectious dose of oocysts for humans is small and of the same order of magnitude as Shigella bacteria (e.g. 10 to 100). Reinfection is probably not difficult, given that the infectious dose after a recent primary infection may be only 100-10000 oocysts (Griffiths, 1998).
-
Description:
Infection with Cryptosporidium begins when the ingested oocysts release sporozoites, which subsequently attach to and invade the intestinal epithelial cell. The parasite has a particular predilection for the jejunum and terminal ileum (Leav et al., 2003).
-
Disease Information:
-
Cryptosporidiosis
:
-
Pathogenesis Mechanism:
Infection with Cryptosporidium begins when the ingested oocysts release sporozoites, which subsequently attach to and invade the intestinal epithelial cell. The parasite has a particular predilection for the jejunum and terminal ileum. This point deserves emphasis, because diagnostic evaluations, such as endoscopy, may miss the site of infection. In patients with AIDS, other sites within the gastrointestinal tract may be involved, including the stomach, duodenum, and colon, as well as the biliary tract. The histopathological features of cryptosporidiosis include a minimal inflammatory infiltrate and blunting of the villus. More-pronounced inflammatory changes, such as disruption of the epithelial cell barrier and more-extensive infiltration of the lamina propria with inflammatory cells, are seen in immunodeficient patients (Leav et al., 2003).
The mechanism by which Cryptosporidium infection causes diarrhea remains elusive. The diarrhea is typically noninflammatory and is often profuse. The parasite does elicit a local inflammatory response, and increased production of prostaglandins and several cytokines, particularly IFN-, has been described. It is possible that these inflammatory mediators may consequently alter solute transportation in the intestinal epithelial cell, leading to osmotic diarrhea. Cryptosporidium infection has also been shown to inhibit apoptosis in infected epithelial cells as well as promote it in adjacent epithelial cells in vitro. This could theoretically prolong parasite survival and impair absorption in the intestinal mucosa. The presence of an enterotoxin has also been hypothesized but never conclusively demonstrated (Leav et al., 2003).
Whatever the mechanisms by which Cryptosporidium infection causes disease may be, attachment to and invasion of host cells are crucial primary events in pathogenesis. However, little is known about specific parasite and host molecules involved in these processes. Knowledge of such molecules is essential for understanding the pathogenic mechanisms used by this parasite. Increasing recognition of Cryptosporidium species as emerging pathogens in humans has led to the identification of proteins, including CSL, GP900, p23/27, TRAP C1, gp40/45, cp47, and gp15/Cp17, which are implicated in mediating these interactions. However, progress in establishing the functional role of these proteins has been hindered by the inability to propagate C. parvum in vitro and the lack of suitable systems for genetic manipulation of the parasite (Leav et al., 2003).
-
Incubation Period:
Several case reports of human infections have provided sufficient data to reasonably estimate the incubation period: 2 to 10 days. The most frequently reported period preceding the onset of symptoms is 7 days, which is consistent with the onset reported among human volunteers enrolled in a C. parvum infectious dose study. The latter report presented a mean of 9 days and a median of 6.5 days preceding development of clinical signs. These data are consistent with the reported timing of the C. parvum life cycle in vitro and in animal models (Arrowood, 1997).
-
Prognosis:
When immune function is intact, cryptosporidiosis is usually explosive at onset, lasts approximately 10 to 14 days, and is followed by a complete clinical and parasitologic recovery. Oocyst shedding may lag behind clinical resolution of symptoms by as long as a few weeks. In the immunologically impaired host, onset of cryptosporidiosis is usually insidious - diarrheal symptoms precede detection of the organism in the stool by weeks to months. In these individuals, the enteritis becomes chronic and severity may wax and wane. In persons with the acquired immunodeficiency syndrome (AIDS), diarrhea frequency and volume often escalate unrelentingly as immune function becomes more deranged. However, cryptosporidiosis may also resolve spontaneously in patients anywhere along the spectrum of HIV infection, thus complicating the interpretation of uncontrolled treatment data. For the most part, cryptosporidiosis is a devastating complication for persons with AIDS - it contributes significantly to morbidity and hastens death. In addition to AIDS, immunological deficiencies and other conditions associated with protracted cryptosporidiosis include congenital hypogammagloblulinemia, IgA deficiency, concurrent viral infections, malnutrition, and exogenous immunosuppression, as with corticosteroids (Blagburn and Soave, 1997).
-
Diagnosis Overview:
Cryptosporidiosis can be diagnosed via invasive or noninvasive techniques. Intestinal analysis via biopsy with demonstration of intracellular forms of the parasite is specific, but the diagnosis may be missed, because most common sites of infection are less accessible endoscopically. The "gold standard" and perhaps most widely used test for the detection of Cryptosporidium oocysts in stool remains the modified acid-fast or Kinyoun stain. The test should be specifically requested, because it will not be performed as part of a routine examination for ova and parasites. Interpretation of the stained smear requires experience, because other organisms in the stool may stain acid fast. Several immunofluorescent assays and EIA kits have become commercially available and show promising sensitivity and specificity. These tests use antibodies against Cryptosporidium antigens to detect the parasite in stool specimens. One of these kits, the ColorPAC Cryptosporidium/Giardia rapid assay (Becton-Dickinson), was recently recalled because of a cluster of false-positive results. PCR-based techniques also accurately detect the parasite in environmental samples and stool specimens but have yet to be standardized for routine clinical use and are not yet commercially available (Leav et al., 2003).
-
Symptom Information
:
-
Syndrome --
Asymptomatic intestinal cryptosporidiosis:
-
Description:
Asymptomatic infections have been described primarily during evaluation of possible outbreaks in day care centers or related to travel and, less often, in the context of geographical surveys. Accuracy with which asymptomatic infections are detected depends on the diagnostic proficiency and rigor of the laboratory, and since Cryptosporidium may be very difficult to diagnose, asymptomatic infections may be underestimated (Ungar, 1990).
-
Observed:
While the rate of asymptomatic cryptosporidiosis in normal populations is thought to be low, it may be much higher in those with HIV. In Malaysia, 23% of IVDUs with HIV in a drug rehabilitation center had asymptomatic cryptosporidiosis. In Cuba, about 45% of those with C. parvum and HIV were asymptomatic There is little prospective information on silent carriage by HIV-seropositive individuals in developed countries. In asymptomatic children in the Bronx, New York, USA, 6.4% (5/78) of normal, and 22% (11/50) of immunocompromised, prospectively studied children had asymptomatic carriage (Griffiths, 1998).
-
Syndrome --
Acute self-limited (Transient) intestinal cryptosporidiosis:
-
Description:
Transient disease is common in the immunocompetent population. Numerous studies have shown an incubation period with a mean of approximately 6 days and a range of 2 to 30 days (Griffiths, 1998).
-
Observed:
A study of the various presentations of cryptosporidiosis in HIV-positive patients in London showed that transient infections were found in 28.7% and were more common in the less strongly immunosouppressed patients (Hunter and Nichols. 2002). Blanshard et al. described the various presentations of cryptosporidiosis in HIV-positive patients in London, and 3.9% of the infections were asymptomatic (Hunter and Nichols, 2002).
Symptoms Shown in the Syndrome:
-
Watery diarrhea:
-
Description:
Watery diarrhea: Symptomatic immunocompetent patients usually present with mild to profuse, watery diarrhea, with or without mucous, rarely with blood or leukocytes. Frequent and voluminous bowel movements can contribute to rapid weight loss and dehydration (Arrowood, 1997).
-
Observed:
92% in symptomatic immunocompetent patients (Arrowood, 1997).
-
Nausea/Vomiting/Anorexia:
-
Description:
Nausea/Vomiting/Anorexia: Other frequently reported symptoms include nausea and vomiting (Arrowood, 1997).
-
Observed:
51% in symptomatic immunocompetent patients (Arrowood, 1997).
-
Abdominal discomfort:
-
Description:
Abdominal discomfort: Other frequently reported symptoms include abdominal cramping (Arrowood, 1997).
-
Observed:
45% in symptomatic immunocompetent patients (Arrowood, 1997).
-
Fever:
-
Description:
Fever: Other frequently reported symptoms include mild fever (less than 39 degrees celcius) (Arrowood, 1997).
-
Observed:
36% in symptomatic immunocompetent patients (Arrowood, 1997).
-
Malaise/Fatigue/Weakness:
-
Repiratory problems:
-
Cough:
-
Syndrome --
Chronic intestinal cryptosporidiosis:
-
Description:
Chronic cryptosporidial disease is commonest in patients with AIDS or malnutrition (Griffiths, 1998). Survival of persons with HIV infection and chronic cryptosporidiosis is significantly shorter than that of those with transient or asymptomatic disease (Griffiths, 1998). If people with AIDS and chronic diarrhea are analyzed as a group, they have poorer survival than those without diarrhea (Griffiths, 1998).
-
Observed:
Blanshard et al. described the various presentations of cryptosporidiosis in HIV-positive patients in London (Hunter and Nichols, 2002). Chronic disease was present in 59.7% of patients (Hunter and Nichols, 2002).
Symptoms Shown in the Syndrome:
-
Diarrhea:
-
Description:
Diarrhea (Griffiths, 1998)
-
Observed:
In a retrospective study of 250 Thai patients presenting with chronic diarrhea and HIV, 8% of adults and 19% of children had cryptosporidiosis (Griffiths, 1998).
-
Weight loss:
-
Description:
Weight loss (Griffiths, 1998)
-
Observed:
In a retrospective study of 250 Thai patients presenting with chronic diarrhea and HIV, 100% had weight loss and malnutrition (Griffiths, 1998).
-
Malnutrition:
-
Description:
Malnutrition (Griffiths, 1998)
-
Observed:
In a retrospective study of 250 Thai patients presenting with chronic diarrhea and HIV, 100% had weight loss and malnutrition (Griffiths, 1998).
-
Syndrome --
Fulminant intestinal cryptosporidiosis:
-
Description:
Essentially exclusively seen in person with AIDS or chemotherapy-induced immunosuppression, fuliminant cryptosporidiosis is a dramatic cholera-like illness with a very high mortality. Profound hypovolemia and shock may require intensive care unit management of fluid and electrolyte balances. Diarrheal outputs of 1 l/h are not uncommon. A very short survival time (5 weeks according to Blanshard et al., (1992) and 10.6 days in the report by Jordan, 1996) increased intercurrent infections and low weights at presentation are the rule (Griffiths, 1998).
-
Observed:
Blanshard et al. described the various presentations of cryptosporidiosis in HIV-positive patients in London (Hunter and Nichols, 2002). Fulminant disease, the passage of more than 2 liters of stool/day, affected 7.8% of the patients, but only those with a CD4 count less than 50/mm(3) (Hunter and Nichols, 2002).
-
Syndrome --
Respiratory cryptosporidiosis:
-
Description:
Respiratory infection is common but usually unapparent. In childhood cryptosporidiosis cough is frequent, being reported in one-fifth to one-third of normal children (Griffiths, 1998). Pulmonary symptoms are about three-fold more frequent in children admitted to hospital with cryptosporidial diarrhea than in children with other intestinal pathogens (Griffiths, 1998).
Respiratory cryptosporidiosis has been increasingly reported, particularly in immunocompromised individuals. Symptoms included cough, croup, wheezing, hoarseness, and shortness of breath. Few reports have demonstrated cryptospordia in the bronchial mucosal epithelium. Most cases have been diagnosed by oocysts in sputum, tracheal aspirates, bronchoalveolar lavage fluid, and alveolar exudate (obtained by lung biopsy). It is not clear whether oocysts detected in these specimens were due to aspiration from the gastrointestinal tract or colonization and replication in the respiratory epithelium (Arrowood, 1997).
-
Observed:
Of 250 children in the Ivory Coast with cryptosporidial diarrheas, 77% had profuse diarrhea, 58% had fever, and 19% had pulmonary symptoms (Griffiths, 1998).
Symptoms Shown in the Syndrome:
-
Cough:
-
Description:
Cough: Symptomatic respiratory cryptosporidiosis in people with AIDS is manifested by cough, copious tracheal secretions, and dyspnea (Griffiths, 1998).
-
Observed:
In a review from Spain, chronic cough was present in 91%, fever in 59%, and dyspnea in 64% of patients (Griffiths, 1998).
-
Fever:
-
Description:
Fever (Griffiths, 1998)
-
Observed:
In a review from Spain, chronic cough was present in 91%, fever in 59%, and dyspnea in 64% of patients (Griffiths, 1998).
-
Dyspnea:
-
Description:
Dyspnea: Symptomatic respiratory cryptosporidiosis in people with AIDS is manifested by cough, copious tracheal secretions, and dyspnea (Griffiths, 1998).
-
Observed:
In a review from Spain, chronic cough was present in 91%, fever in 59%, and dyspnea in 64% of patients (Griffiths, 1998).
-
Syndrome --
Hepatobiliary cryptosporidiosis:
-
Description:
Infection of gall bladder and bile duct epithelium has resulted in a calculous cholecystitis and sclerosing cholangitis in several AIDS patients. Reported symptoms include fever, nonradiating right upper quadrant pain, nausea, vomiting, and in some cases diarrhea and jaundice. Diagnosis has been confirmed by histologic examination of biopsy specimens or by identification of oocysts in bile (oocysts numbers may be below detectable limits in stool). Hepatobiliary infections were observed in SIV-infected Rhesus monkeys (Arrowood, 1997).
The presence of biliary symptoms was a strong indicator of the prognosis since 83% of patients with symptoms died within the following year compared to only 48% of those without. In our view, it is doubtful that this difference was due directly to the biliary involvement but is more likely to reflect the point that more severely immunocompromised persons are more likely to experience biliary involvement (Hunter and Nichols, 2002).
-
Observed:
Of 20 patients suffering from cholangitis in a British study, 13 had cryptosporidiosis. In a Spanish study of 43 AIDS patients with chronic diarrhea due to Cryptosporidium infection, 8 patients (18.6%) were reported to have Cryptosporidium infection of the common bile duct. Following the waterborne outbreak of cryptosporidiosis in Milwaukee, Vakil et al., reported that 82 patients, believed to have become infected at the time of the outbreak, 24 (29.3%) reported biliary symptoms (Hunter and Nichols, 2002).
Symptoms Shown in the Syndrome:
-
Fever:
-
Pain:
-
Nausea:
-
Vomiting:
-
Diarrhea:
-
Jaundice:
-
Syndrome --
Pancreatic cryptosporidiosis:
-
Description:
Pancreatic cryptosporidiosis with colonization of the pancreatic ducts has been reported in several immunocompromised cases, but only one case of pancreatic cryptosporidiosis has been reported in an immunologically normal individual (Arrowood, 1997). AIDS patients with pancreatic cryptosporidial infections have also exhibited bile duct or gall bladder infections. A severe combined immunodeficient infant with cryptosporidial enteritis had cryptosporidia in the pancreatic duct epithelium at autopsy (Arrowood, 1997).
-
Observed:
A series of 15 autopsies on patients with AIDS and cryptosporidiosis showed that five had evidence of infection of the pancreas (Hunter and Nichols, 2002).
-
Diarrhea:
-
Description:
Diarrhea: Diarrhea is the most noteworthy symptom. Characteristically, it is voluminous and watery, often called cholera-like. As many as 71 stools and 12 to 17 l/d have been reported. However, less fulminant diarrhea also occurs, even in HIV-infected persons. Mucous may be associated with diarrhea, but blood or leukocytes are rarely reported. As much as a 25 kg weight loss has been noted (Ungar, 1990).
-
Observed:
70 people of 194 total in HIV-infected patients, 33 people out of 194 in other immunodeficient patients, and 73 peopleout of 194 in immunologically healthy patients (Ungar, 1990).
-
Abdominal pain:
-
Description:
Abdominal pain: Crampy abdominal pain, sometimes quite severe, may occur (Ungar, 1990).
-
Observed:
36 people out of 194 in HIV-infected patients, 11 people out of 194 in other immunodeficient patients, and 55 people out of 194 in immunologically healthy patients (Ungar, 1990).
-
Anorexia/Nausea/Vomiting:
-
Description:
Anorexia/nausea/vomiting: Less frequent symptoms accompanying diarrhea include generalized malaise, weakness, or fatigue, and loss of appetite, nausea, and vomiting (Ungar, 1990).
-
Observed:
36 people out of 194 in HIV-infected patients, 12 people out of 194 in other immunodeficient patients, and 29 people out of 194 in immunologically healthy patients (Ungar, 1990).
-
Fever:
-
Description:
Fever: Less frequent symptoms accompanying diarrhea include low grade fever (less than 39 C) perhaps actually caused by other concomitant infections, particularly in immunologically deficient hosts (Ungar, 1990).
-
Observed:
39 people out of 194 in HIV-infected patients, 10 people out of 194 in other immunodeficient patients, and 22 people out of 194 in immunologically healthy patients (Ungar, 1990).
-
Malaise/Fatigue/Weakness:
-
Description:
Malaise/fatigue/weakness: Less frequent symptoms accompanying diarrhea include generalized malaise, weakness, or fatigue, and loss of appetitie, nausea, and vomiting (Ungar, 1990).
-
Observed:
21 people out of 194 in HIV-infected patients, 7 people out of 194 in other immunodeficient patients, and 24 people out of 194 in immunologically healthy patients (Ungar, 1990).
-
Respiratory problems:
-
Description:
Respiratory problems. Respiratory infection is common but usually unapparent. In childhood cryptosporidiosis cough is frequent, being reported in one-fifth to one-third of normal children (Griffiths, 1998). Pulmonary symptoms are about three-fold more frequent in children admitted to hospital with cryptosporidial diarrhea than in children with other intestinal pathogens (Griffiths, 1998).
Respiratory cryptosporidiosis has been increasingly reported, particularly in immunocompromised individuals. Symptoms included cough, croup, wheezing, hoarseness, and shortness of breath. Few reports have demonstrated cryptospordia in the bronchial mucosal epithelium. Most cases have been diagnosed by oocysts in sputum, tracheal aspirates, bronchoalveolar lavage fluid, and alveolar exudate (obtained by lung biopsy). It is not clear whether oocysts detected in these specimens were due to aspiration from the gastrointestinal tract or colonization and replication in the respiratory epithelium (Arrowood, 1997) (Arrowood, 1997).
-
Observed:
20 people out of 194 in HIV-infected patients, 11 people out of 194 in other immunodeficient patients, and 3 people out of 194 in immunologically healthy patients (Ungar, 1990).
-
Death:
-
Description:
Death: In HIV-infected persons (either presumed, based on clinical picture in some of the earlier cases, or serologically diagnosed), cryptosporidiosis lasting more than 30 d is usually followed by death, although spontaneous clinical recovery has been reported (Ungar, 1990).
-
Observed:
42 people out of 194 in HIV-infected patients, 10 people out of 194 in other immunodeficient patients, and 0 people out of 194 in immunologically healthy patients (Ungar, 1990).
-
Treatment Information:
-
Paromomycin:
The aminoglycoside paromomycin continues to be one of the few antimicrobial agents that remains consistently in clinical use. This is despite a recent prospective double-blind, placebo-controlled ACTG trial of paromomycin in 35 adults with AIDS and CD4 counts less than 150, which reported that this drug was no more effective than placebo. A recent approach to therapy has been to use combination chemotherapy. A small open-label study of a combination of paromomycin and azithromycin for 4 weeks followed by paromomycin alone for 8 weeks in 11 patients with AIDS and CD4 counts less than 100 reported a significant and consistent reduction in symptoms and oocyst excretion (Tzipori and Ward, 2002).
-
Applicable:
Paromomycin and azithromycin have been reported to produce symptomatic relief in infected patients. A suggested regimen for patients with AIDS who have CD4 cell counts fewer than 100 cells/mm(3) is an oral combination of paromomycin (1 g bid) and azithromycin (500 mg PO qd) for 4 weeks and then paromomycin alone for 8 weeks. No specific treatment is necessary for patients who are immunocompetent (Website 103).
-
Contraindicator:
Paromomycin is contraindicated in patients with documented hypersensitivity. Hepatic impairment. Do not administer with pimozide (Website 103).
-
Complication:
Nephrotoxic potential may increase with concurrent administration of other aminoglycosides, penicillins, cephalosporins, amphotericin B, and loop diuretics (Website 103). May increase hepatic enzymes and cholestatic jaundice. Caution in patients with impaired hepatic function, prolonged QT intervals, or pneumonia. Caution in hospitalized patients, elderly patients, or debilitated patients (Website 103).
-
Success Rate:
Four children on chemotherapy for acute lymphoblastic leukemia presented with severe diarrhea and dehydration. Cryptosporidium was identified in the stools using modified Ziehl-Neelsen stain. Two of them received paromomycin and responded well. One was started on paromomycin for 10 days and although there was clinical improvement, his stools examination continued to be positive for Cryptosporidium. He then received azithromycin for 10 days. He responded well and his stools became negative for Cryptosporidium. The fourth patient received azithromycin from the start and responded well. Cryptosporidium should be considered in all immunocompromised children with severe or prolonged diarrhea, and since it is not seen in a routine ova and parasite examination, the laboratory should be notified for diagnostic confirmation using modified Ziehl-Neelsen stain. Immunocompromised children with Cryptosporidium diarrhea may benefit from paromomycin or azithromycin therapy (Trad et al., 2003).
The aminoglycoside paromomycin continues to be one of the few antimicrobial agents that remains consistently in clinical use. This is despite a recent prospective double-blind, placebo-controlled ACTG trial of paromomycin in 35 adults with AIDS and CD4 counts less than 150, which reported that this drug was no more effective than placebo (Tzipori and Ward, 2002).
-
Azithromycin:
Inhibits bacterial growth, possibly by blocking dissociation of peptidyl tRNA from ribosomes, causing RNA-dependent protein synthesis to arrest (Website 103).
-
Applicable:
Paromomycin and azithromycin have been reported to produce symptomatic relief in infected patients. A suggested regimen for patients with AIDS who have CD4 cell counts fewer than 100 cells/mm(3) is an oral combination of paromomycin (1 g bid) and azithromycin (500 mg PO qd) for 4 weeks and then paromomycin alone for 8 weeks. No specific treatment is necessary for patients who are immunocompetent (Website 103).
-
Contraindicator:
Azithromycin is contraindicated in patients with documented hypersensitivity or hepatic impairment. Do not administer with pimozide (Website 103).
-
Complication:
May increase hepatic enzymes and cholestatic jaundice. Caution in patients with impaired hepatic function, prolonged QT intervals, or pneumonia. Caution in hospitalized patients, elderly patients, or debilitated patients (Website 103).
-
Success Rate:
Short-term azithromycin treatment for cryptosporidial diarrhea in AIDS patients was associated with good clinical improvement but parasitological benefit was doubtful. All 13 patients, who had symptoms of cryptosporidiosis, symptomatically improved with 5 days of treatment with azithromycin and became asymptomatic after 7 days of antibiotic, but stool sample was positive for cryptosporidium even after 7 days of therapy. After 14 days of treatment with azithromycin in 13 patients, in five patients stool was free of cryptosporidial oocyst (Kadappu et al., 2002)
-
Nitazoxanide:
One of the newer chemotherapeutic agents to be evaluated is nitazoxanide (NTZ). NTZ is a nitrothiazolyl-salicylamide derivative with broad-spectrum parasiticidal activity against protozoa, nematodes, trematodes and cestodes. Its reported efficacy against these parasites led to trials of the drug for cryptosporidiosis (Tzipori and Ward, 2002).
-
Applicable:
A 3-day course of nitazoxanide significantly improved the resolution of diarrhea, parasitological eradication, and mortality in HIV-seronegative, but not HIV-seropositive, children (Amadi et al., 2002).
-
Contraindicator:
Usually safe in pregnancy but benefits must outweigh the risks (Website 103).
-
Complication:
May cause abdominal pain, diarrhea, vomiting, or headache. Administer with food. Caution when coadministered with other highly plasma protein-bound drugs with narrow therapeutic indices (Website 103).
-
Success Rate:
An uncontrolled trial of NTZ in 12 patients with AIDS-associated cryptosporidiosis in Mali reported a greater than 95% reduction in oocyst excretion in seven individuals. In four of these seven patients, eradication or decrease in oocyst excretion was associated with complete resolution of diarrhea. Subsequently, a double-blind, placebo-controlled crossover study of NTZ in 66 AIDS patients in Mexico reported parasitological cure (no oocysts detected in fecal samples) rates that were significantly superior to the placebo response in 65% of the patients. Of these, 86% of the patients also reported resolution of diarrhea. More recently, a prospective randomized, placebo-controlled, double-blind trial of the drug was conducted in immunocompetent individuals (50 adults and 50 children) with diarrhea due to cryptosporidiosis in Egypt. In this study, of 49 patients randomized to receive 3 d of nitazoxanide, 80% showed clinical improvement in symptoms after 7 d and 67% had no oocysts detected in the stools, compared to 41% with clinical improvement and 22% with parasitological improvement in the placebo-treated group (Tzipori and Ward, 2002).
-
Antidiarrheal agents:
Antidiarrheal agents are used to treat diarrhea adjunctly with rehydration therapy to correct for fluid and electrolyte depletion. May provide temporary relief in some patients. Octreotide (Sandostatin) may help, but it is expensive (Website 103).
-
Applicable:
A decrease in diarrheal flux improves the quality of life for people with cryptosporidiosis and may (theoretically) improve nutrient exchange through longer intestinal contact time. Opiates and other nonspecific drugs are the mainstay of antimotility agent treatment (Griffiths, 1998).
-
Prevention:
-
Prevention of Exposure:
-
Description:
Patients with underlying immune system weaknesses are at risk for the more severe complications of Cryptosporidium infection. In the absence of effective, specific therapy against infection with this parasite, preventative measures are of great importance among this patient population. Such measures include extensive hand washing, avoiding direct contact with stool from animals or humans, avoiding the accidental ingestion of water used in recreational activities, and taking measures to ensure the safety of the drinking water. It should be noted that the quality of the local drinking water is regionally and seasonally variable. Local public health and municipal water authorities can provide specific information about the safety of the water supply. Cryptosporidium species can be removed from drinking water by either boiling for 1 min or by filtering the water through a filter with a pore size of less than 1 um. These recommendations are well summarized on the Centers for Disease Control and Prevention's Web site (Leav et al., 2003).
-
Source water control:
-
Description:
The multiple barrier concept for prevention of waterborne disease in drinking water includes protection of source waters from contamination. Protected watersheds generally have lower oocyst levels than sites receiving agricultural, sewage, or urban runoff. Limiting these activities in a watershed might help reduce the burden on the water treatment process, but storm events that wash fecal material into receiving streams, animal migration, or epizootic infections may create peaks in the oocyst densities (Rose et al., 1997).
-
Efficacy:
-
Duration:
Impoundment of water in a reservoir can reduce variations in water quality. Small size and low density of an oocyst results in a low sedimentation velocity (0.5 mm/sec) requiring more than a year for the oocyst to settle to the bottom of a 20 m deep reservoir. Although a reservoir may not reduce the number of oocysts through sedimentation, oocyst viability would be expected to decline over this period (Rose et al., 1997).
-
Coagulation, Sedimentation, and Filtration:
-
Description:
Physical removal of oocysts through coagulation, sedimentation, and filtration is the primary barrier against waterborne cryptosporidiosis. Most waterborne outbreaks have been associated with problems with one of these processes. When deficiencies were corrected, rates of cryptosporidiosis decreased, indicating that properly operated filtration can control waterborne diseases in a community (Rose et al., 1997). Effective coagulation of oocysts has been achieved using alum, ferric chloride, and polyaluminum chloride. Addition of a polymer along with a metal salt generally improves oocyst removal. Enhanced coagulation for optimum removal of total organic carbon also improved removal of oocysts compared to the conventional baseline conditions. Microfiltration and ultrafiltration membrane processes can remove all oocysts (Rose et al., 1997).
-
Efficacy:
-
Rate:
Properly operated conventional treatment (coagulation, sedimentation, and filtration) can remove 99% or more of the oocysts. Microfiltration and ultrafiltration membrane processes can remove all oocysts. In addition, treatment processes such as direct filtration (with chemical pretreatment), high-rate filtration, dissolved-air flotation, diatomaceous earth, and slow-sand filtration can also effectively remove oocysts (Rose et al., 1997).
-
Waste stream recycle:
-
Description:
Efforts to conserve water in arid areas, to minimize impact on receiving stream, and to reduce waste have led to the recycling of water used to wash filters. These waters can contain high levels of oocysts, however if properly handled, the microbial impact of washwater recycle can be minimized. Many systems, however, are not designed or operated for this process. Often times, the recycle pumps are designed to quickly drain the washwater holding tanks, increasing the proportion of recycled water to 10% or more of the total flow. To reduce the number of oocysts it has been recommended that recycled water be constantly returned at low rates and that washwater be treated with polymers. In the evaluation of the Waterloo (Ontario, Canada) treatment plant, other options for handling backwash were deemed to pose potentially greater risks than recycling the water through the treatment plant (Rose et al., 1997).
-
Disinfection with chlorine dioxide:
-
Description:
For control of the waterborne protozoan a combination of filtration and disinfection will be needed (Rose et al., 1997). Chlorine dioxide has demonstrated some efficacy as a disinfectant for Cryptosporidium inactivation. Thirty minutes of exposure of 0.22 mg chlorine dioxide per liter significantly reduced oocyst infectivity, although some oocysts remain viable. In contrast, others found out that a disinfectant concentration multiplied by a contact time (CT) product of 60 to 80 mg. min/l was necessary to produce 90 to 96% inactivation (Rose et al., 1997).
-
Efficacy:
-
Rate:
The percent inactivation rate of free chlorine dioxide disinfection for Cryptosporidium is 90 to 97% (Rose et al., 1997).
-
Disinfection with ozone:
-
Description:
Although, ozonation of water has also been shown to kill Cryptosporidium oocysts, the appropriate amounts of ozone needed to disinfect water at various temperatures and pHs have not been clearly defined. Bottlers are currently restricted to no more than 0.4 mg of ozone per liter in the final product. This may or may not be an adequate amount to kill Cryptosporidium species, depending on the contact time and other water conditions. In general, the amount of ozone needed to kill Cryptosporidium species is hundreds of times greater than that needed to kill bacterial contaminants (Juranek, 1995).
-
Efficacy:
-
Rate:
On average, 4.5 mg min/l CT was required for 99% oocyst inactivation (measured by mouse infectivity) by ozone at 20 to 25 degrees celcius (Rose et al., 1997).
-
Synergistic Effects:
-
Description:
Oocyst viability (measured using DAPI and PI) decreased 50, 99.7, and 100% when oocysts were shaken with sand for 5, 90, and 120 minutes, respectively. Viability decreased additional 25% when oocysts were shaken with sand for 5 minutes, then exposed to free chlorine (1mg/l at 20 degees C) for 5 minutes. The synergism of multiple disinfectants was found when free chlorine was followed by monochloramine producing oocyst inactivation greater than the sum of both disinfectants examined separately. Synergism for ozone and chloramines was also observed (Rose et al., 1997).
-
Model System:
-
Mouse:
-
Model Host:
The mouse is the most commonly used model of C. parvum infections (Lindsay, 1997) (Lindsay, 1997).
-
Model Pathogens:
-
Description:
The mouse is the most commonly used model of C. parvum infections. Soon after C. parvum was recognized as a serious pathogen, scientists began developing mouse models for the parasite and it was determined that most outbred strains of weaned or adult mice were resistant to experimental infection but suckling animals could be readily infected (Lindsay, 1997). Many scientist have used the suckling mouse system to examine a variety of the aspects of the biology of C. parvum (Lindsay, 1997). Conventional adult BALB/c and CD1 mice are infrequently susceptible to even light C. parvum infection, but germ free adults of the same strains are readily susceptible to infections (Lindsay, 1997).
Other models of C. parvum that are presently being used include the neonatal mouse and the immunosuppressed mouse (Tzipori, 1998).
-
Rat:
-
Model Host:
Several groups of researchers presently use rats to study C. parvum infections (Lindsay, 1997).
-
Model Pathogens:
-
Description:
Several groups of researchers presently use rats to study C. parvum infections. Most studies involve chemically or naturally (athymic) immunosuppressed animals (Lindsay, 1997).
-
Guinea pig:
-
Model Host:
Guinea pig (Lindsay, 1997)
-
Model Pathogens:
-
Description:
Cryptosporidium parvum was transmitted to 1-day-old SPF guinea pigs. The prepatent period was 7 days, and the patent period was 4 days. No clinical signs were present. Others were unable to transmit C. parvum (calf-origin Cryptosporidium sp.) to guinea pigs (Lindsay, 1997).
-
Hamster:
-
Model Host:
Hamster (Lindsay, 1997)
-
Model Pathogens:
-
Description:
A model of cryptosporidiosis used Suckling Syrian golden hamster pups, 4 to 5 days old, that were inoculated orally or by a novel method that involved direct inoculation through the body wall into the stomach (Lindsay, 1997). Experimental C. parvum infections in young adult and aged male hamsters were compared (Lindsay, 1997). Cryptosporidium parvum infection was studied in immunosuppressed adult hamsters (Lindsay, 1997).
-
Primate:
-
Model Host:
Rhesus monkeys (Macaca mulatta) (Lindsay, 1997)
-
Model Pathogens:
-
Description:
Disseminated C. parvum infections have been observed in Rhesus monkeys (Macaca mulatta) experimentally infected with Simian immunodeficiency virus delta. This suggests a potential experimental primate model of cryptosporidiosis following viral induced immunosuppression (Lindsay, 1997).
-
Pig:
-
Model Host:
Pig (Tzipori, 1998)
-
Model Pathogens:
-
Description:
The piglet diarrhea model helps identify realistic interactions between diarrhea, effective therapy, and drug toxicity (Tzipori, 1998). The piglet diarrhea model is the only standard diarrhea model available that can be used under controlled laboratory conditions (Tzipori, 1998).
The piglet diarrhea model remains our model of choice for the detection of partially effective drugs, and it is clearly the most accurate predictor of the efficacy of drugs in humans with chronic cryptosporidiosis (Theodos et al., 1998).
-
Miscellaneous mammalian host models:
-
Model Host:
Young calves, lambs, goat kids, and pigs are susceptible to experimental C. parvum infections (Lindsay, 1997). Dogs and cats are susceptible to human C. parvum isolates, however little attention has been given these hosts. Cryptosporidium parvum infections were studied in suckling opossums (Lindsay, 1997).
-
Model Pathogens:
-
Description:
Young calves, lambs, goat kids, and pigs are susceptible to experimental C. parvum infections. Because of their large size, high susceptibility for natural C. parvum infections, and high cost of housing they are not often used in controlled laboratory studies (Lindsay, 1997). Dogs and cats are susceptible to human C. parvum isolates, however little attention has been given these hosts. Cryptosporidium parvum infections were studied in suckling opossums (Lindsay, 1997).
-
Mammals:
-
Taxonomy Information:
-
Species:
-
Mammals
(Website 102):
-
GenBank Taxonomy No.:
40674
-
Scientific Name:
Mammalia (Website 102)
-
Description:
Even though C. parvum was described in 1907, it was not recognized as a pathogen of mammals until 1971 when the infection was linked to calf diarrhea (Sestak et al., 2002).
Cryptosporidium parvum is zoonotic, apparently lacking host specificity among mammals (Fayer et al., 1997).
-
Primates
(Website 16):
-
GenBank Taxonomy No.:
9443
-
Scientific Name:
Primate (Website 16)
-
Description:
Cryptosporidium parvum and C. parvum-like oocysts have been reported from the following primates: Ateles belzebuth (Marimonda spider monkey), Calithrix jacchus (common marmoset), Cercocebus albigena (mangabey), Cercocebus torquatus (white-collared monkey), Cercopithecus aethiops (velvet monkey), Cercopithecus campbelli (Campbell's mona), Cercopithecus talapoin (Talapoin monkey), Erythrocebus patas (Patas monkey), Eulemur macaco (black lemur), Gorilla gorilla (gorilla), Homo sapiens (human), Hylobates syndactylus syndactylus (siamang), Lemur catta (ring-tailed lemur), Lemur macacomayottensis (brown lemur), Lemur variegatus (ruffed lemur), Macaca fascicularis (long-tailed macaque), Macaca fuscata (Japanese macaque), Macaca mulatta (rhesus monkey), Macaca nemestrina (cotton-tipped/pigtail macaque), Macaca radiata (Bonnet macaque), Macaca thibetana (Pere David's macaque), Mandrillus leucophaeus (drill), Nycticebus pygmaeus (lesser slow loris), Papio anubis (olive baboon), Papio cynocephalus (baboon), Pithecia pithecia (white-faced saki), Pongo pygmaeus (orangutan), Saguinus oedipus (cotton-topped tamarin), Saimiri sciureus (squirrel monkey), and Varecia variegata (red-ruffed lemur) (Fayer et al., 2000).
-
Ateles belzebuth hybridus (Website 17):
-
GenBank Taxonomy No.:
129801
-
Scientific Name:
Ateles belzebuth hybridus (Website 17)
-
Description:
Three species of primates previously found to be infested were still shedding cryptosporidial oocysts (Eulemur macaco mayottensis, Ateles belzebuth hybridus and Cercopithecus talapoin) (Gomez et al., 2000). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Cercocebus torquatus torquatus (Website 18):
-
GenBank Taxonomy No.:
81944
-
Scientific Name:
Cercocebus torquatus torquatus (Website 18)
-
Description:
Three species of primates previously found to be infested were still shedding cryptosporidial oocysts (Eulemur macaco mayottensis, Ateles belzebuth hybridus and Cercopithecus talapoin) whereas two became negative in the current study (Cercocebus torquatus torquatus and Cercocebus patas) (Gomez et al., 2000). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Black lemur
(Website 19):
-
GenBank Taxonomy No.:
30602
-
Scientific Name:
Eulemur macaco (Website 19)
-
Description:
Three species of primates previously found to be infested were still shedding cryptosporidial oocysts (Eulemur macaco mayottensis, Ateles belzebuth hybridus and Cercopithecus talapoin) (Gomez et al., 2000). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Eulemur macaco macaco
(Website 20):
-
GenBank Taxonomy No.:
30603
-
Scientific Name:
Eulemur macaco macaco (Website 20)
-
Description:
All primate species newly introduced into the zoo have been infested by the protozoan (Eulemur macaco macaco, Lemur variegatus, Lemur catta, Saimiri sciureus boliviensis, Cercocebus albigena albigena, and Macaca thibetana (Gomez et al., 2000)). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Mountain gorilla
(Website 21):
-
GenBank Taxonomy No.:
9594
-
Scientific Name:
Gorilla gorilla beringei (Website 21)
-
Description:
For behavioral research and due to growing ecotourism, some populations of free-ranging mountain gorillas (Gorilla gorilla beringei) have become habituated to humans. Molecular analysis of two Cryptosporidium sp. oocyst isolates originating from two human-habituated gorilla groups and two oocyst isolates from non-habituated gorillas yielded positive identification of C. parvum Genotype 2 (G2; i.e., "cattle", "animal-adapted", or "zoonotic"). As G2 is cross-transmissible between humans and animals, C. parvum infections can be propagated in the habitats of human-habituated, free-ranging gorillas through both zoonotic and anthroponotic transmission cycles (Graczyk et al., 2001).
-
Siamang
(Website 22):
-
GenBank Taxonomy No.:
9590
-
Scientific Name:
Hylobates syndactylus (Website 22)
-
Description:
Five primates found to be infected in the present study (Pithecia pithecia, Cercopithecus torquatus lunulatus, Mandrillus leucophaeus, Hylobates syndactylus syndactylus, and Gorilla gorilla) had previously tested negative for Cryptosporidium (Gomez et al., 2000). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Ring-tailed lemur
(Website 23):
-
GenBank Taxonomy No.:
9447
-
Scientific Name:
Lemur catta (Website 23)
-
Description:
All primate species newly introduced into the zoo have been infested by the protozoan (Eulemur macaco macaco, Lemur variegatus, Lemur catta, Saimiri sciureus boliviensis, Cercocebus albigena albigena, and Macaca thibetana (Gomez et al., 2000)). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Ruffed lemur
(Website 24):
-
GenBank Taxonomy No.:
9455
-
Scientific Name:
Varecia variegata or Lemur variegatus (Website 24)
-
Description:
All primate species newly introduced into the zoo have been infested by the protozoan (Eulemur macaco macaco, Lemur variegatus, Lemur catta, Saimiri sciureus boliviensis, Cercocebus albigena albigena, and Macaca thibetana (Gomez et al., 2000). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Gray-cheeked mangabey
(Website 25):
-
GenBank Taxonomy No.:
75567
-
Scientific Name:
Lophocebus albigena or Cercocebus albigena (Website 25)
-
Description:
All primate species newly introduced into the zoo have been infested by the protozoan (Eulemur macaco macaco, Lemur variegatus, Lemur catta, Saimiri sciureus boliviensis, Cercocebus albigena albigena, and Macaca thibetana (Gomez et al., 2000)). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Pere David's macaque
(Website 26):
-
GenBank Taxonomy No.:
54602
-
Scientific Name:
Macaca thibetana (Website 26)
-
Description:
All primate species newly introduced into the zoo have been infested by the protozoan (Eulemur macaco macaco, Lemur variegatus, Lemur catta, Saimiri sciureus boliviensis, Cercocebus albigena albigena, and Macaca thibetana (Gomez et al., 2000)). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Drill
(Website 27):
-
GenBank Taxonomy No.:
9568
-
Scientific Name:
Mandrillus leucophaeus (Website 27)
-
Description:
Five primates found to be infected in the present study (Pithecia pithecia, Cercopithecus torquatus lunulatus, Mandrillus leucophaeus, Hylobates syndactylus syndactylus, and Gorilla gorilla) had previously tested negative for Cryptosporidium (Gomez et al., 2000). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
White-faced saki
(Website 28):
-
GenBank Taxonomy No.:
43777
-
Scientific Name:
Pithecia pithecia (Website 28)
-
Description:
Five primates found to be infected in the present study (Pithecia pithecia, Cercopithecus torquatus lunulatus, Mandrillus leucophaeus, Hylobates syndactylus syndactylus, and Gorilla gorilla) had previously tested negative for Cryptosporidium (Gomez et al., 2000). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Propithecus verreauxi coquereli
(Website 31):
-
GenBank Taxonomy No.:
122226
-
Scientific Name:
Propithecus verreauxi coquereli (Website 31)
-
Description:
Using molecular and morphological techniques a Cryptosporidium genotype identified in stools of a captive Coquerel's sifaka (Propithecus verreauxi coquereli), a prosimian primate native to Madagascar. The oocysts were morphologically identical to C. parvum, and the phylogenetic analysis based on the full-length ssrRNA confirmed that this isolate belonged to the C. parvum group. Sequence of a DNA fragment of the N-terminal part of the COWP gene was identical to two recently reported Cryptosporidium sequences from isolates obtained from a human with cryptosporidiosis. The partial ssrRNA sequences containing a variable region from these same isolates also showed 100% similarity to the ssrRNA sequence from the Cryptosporidium genotype identified in these captive lemurs (da Silva et al., 2003).
-
Common squirrel monkey
(Website 29):
-
GenBank Taxonomy No.:
9521
-
Scientific Name:
Saimiri sciureus (Website 29)
-
Description:
All primate species newly introduced into the zoo have been infested by the protozoan (Eulemur macaco macaco, Lemur variegatus, Lemur catta, Saimiri sciureus boliviensis, Cercocebus albigena albigena, and Macaca thibetana (Gomez et al., 2000)). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Cetartiodactyla
(Website 30):
-
GenBank Taxonomy No.:
91561
-
Scientific Name:
Cetartiodactyla (Website 30)
-
Description:
Cryptosporidium parvum and C. parvum-like oocysts have been reported from the following artiodactyla: Addax nasomaculatus (addax), Aepyceros melampus (impala), Ammotragus lervia (Barbary sheep), Antidorcas marsupialis (springbok), Antilope cervicapra (blackbuck), Axis axis (axis deer), Bison bison (American bison), Bison bonasus (European bison), Bos indicus (zebu), Bos taurus (ox), Boselaphus tragocamelus (nilgai), Bubalus bubalis (water buffalo), Bubalus depressicornis (lowland anoa), Camelus bactrianus (bactrian camel), Capra falconeri (turkomen markhor), Capra hircus (goat), Capreolus capreolus (roe deer), Cervus albirostris (Thorold's deer), Cervus duvauceli (Barasingha deer), Cervus elaphus (red deer/elk/wapiti), Cervus eldi (Eld's deer), Cervus nippon (Sika deer), Cervus unicolor (sambar), Connochaetes gnou (wildebeest), Connochaetes taurinus (blue-beard gnu), Dama dama (fallow deer), Elaphus davidianus (Pere David's deer), Gazella dama (Addra gazelle), Gazella dorcas (Dorca's gazelle), Gazella leptoceros (slender-horned gazelle), Gazella subgutterosa (Persian gazelle), Gazella thomsoni (Thomson's gazelle), Giraffa camelopardalis (giraffe), Hexaprotodon liberiensis (pygmy hippopotamus), Hippotragus niger (sable antelope), Kobus ellipsiprymmus (ellipsen waterbuck), Lama glama (llama), Lama guanicoae (guanaco), Lama pacos (alpaca), Muntiacus reevesi (muntjac deer), Odocoileus hemionus (mule deer), Odocoileus virginianus (white-tailed deer), Oryx gazella callotys (fringe-eared oryx), Oryx gazella dammah (scimitar-horned oryx), Ovis aries (sheep), Ovis musimon (mouflon), Ovis orientalis (urial), Sus scrofa (pig), Syncerus caffer (African buffalo), Taurotragus oryx (eland), Tayassu tajacu (collared peccary), Tragelaphus euryceros (bongo) (Fayer et al., 2000).
-
Addax nasomaculatus
(Website 32):
-
GenBank Taxonomy No.:
59515
-
Scientific Name:
Addax nasomaculatus (Website 32)
-
Description:
In neonatal exotic ruminants, C. parvum was confirmed by histology or by oocyst detection in blackbuck (Antilope cervicapra), sable antelope (Hippotragus niger), scimitar-horned (Oryx gazella dammah) and fringe-eared (Oryx gazella callotys) oryx, and in addax (Addax nasomaculatus) (Fayer et al., 1997).
-
Blackbuck
(Website 33):
-
GenBank Taxonomy No.:
59525
-
Scientific Name:
Antilope cervicapra (Website 33)
-
Description:
In neonatal exotic ruminants, C. parvum was confirmed by histology or by oocyst detection in blackbuck (Antilope cervicapra), sable antelope (Hippotragus niger), scimitar-horned (Oryx gazella dammah) and fringe-eared (Oryx gazella callotys) oryx, and in addax (Addax nasomaculatus) (Fayer et al., 1997).
-
American bison
(Website 34):
-
GenBank Taxonomy No.:
9901
-
Scientific Name:
Bison bison (Website 34)
-
Description:
In all, 17 species previously found to be negative became infected (Bison bison, Bison bonasus, Bos taurus frontalis, Boselaphus tragocamelus, Oryx dammae, Ovis musimon, Tragelaphus eurycerus, Camelus bactrianus, Camelus dromedaries, Lama guanicoe, Cervus dama, Cervus elaphus canadiensis, Cervus unicolor, Hexaprotodom liberiensis, Tayassu tajacu, Tapirus terrestris, and Loxodonta africana) Gomez et al., 2000)). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
European bison
(Website 35):
-
GenBank Taxonomy No.:
9902
-
Scientific Name:
Bison bonasus (Website 35)
-
Description:
In all, 17 species previously found to be negative became infected (Bison bison, Bison bonasus, Bos taurus frontalis, Boselaphus tragocamelus, Oryx dammae, Ovis musimon, Tragelaphus eurycerus, Camelus bactrianus, Camelus dromedaries, Lama guanicoe, Cervus dama, Cervus elaphus canadiensis, Cervus unicolor, Hexaprotodom liberiensis, Tayassu tajacu, Tapirus terrestris, and Loxodonta africana (Gomez et al., 2000)). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Cow
(Website 3):
-
GenBank Taxonomy No.:
9913
-
Scientific Name:
Bos taurus (Website 3)
-
Description:
In 1971, the first report of bovine cryptosporidiosis described endogenous stages in the jejunum of an 8-month old heifer with chronic diarrhea. Reports followed of diarrheic calves 2 weeks old or less from beef and dairy herds. C. parvum was found in histological sections of lower jejunum and ileum. Other enteropathogens often associated with calfhood diarrhea were not found in some calves, leaving C. parvum as the sole pathogen. A study in the U.S. confirmed these Canadian findings and suggested that cryptosporidia were common enteropathogens of calves. Studies worldwide have supported this. Experimental infections with purified oocysts confirmed that C. parvum alone induced clinical illness (Fayer et al., 1997).
-
Nilgai
(Website 36):
-
GenBank Taxonomy No.:
9917
-
Scientific Name:
Boselaphus tragocamelus (Website 36)
-
Description:
In all, 17 species previously found to be negative became infected (Bison bison, Bison bonasus, Bos taurus frontalis, Boselaphus tragocamelus, Oryx dammae, Ovis musimon, Tragelaphus eurycerus, Camelus bactrianus, Camelus dromedaries, Lama guanicoe, Cervus dama, Cervus elaphus canadiensis, Cervus unicolor, Hexaprotodom liberiensis, Tayassu tajacu, Tapirus terrestris, and Loxodonta africana (Gomez et al., 2000)). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Lowland anoa
(Website 37):
-
GenBank Taxonomy No.:
27596
-
Scientific Name:
Bubalus depressicornis (Website 37)
-
Description:
Of the three newly introduced hosts (Bubalus depressicornis, Gazella dama mhorr, and Babyrousa babyrousa), only the first shows the presence of oocysts (Gomez et al., 2000). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Bactrian camel
(Website 38):
-
GenBank Taxonomy No.:
9837
-
Scientific Name:
Camelus bactrianus (Website 38)
-
Description:
In all, 17 species previously found to be negative became infected (Bison bison, Bison bonasus, Bos taurus frontalis, Boselaphus tragocamelus, Oryx dammae, Ovis musimon, Tragelaphus eurycerus, Camelus bactrianus, Camelus dromedaries, Lama guanicoe, Cervus dama, Cervus elaphus canadiensis, Cervus unicolor, Hexaprotodom liberiensis, Tayassu tajacu, Tapirus terrestris, and Loxodonta africana (Gomez et al., 2000)). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Arabian camel
(Website 39):
-
GenBank Taxonomy No.:
9838
-
Scientific Name:
Camelus dromedarius (Website 39)
-
Description:
In all, 17 species previously found to be negative became infected (Bison bison, Bison bonasus, Bos taurus frontalis, Boselaphus tragocamelus, Oryx dammae, Ovis musimon, Tragelaphus eurycerus, Camelus bactrianus, Camelus dromedaries, Lama guanicoe, Cervus dama, Cervus elaphus canadiensis, Cervus unicolor, Hexaprotodom liberiensis, Tayassu tajacu, Tapirus terrestris, and Loxodonta africana (Gomez et al., 2000)). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Goat
(Website 5):
-
GenBank Taxonomy No.:
9925
-
Scientific Name:
Capra hircus (Website 5)
-
Description:
The prevalence of infection by C. parvum in lambs and goat kids has been studied in both outbreaks of diarrhea and in randomly selected farms, although more research has been done on cattle. In outbreaks of diarrhea, morbidity can be very high in lambs and goat kids. Mortality increases when the disease is associated with concurrent infections or deficiencies in nutrition or husbandry. In goat herds in France and Hungary, C. parvum was considered to be the predominant aetiological agent in neonate goat kids with diarrhea. In Spain, in a study on 97 sheep farms and 31 goat farms, all randomly selected, corresponding to a total of 2204 lambs and 367 goat kids under 5 weeks old, flock prevalence was 47 and 36% and individual prevalence was 15 and 11% for lambs and goat kids, respectively (de Graaf et al., 1999).
-
Fallow deer
(Website 40):
-
GenBank Taxonomy No.:
30532
-
Scientific Name:
Cervus dama or Dama dama (Website 40)
-
Description:
In all, 17 species previously found to be negative became infected (Bison bison, Bison bonasus, Bos taurus frontalis, Boselaphus tragocamelus, Oryx dammae, Ovis musimon, Tragelaphus eurycerus, Camelus bactrianus, Camelus dromedaries, Lama guanicoe, Cervus dama, Cervus elaphus canadiensis, Cervus unicolor, Hexaprotodom liberiensis, Tayassu tajacu, Tapirus terrestris, and Loxodonta africana (Gomez et al., 2000)). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Wapiti
(Website 41):
-
GenBank Taxonomy No.:
9861
-
Scientific Name:
Cervus elaphus canadensis (Website 41)
-
Description:
In all, 17 species previously found to be negative became infected (Bison bison, Bison bonasus, Bos taurus frontalis, Boselaphus tragocamelus, Oryx dammae, Ovis musimon, Tragelaphus eurycerus, Camelus bactrianus, Camelus dromedaries, Lama guanicoe, Cervus dama, Cervus elaphus canadiensis, Cervus unicolor, Hexaprotodom liberiensis, Tayassu tajacu, Tapirus terrestris, and Loxodonta africana (Gomez et al., 2000)). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Samba
(Website 42):
-
GenBank Taxonomy No.:
9862
-
Scientific Name:
Cervus unicolor (Website 42)
-
Description:
In all, 17 species previously found to be negative became infected (Bison bison, Bison bonasus, Bos taurus frontalis, Boselaphus tragocamelus, Oryx dammae, Ovis musimon, Tragelaphus eurycerus, Camelus bactrianus, Camelus dromedaries, Lama guanicoe, Cervus dama, Cervus elaphus canadiensis, Cervus unicolor, Hexaprotodom liberiensis, Tayassu tajacu, Tapirus terrestris, and Loxodonta africana (Gomez et al., 2000)). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Connochaetes taurinus taurinus
(Website 43):
-
GenBank Taxonomy No.:
101659
-
Scientific Name:
Connochaetes taurinus taurinus (Website 43)
-
Description:
The morphological characteristics and measurements of the oocysts from five hosts (Connochaetes taurinus taurinus, Gazella dorcas neglecta, Kobus ellipsiprymmus, Syncerus caffer, Giraffa camelopardalis) matched those of C. parvum, a species that frequently infects these kind of mammals (Gomez et al., 1996).
-
Dorcas gazelle
(Website 44):
-
GenBank Taxonomy No.:
37751
-
Scientific Name:
Gazella dorcas or Gazella pelzelni (Website 44)
-
Description:
The morphological characteristics and measurements of the oocysts from five hosts (Connochaetes taurinus taurinus, Gazella dorcas neglecta, Kobus ellipsiprymmus, Syncerus caffer, Giraffa camelopardalis) matched those of C. parvum, a species that frequently infects these kind of mammals (Gomez et al., 1996).
-
Giraffe
(Website 45):
-
GenBank Taxonomy No.:
9894
-
Scientific Name:
Giraffa camelopardalis (Website 45)
-
Description:
The morphological characteristics and measurements of the oocysts from five hosts (Connochaetes taurinus taurinus, Gazella dorcas neglecta, Kobus ellipsiprymmus, Syncerus caffer, Giraffa camelopardalis) matched those of C. parvum, a species that frequently infects these kind of mammals (Gomez et al., 1996).
-
Pygmy hippopotamus
(Website 46):
-
GenBank Taxonomy No.:
56798
-
Scientific Name:
Hexaprotodon liberiensis (Website 46)
-
Description:
17 species previously found to be negative became infected (Bison bison, Bison bonasus, Bos taurus frontalis, Boselaphus tragocamelus, Oryx dammae, Ovis musimon, Tragelaphus eurycerus, Camelus bactrianus, Camelus dromedaries, Lama guanicoe, Cervus dama, Cervus elaphus canadiensis, Cervus unicolor, Hexaprotodom liberiensis, Tayassu tajacu, Tapirus terrestris, and Loxodonta africana (Gomez et al., 2000)). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Sable antelope
(Website 47):
-
GenBank Taxonomy No.:
37189
-
Scientific Name:
Hippotragus niger (Website 47)
-
Description:
In neonatal exotic ruminants, C. parvum was confirmed by histology or by oocyst detection in blackbuck (Antilope cervicapra), sable antelope (Hippotragus niger), scimitar-horned (Oryx gazella dammah) and fringe-eared (Oryx gazella callotys) oryx, and in addax (Addax nasomaculatus) (Fayer et al., 1997).
-
Waterbuck
(Website 48):
-
GenBank Taxonomy No.:
9962
-
Scientific Name:
Kobus ellipsiprymnus (Website 48)
-
Description:
The morphological characteristics and measurements of the oocysts from five hosts (Connochaetes taurinus taurinus, Gazella dorcas neglecta, Kobus ellipsiprymmus, Syncerus caffer, Giraffa camelopardalis) matched those of C. parvum, a species that frequently infects these kind of mammals (Gomez et al., 1996).
-
Guanaco
(Website 49):
-
GenBank Taxonomy No.:
9840
-
Scientific Name:
Lama guanicoe or Lama guanicoe guanaco (Website 49)
-
Description:
17 species previously found to be negative became infected (Bison bison, Bison bonasus, Bos taurus frontalis, Boselaphus tragocamelus, Oryx dammae, Ovis musimon, Tragelaphus eurycerus, Camelus bactrianus, Camelus dromedaries, Lama guanicoe, Cervus dama, Cervus elaphus canadiensis, Cervus unicolor, Hexaprotodom liberiensis, Tayassu tajacu, Tapirus terrestris, and Loxodonta africana (Gomez et al., 2000)). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Chinese muntjac
(Website 50):
-
GenBank Taxonomy No.:
9886
-
Scientific Name:
Muntiacus reevesi (Website 50)
-
Description:
Although specimen collection was done on a casual basis, this work has shown for the first time that hedgehogs, shrews, fallow and muntjac deer, badgers and foxes can shed C. parvum in their feces (Sturdee et al., 1999).
-
White-tailed deer
(Website 51):
-
GenBank Taxonomy No.:
9874
-
Scientific Name:
Odocoileus virginianus (Website 51)
-
Description:
Based on morphometric analysis, in the previous reports of infections in deer cryptosporidia were designated C. parvum. In addition, for one of the captive deer isolates, the SSU rRNA gene sequence was identical to the C. parvum genotype 2 sequence (GenBank accession number AF093494) (Perz and Le Blancq, 2001). Southern analysis revealed 22 fecal samples containing Cryptosporidium small-subunit (SSU) ribosomal DNA and these included 10 of 91 white-tailed deer (Odocoileus virginianus) samples (Perz and Le Blancq, 2001).
-
Scimitar-horned oryx
(Website 52):
-
GenBank Taxonomy No.:
59534
-
Scientific Name:
Oryx dammah (Website 52)
-
Description:
17 species previously found to be negative became infected (Bison bison, Bison bonasus, Bos taurus frontalis, Boselaphus tragocamelus, Oryx dammae, Ovis musimon, Tragelaphus eurycerus, Camelus bactrianus, Camelus dromedaries, Lama guanicoe, Cervus dama, Cervus elaphus canadiensis, Cervus unicolor, Hexaprotodom liberiensis, Tayassu tajacu, Tapirus terrestris, and Loxodonta africana) (Gomez et al., 2000). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Oryx gazella callotis
(Website 53):
-
GenBank Taxonomy No.:
59548
-
Scientific Name:
Oryx gazella callotis (Website 53)
-
Description:
In neonatal exotic ruminants, C. parvum was confirmed by histology or by oocyst detection in blackbuck (Antilope cervicapra), sable antelope (Hippotragus niger), scimitar-horned (Oryx gazella dammah) and fringe-eared (Oryx gazella callotys) oryx, and in addax (Addax nasomaculatus) (Fayer et al., 1997).
-
Sheep
(Website 4):
-
GenBank Taxonomy No.:
9940
-
Scientific Name:
Ovis aries (Website 4)
-
Description:
Infection has been reported in sheep in several European countries, the US, Canada, Iran, and Trinidad and Tobago, and C. parvum is now considered one of the principal causes of diarrheic outbreaks in neonatal lambs. Infection causes mild to severe diarrhea in lambs 512 days old accompanied by depression, anorexia, weight loss and the shedding of a large number of oocysts. Mortality is low in naturally reared suckling lambs, although it increases when the disease is associated with concurrent infections or deficiencies in nutrition or husbandry (Causape et al., 2002).
-
Mouflon
(Website 54):
-
GenBank Taxonomy No.:
9938
-
Scientific Name:
Ovis aries musimon (Website 54)
-
Description:
17 species previously found to be negative became infected (Bison bison, Bison bonasus, Bos taurus frontalis, Boselaphus tragocamelus, Oryx dammae, Ovis musimon, Tragelaphus eurycerus, Camelus bactrianus, Camelus dromedaries, Lama guanicoe, Cervus dama, Cervus elaphus canadiensis, Cervus unicolor, Hexaprotodom liberiensis, Tayassu tajacu, Tapirus terrestris, and Loxodonta africana (Gomez et al., 2000)). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Pig
(Website 6):
-
GenBank Taxonomy No.:
9823
-
Scientific Name:
Sus scrofa (Website 6)
-
Description:
Previous studies have confirmed that diarrhea in suckling and weaned piglets is usually a multifactorial problem, where mixed infections between C. parvum and E. coli or rotavirus are frequent. It has been suggested that Cryptosporidium is not an important primary agent of diarrhea in piglets but it may be a copathogen in the multifactorial aetiology. Recently, genetic analysis of the Cryptosporidium isolates from pig herds revealed that the animals harbored two distinct genotypes: a porcine genotype and a bovine genotype with distinct virulence in nude mice. The zoonotic potential of the porcine genotype is still uncertain and requires further study (de Graaf et al., 1999).
-
African buffalo
(Website 55):
-
GenBank Taxonomy No.:
9970
-
Scientific Name:
Syncerus caffer (Website 55)
-
Description:
The morphological characteristics and measurements of the oocysts from five hosts (Connochaetes taurinus taurinus, Gazella dorcas neglecta, Kobus ellipsiprymmus, Syncerus caffer, Giraffa camelopardalis) matched those of C. parvum, a species that frequently infects these kind of mammals (Gomez et al., 1996).
-
Collared peccary
(Website 56):
-
GenBank Taxonomy No.:
9829
-
Scientific Name:
Pecari tajacu, Tayassu angulatus, or Tayassu tajacu (Website 56)
-
Description:
17 species previously found to be negative became infected (Bison bison, Bison bonasus, Bos taurus frontalis, Boselaphus tragocamelus, Oryx dammae, Ovis musimon, Tragelaphus eurycerus, Camelus bactrianus, Camelus dromedaries, Lama guanicoe, Cervus dama, Cervus elaphus canadiensis, Cervus unicolor, Hexaprotodom liberiensis, Tayassu tajacu, Tapirus terrestris, and Loxodonta africana (Gomez et al., 2000)). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Bongo
(Website 57):
-
GenBank Taxonomy No.:
69297
-
Scientific Name:
Tragelaphus eurycerus or Tragelaphus euryceros (Website 57)
-
Description:
17 species previously found to be negative became infected (Bison bison, Bison bonasus, Bos taurus frontalis, Boselaphus tragocamelus, Oryx dammae, Ovis musimon, Tragelaphus eurycerus, Camelus bactrianus, Camelus dromedaries, Lama guanicoe, Cervus dama, Cervus elaphus canadiensis, Cervus unicolor, Hexaprotodom liberiensis, Tayassu tajacu, Tapirus terrestris, and Loxodonta africana (Gomez et al., 2000)). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Carnivora
(Website 58):
-
GenBank Taxonomy No.:
33554
-
Scientific Name:
Carnivora (Website 58)
-
Description:
Cryptosporidium parvum and C. parvum-like oocysts have been reported from the following members of the Order Carnivora: Acrionyx jubatus (cheetah), Canis familiaris (dog), Canis latrans (coyote), Felis catus (cat), Helarcotos malayanus (Malayan bear), Martes foina (beech marten), Meles meles (badger), Mephitis mephitis (striped skunk), Mustela putorius (ferret), Panthera pardus (leopard), Procyon lotor (raccoon), Urocyon cinereoargenteus (grey fox), Ursus americanus (black bear), Ursus arctos (brown bear), Ursus (Thalarcotos) maritimus (polar bear), Vulpes vulpes (red fox), and Zalophus californianus (California sea lion) (Fayer et al., 2000).
-
Dog
(Website 8):
-
GenBank Taxonomy No.:
9615
-
Scientific Name:
Canis familiaris (Website 8)
-
Description:
Cryptosporidiosis caused by C. parvum was first reported in a dog in the US in 1983. This and other natural infections in dogs were considered to be due to C. parvum. Most infections involved asymptomatic young dogs and have been asymptomatic unless dogs were concurrently infected with canine distemper virus infection, which is known to be immunosuppressive. Experimentally dogs have been infected with C. parvum oocysts from humans and calves. Although antibodies to Cryptosporidium were found in 16 of 20 (80%) dogs from Scotland, surveys in Finland, Germany, and Scotland failed to detect oocysts in feces of healthy dogs, and the prevalence remains unknown (Fayer et al., 1997).
-
Cat
(Website 59):
-
GenBank Taxonomy No.:
9685
-
Scientific Name:
Felis catus (Website 59)
-
Description:
Cryptosporidium parvum from human feces and from bovine feces was transmitted to cats (1 to 100 days old) and the recipients excreted oocysts but remained clinically normal. Another cat fed C. parvum from bovine feces had diarrhea and excreted C. parvum-like oocysts. Cats may serve as hosts to C. felis, C. muris, and C. parvum (Fayer et al., 1997).
-
Beach marten
(Website 60):
-
GenBank Taxonomy No.:
9659
-
Scientific Name:
Martes foina (Website 60)
-
Description:
Temporary episodes of diarrhea in captive beech martens (Martes foina) were accompanied by shedding of Cryptosporidium oocysts. Oocysts were detected in fecal samples by flotation and in acid-fast-stained smear preparations. The oocysts were 3-5 microns, which is consistent with C. parvum. The source of the Cryptosporidium infection remained unknown. This is the first demonstration of Cryptosporidium in beech martens (Rademacher et al., 1999).
-
Eurasian badger
(Website 61):
-
GenBank Taxonomy No.:
9662
-
Scientific Name:
Meles meles (Website 61)
-
Description:
Although specimen collection was done on a casual basis, this work has shown for the first time that hedgehogs, shrews, fallow and muntjac deer, badgers and foxes can shed C. parvum in their feces (Sturdee et al., 1999). Cryptosporidium was found in seven species for which it is the first finding in Britain (Sorex araneus, S. minutus, Erinaceus europaeus, Dama dama, Muntiacus reevesi, Meles meles and Vulpes vulpes) and confirmed the rabbit Oryctolagus cuniculus as a host (Sturdee et al., 1999).
-
Striped skunk
(Website 62):
-
GenBank Taxonomy No.:
30548
-
Scientific Name:
Mephitis mephitis (Website 62)
-
Description:
Southern analysis revealed 22 fecal samples containing Cryptosporidium small-subunit (SSU) ribosomal DNA; these included 10 of 91 white-tailed deer (Odocoileus virginianus) samples, 3 of 5 chipmunk (Tamias striatus) samples, 1 of 2 white-footed mouse (Peromyscus leucopus) samples, 1 of 2 striped skunk (Mephitis mephitis) samples, 1 of 5 racoon (Procyon lotor) samples, and 6 of 6 muskrat (Ondatra zibethicus) samples. All of the 15 SSU PCR products sequenced were characterized as Cryptosporidium parvum (Perz and Le Blancq, 2001).
-
Domestic ferret
(Website 10):
-
GenBank Taxonomy No.:
9669
-
Scientific Name:
Mustela putorius furo (Website 10)
-
Description:
Recent molecular studies show that Cryptosporidium parvum is composed of at least eight genotypes including zoonotic genotypes. Therefore, it is important to screen the genotypes of the isolates harbored in animals for the control of human cryptosporidiosis. The ferret is a popular pet, but also a reservoir of Cryptosporidium. Since the infectivity of zoonotic genotypes in ferrets remains unclear, there is a possibility these hosts harbor zoonotic genotypes. In the present study, we examined the genotypes of C. parvum isolates from ferrets in Japan using polymerase chain reaction direct sequencing. The sequences of the isolates examined clustered with the ferret-adapted genotype (ferret genotype). Our study suggests that ferrets harbor the ferret genotype which is conserved across geographical areas (Abe and Iseki).
-
Raccoon
(Website 9):
-
GenBank Taxonomy No.:
9654
-
Scientific Name:
Procyon iotor (Website 9)
-
Description:
Fecal samples from 100 wild raccoons were examined for the presence of oocysts of Cryptosporidium parvum using a commercially available indirect immunofluorescent detection procedure. Thirteen (13%) of the samples were positive for oocysts. All positive samples were from juvenile raccoons. Over 61% of the infected samples contained moderate to large numbers of oocysts. Raccoons may serve as potential reservoirs for transmission of C. parvum (Snyder, 1988).
-
American black bear
(Website 63):
-
GenBank Taxonomy No.:
9643
-
Scientific Name:
Ursus americanus (Website 63)
-
Description:
To further validate the observation of the existence of host-adapted strains of Cryptosporidium parvum, we genetically characterized an isolate of Cryptosporidium parasite from a black bear. Sequence analysis of the ribosomal RNA small subunit and the 70-kDa heat shock protein (HSP70) showed that this parasite represents a new genotype of C. parvum and is related to the C. parvum dog genotype (Xiao et al., 2000).
-
Red fox
(Website 64):
-
GenBank Taxonomy No.:
9627
-
Scientific Name:
Vulpes vulpes (Website 64)
-
Description:
Although specimen collection was done on a casual basis, this work has shown for the first time that hedgehogs, shrews, fallow and muntjac deer, badgers and foxes can shed C. parvum in their feces (Sturdee et al., 1999). Cryptosporidium was found in seven species for which it is the first finding in Britain (Sorex araneus, S. minutus, Erinaceus europaeus, Dama dama, Muntiacus reevesi, Meles meles and Vulpes vulpes) and confirmed the rabbit Oryctolagus cuniculus as a host (Sturdee et al., 1999).
-
California sealion
(Website 65):
-
GenBank Taxonomy No.:
9704
-
Scientific Name:
Zalophus californianus (Website 65)
-
Description:
By means of fluorescently labeled monoclonal antibodies, Cryptosporidium oocysts were detected in 3 samples from California sea lions, 1 of which also contained Giardia cysts. Oocysts of Cryptosporidium and cysts of Giardia were morphologically indistinguishable from oocysts of C. parvum and cysts of G. duodenalis from other animal origins. Oocysts and cysts were then purified using immunomagnetic separation techniques and identified by polymerase chain reaction, from which species-specific products were obtained. Sequence analysis revealed that the 452-bp and 358-bp PCR products of Cryptosporidium isolated from California sea lion had identities of 98% with sequences of their template fragments of C. parvum obtained from infected calves. Based on morphological, immunological, and genetic characterization, the isolates were identified as C. parvum and G. duodenalis, respectively. The findings suggested that California sea lions could serve as reservoirs in the environmental transmission of Cryptosporidium and Giardia (Deng et al., 2000).
-
Bats
(Website 66):
-
GenBank Taxonomy No.:
9397
-
Scientific Name:
Chiroptera (Website 66)
-
Description:
Cryptosporidium parvum and C. parvum-like oocysts have been reported from the following members of the Order Chiroptera: Eptesicus fuscus (big brown bat) and Myotis adversus (large-footed mouse-eared bat) (Fayer et al., 2000).
-
Large footed bat
(Website 67):
-
GenBank Taxonomy No.:
59461
-
Scientific Name:
Myotis adversus (Website 67)
-
Description:
Mice (M. musculus syn. domesticus) from different geographical areas were shown to carry a distinct genotype of C. parvum (referred to as the "mouse" genotype) by both rDNA and acetyl-CoA synthetase gene sequence analyses, indicating that this genotype is conserved across widely separated geographical areas. The "mouse" genotype was also identified in a fecal sample from a large-footed mouse-eared bat (Myotis adversus), extending the host range of this genotype (Morgan et al., 1999).
-
Insectivora
(Website 68):
-
GenBank Taxonomy No.:
9362
-
Scientific Name:
Insectivora (Website 68)
-
Description:
Cryptosporidium parvum and C. parvum-like oocysts have been reported from the following members of the Order Insectivora: Ateletrix albiventris (African hedgehog), Erinaceus europaeus (European hedgehog), Sorex araneus (long-tailed shrew), Sorex minutus (pygmy shrew) (Fayer et al., 2000).
-
Middle-African hedgehog
(Website 69):
-
GenBank Taxonomy No.:
9368
-
Scientific Name:
Atelerix albiventris (Website 69)
-
Description:
Fatal intestinal cryptosporidiosis of unknown source and unexplained epizootiology is reported in a neonatal captive African hedgehog (Ateletrix albiventris) and for the first time in a hedgehog species. The infection, confined to ileum, jejunum, and colon, was extremely severe in the lower jejunum where over 75% of the epithelial cells harbored the pathogen. The ileum and the jejunum displayed moderate and severe villus atrophy and mucosal hyperplasia. Lamina propria and mucosa were infiltrated by eosinophils, lymphocytes, and macrophages. Developmental stages of Cryptosporidium sp. produced a positive reaction with immunofluorescent antibody for detection of the human pathogen, Cryptosporidium parvum (Graczyk et al., 1998).
-
Western European hedgehog
(Website 70):
-
GenBank Taxonomy No.:
9365
-
Scientific Name:
Erinaceus europaeus (Website 70)
-
Description:
Although specimen collection was done on a casual basis, this work has shown for the first time that hedgehogs, shrews, fallow and muntjac deer, badgers and foxes can shed C. parvum in their feces (Sturdee et al., 1999). Cryptosporidium was found in seven species for which it is the first finding in Britain (Sorex araneus, S. minutus, Erinaceus europaeus, Dama dama, Muntiacus reevesi, Meles meles and Vulpes vulpes) and confirmed the rabbit Oryctolagus cuniculus as a host (Sturdee et al., 1999).
-
European shrew
(Website 71):
-
GenBank Taxonomy No.:
42254
-
Scientific Name:
Sorex araneus (Website 71)
-
Description:
Although specimen collection was done on a casual basis, this work has shown for the first time that hedgehogs, shrews, fallow and muntjac deer, badgers and foxes can shed C. parvum in their feces (Sturdee et al., 1999). Cryptosporidium was found in seven species for which it is the first finding in Britain (Sorex araneus, S. minutus, Erinaceus europaeus, Dama dama, Muntiacus reevesi, Meles meles and Vulpes vulpes) and confirmed the rabbit Oryctolagus cuniculus as a host (Sturdee et al., 1999).
-
White-toothed shrew
(Website 72):
-
GenBank Taxonomy No.:
36802
-
Scientific Name:
Crocidura russula (Website 72)
-
Description:
Five rodent and two insectivore species were investigated for Cryptosporidium at seven sites in north-eastern Spain. Of the 442 animals studied, 82 Apodemus sylvaticus, 1 A. flavicollis, 5 Mus spretus, 1 Rattus rattus, 8 Clethrionomys glareolus and 13 Crocidura russula were infected with only C. parvum (Torres et al., 2000).
-
Eurasian pygmy shrew
(Website 73):
-
GenBank Taxonomy No.:
62280
-
Scientific Name:
Sorex minutus (Website 73)
-
Description:
Although specimen collection was done on a casual basis, this work has shown for the first time that hedgehogs, shrews, fallow and muntjac deer, badgers and foxes can shed C. parvum in their feces (Sturdee et al., 1999). Cryptosporidium was found in seven species for which it is the first finding in Britain (Sorex araneus, S. minutus, Erinaceus europaeus, Dama dama, Muntiacus reevesi, Meles meles and Vulpes vulpes) and confirmed the rabbit Oryctolagus cuniculus as a host (Sturdee et al., 1999).
-
Lagomorpha
(Website 74):
-
GenBank Taxonomy No.:
9975
-
Scientific Name:
Lagomorpha (Website 74)
-
Description:
Cryptosporidium parvum and C. parvum-like oocysts have been reported from the following members of the Order Lagomorpha: Oryctolagus cuniculus (rabbit) and Sylvilagus floridanus (cottontail) (Fayer et al., 2000).
-
Rabbit
(Website 11):
-
GenBank Taxonomy No.:
9986
-
Scientific Name:
Oryctolagus cuniculus (Website 11)
-
Description:
Cryptosporidium was reported in a healthy rabbit from Washington DC in 1979 and was named C. cuniculus only because cryptosporidia were considered to be host specific at that time. Retrospectively, C. cuniculus is synonymous with C. parvum. Since that time, cryptosporidiosis has been reported in laboratory-raised and farmed rabbits in the U.S., Belgium, and Germany, in laboratory and wild rabbits in Brazil, and in a wild cottontail rabbit (S. floridanus). Prevalence in rabbits is unknown (Fayer et al., 1997).
Cryptosporidium parvum was found in seven species for which it is the first finding in Britain (Sorex araneus, S. minutus, Erinaceus europaeus, Dama dama, Muntiacus reevesi, Meles meles and Vulpes vulpes) and confirmed the rabbit Oryctolagus cuniculus as a host (Sturdee et al., 1999).
-
Cottontail rabbit
(Website 12):
-
GenBank Taxonomy No.:
9988
-
Scientific Name:
Sylvilagus floridanus (Website 12)
-
Description:
Cryptosporidium was reported in a healthy rabbit from Washington DC in 1979 and was named C. cuniculus only because cryptosporidia were considered to be host specific at that time. Retrospectively, C. cuniculus is synonymous with C. parvum. Since that time, cryptosporidiosis has been reported in laboratory-raised and farmed rabbits in the U.S., Belgium, and Germany, in laboratory and wild rabbits in Brazil, and in a wild cottontail rabbit (S. floridanus). Prevalence in rabbits is unknown (Fayer et al., 1997).
-
Marsupials
(Website 75):
-
GenBank Taxonomy No.:
9263
-
Scientific Name:
Metatheria (Website 75)
-
Description:
Cryptosporidium parvum and C. parvum-like oocysts have been reported from the following members of the Order Metatheria: Antechinus stuartii (brown antechinus), Didelphis virginiana (Opposum), Isodon obesulus (southern brown bandicoot), Macropus giganteus (eastern grey kangaroo), Macropus rufogriseus (red neck wallaby), Macropus rufus (red kangaroo), Phascolarctos cinereus (koala), Thylogale billardierii (pademelon), and Trichosurus vulpecula (brushtail possum) (Fayer et al., 2000).
-
North American opossum
(Website 76):
-
GenBank Taxonomy No.:
9267
-
Scientific Name:
Didelphis virginiana (Website 76)
-
Description:
Five nursing opossums (Didelphis virginiana) were each inoculated with 5 x 10(6) Cryptosporidium parvum oocysts of calf origin. Following inoculation, endogenous stages of C. parvum were observed in the ileum, cecum, and colon of these opossums. Two of three noninoculated pouch mates acquired infections during the study based on examinations of feces and tissue sections of all eight opossums. Mild diarrhea was observed in four of seven opossums harboring C. parvum, although none died as a result of the infection. Under the conditions of this study, C. parvum appeared to be only mildly pathogenic for opossums (Lindsay et al., 1988).
-
Odd-toed ungulates
(Website 77):
-
GenBank Taxonomy No.:
9787
-
Scientific Name:
Perissodactyla (Website 77)
-
Description:
Cryptosporidium parvum and C. parvum-like oocysts have been reported from the following members of the Order Perissodactyla: Cerathotherium simum (southern white rhinoceros), Equus caballus (horse), Equus przewalski (miniature horse), Equus zebra (zebra), Rhinoceros unicornis (rhinoceros), Tapirus terrestris (Brazilian tapir) (Fayer et al., 2000).
-
Ceratotherium simum simum
(Website 78):
-
GenBank Taxonomy No.:
73337
-
Scientific Name:
Ceratotherium simum simum (Website 78)
-
Description:
Oocysts of Cryptosporidium were present in three ungulate species that are known hosts of this parasite (Connochaetes taurinus taurinus, Giraffa camelopardalis, and Ceratotherium simum simum). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Horse
(Website 7):
-
GenBank Taxonomy No.:
9796
-
Scientific Name:
Equus caballus (Website 7)
-
Description:
The first review article that addressed cryptosporidiosis in equines indicated that data were sparse. Presently, little more is known. Clinical cryptosporidiosis in horses, first reported in immunodeficient Arabian foals in the U.S. and then Australia, later was reported in immunodeficient Thoroughbred foals in the U.S., and a year later it was reported in an immunodeficient Arabian foal in the U.K. These early reports and the absence of any reports of cryptosporidiosis in other horses suggested that only immunodeficient horses became infected. But when antibodies against the parasite were found in 91% of 22 immunologically normal horses in Scotland and then the parasite was found in feces from normal foals in Louisiana, Illinois, Canada, France, Spain, Italy and Iceland, it became apparent that all horses worldwide were susceptible to infection. In reports that provided a detailed description of the parasite, the only named species with supporting characteristics was C. parvum (Fayer et al., 1997).
-
Brazilian tapir
(Website 79):
-
GenBank Taxonomy No.:
9801
-
Scientific Name:
Tapirus terrestris (Website 79)
-
Description:
17 species previously found to be negative became infected (Bison bison, Bison bonasus, Bos taurus frontalis, Boselaphus tragocamelus, Oryx dammae, Ovis musimon, Tragelaphus eurycerus, Camelus bactrianus, Camelus dromedaries, Lama guanicoe, Cervus dama, Cervus elaphus canadiensis, Cervus unicolor, Hexaprotodom liberiensis, Tayassu tajacu, Tapirus terrestris, and Loxodonta africana). On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Proboscidea
(Website 80):
-
GenBank Taxonomy No.:
9779
-
Scientific Name:
Proboscidea (Website 80)
-
Description:
Cryptosporidium parvum and C. parvum-like oocysts have been reported from the following members of the Order Proboscidea: Elephas maximus (Indian elephant) and Loxodonta africana (African elephant) (Fayer et al., 2000).
-
African savanna elephant
(Website 81):
-
GenBank Taxonomy No.:
9785
-
Scientific Name:
Loxodonta africana (Website 81)
-
Description:
17 species previously found to be negative became infected (Bison bison, Bison bonasus, Bos taurus frontalis, Boselaphus tragocamelus, Oryx dammae, Ovis musimon, Tragelaphus eurycerus, Camelus bactrianus, Camelus dromedaries, Lama guanicoe, Cervus dama, Cervus elaphus canadiensis, Cervus unicolor, Hexaprotodom liberiensis, Tayassu tajacu, Tapirus terrestris, and Loxodonta africana. On average, 100 fields of each fecal smear were inspected using light microscopy. Stained oocysts were detected at x400 magnification and confirmed at x1000 magnification. The size of detected oocysts averaged 4.5 um (4-5 um). It seems reasonable to consider them as Cryptosporidium parvum (Gomez et al., 2000).
-
Rodents
(Website 82):
-
GenBank Taxonomy No.:
9989
-
Scientific Name:
Rodentia (Website 82)
-
Description:
Cryptosporidium parvum and C. parvum-like oocysts have been reported from the following members of the Order Rodentia: Apodemus agrarius (field mouse), Apodemus flavicollis (field mouse), Apodemus sylvaticus (field mouse), Castor canadensis (beaver), Castor fiber (European beaver), Cavia porcellus (guinea pig), Chinchilla laniger (chinchilla), Cleithrionomys glareolus (red-backed vole), Geomys bursarius (pocket gopher), Glaucomys volans (flying squirrel), Hystrix indica (Indian porcupine), Marmota monax (woodchuck), Mesocricetus auratus (golden hamster), Microtus agrestis (field vole), Microtus arvalis (Orkney vole), Mus musculus (house mouse), Myocastor coypus (coypu), Ondatra zibethicus (muskrat), Rattus norvegicus (Norwegian rat), Rattus rattus (house rat), Sciurus carolinensis (grey squirrel), Sciurus niger (fox squirrel), Sigmodon hispidus (cotton rat), Spermophilus tridecemlineatus (13-lined ground squirrel), Tamias sibiricus (Siberian chipmunk), and Tamias striatus (chipmunk) (Fayer et al., 2000).
-
Yellow-necked field mouse
(Website 83):
-
GenBank Taxonomy No.:
54292
-
Scientific Name:
Apodemus flavicollis (Website 83)
-
Description:
Five rodent and two insectivore species were investigated for Cryptosporidium at seven sites in north-eastern Spain. Of the 442 animals studied, 82 Apodemus sylvaticus, 1 A. flavicollis, 5 Mus spretus, 1 Rattus rattus, 8 Clethrionomys glareolus and 13 Crocidura russula were infected with only C. parvum. Eleven A. sylvaticus and 2 C. glareolus were infected with only C. muris and 16 A. sylvaticus, 1 M. spretus and 2 C. glareolus showed mixed infections. Both cryptosporidial species were found in most study areas. No causal relationship was found between intrinsic host factors (age and sex) and the parasitic prevalence in the most captured host species (A. sylvaticus and C. russula). Extrinsic factors such as collection site of host, seasonality and covering vegetation exerted different influence on the prevalence of Cryptosporidium. Small mammals could become one of the most important sources of cryptosporidial oocysts in those areas where neither farm animals nor significant human activity are present (Torres et al., 2000).
-
European woodmouse
(Website 84):
-
GenBank Taxonomy No.:
10129
-
Scientific Name:
Apodemus sylvaticus (Website 84)
-
Description:
Five rodent and two insectivore species were investigated for Cryptosporidium at seven sites in north-eastern Spain. Of the 442 animals studied, 82 Apodemus sylvaticus, 1 A. flavicollis, 5 Mus spretus, 1 Rattus rattus, 8 Clethrionomys glareolus and 13 Crocidura russula were infected with only C. parvum. Eleven A. sylvaticus and 2 C. glareolus were infected with only C. muris and 16 A. sylvaticus, 1 M. spretus and 2 C. glareolus showed mixed infections. Both cryptosporidial species were found in most study areas. No causal relationship was found between intrinsic host factors (age and sex) and the parasitic prevalence in the most captured host species (A. sylvaticus and C. russula). Extrinsic factors such as collection site of host, seasonality and covering vegetation exerted different influence on the prevalence of Cryptosporidium. Small mammals could become one of the most important sources of cryptosporidial oocysts in those areas where neither farm animals nor significant human activity are present (Torres et al., 2000).
-
Bank vole
(Website 85):
-
GenBank Taxonomy No.:
51090
-
Scientific Name:
Clethrionomys glareolus (Website 85)
-
Description:
Five rodent and two insectivore species were investigated for Cryptosporidium at seven sites in north-eastern Spain. Of the 442 animals studied, 82 Apodemus sylvaticus, 1 A. flavicollis, 5 Mus spretus, 1 Rattus rattus, 8 Clethrionomys glareolus and 13 Crocidura russula were infected with only C. parvum. Eleven A. sylvaticus and 2 C. glareolus were infected with only C. muris and 16 A. sylvaticus, 1 M. spretus and 2 C. glareolus showed mixed infections. Both cryptosporidial species were found in most study areas. No causal relationship was found between intrinsic host factors (age and sex) and the parasitic prevalence in the most captured host species (A. sylvaticus and C. russula). Extrinsic factors such as collection site of host, seasonality and covering vegetation exerted different influence on the prevalence of Cryptosporidium. Small mammals could become one of the most important sources of cryptosporidial oocysts in those areas where neither farm animals nor significant human activity are present (Torres et al., 2000).
-
Golden hamster
(Website 15):
-
GenBank Taxonomy No.:
10036
-
Scientific Name:
Mesocricetus auratus (Website 15)
-
Description:
Young (8-12 weeks) and aged (20-24 months) Syrian golden hamsters were intragastrically inoculated with Cryptosporidium parvum oocysts to compare the susceptibility to cryptosporidiosis between these two age groups. Oocyst shedding was significantly more intense in the aged than in the young hamsters. Moreover, parasite colonization of the small intestine was observed in the aged but not the young hamsters. Splenocytes from aged hamsters exhibited significantly lower T, B, and natural killer cell activities than did those from young hamsters. These studies suggest that susceptibility to cryptosporidial infections may be greater in aged individuals than has been previously realized (Rasmussen and Healey, 1992).
-
Common vole
(Website 86):
-
GenBank Taxonomy No.:
47230
-
Scientific Name:
Microtus arvalis (Website 86)
-
Description:
C. parvum showed a slightly higher prevalence and overall abundance in M. arvalis compared with C. glareolus, but both parameters were considerably lower in A. flavicollis (Bajer et al., 2002).
-
Western European house mouse
(Website 87):
-
GenBank Taxonomy No.:
10092
-
Scientific Name:
Mus musculus domesticus or Mus domesticus (Website 87)
-
Description:
Mice (M. musculus syn. domesticus) from different geographical areas were shown to carry a distinct genotype of C. parvum (referred to as the "mouse" genotype) by both rDNA and acetyl-CoA synthetase gene sequence analyses, indicating that this genotype is conserved across widely separated geographical areas. The "mouse" genotype was also identified in a fecal sample from a large-footed mouse-eared bat (Myotis adversus), extending the host range of this genotype (Morgan et al., 1999).
Wild mice and voles were tested for Cryptosporidium during a 2-year survey at an agricultural site in Warwickshire, United Kingdom. C. parvum and C. muris, the two cryptosporidial species known to infect mammals, were detected. Prevalence figures of 22%, 21% and 13% noted for C. parvum for Mus domesticus, Apodemus sylvaticus and Clethrionomys glareolus, respectively, were higher than those recorded for C. muris at 10%, 6% and 2%. C. parvum causes the sometimes severe diarrhoeal disease cryptosporidiosis in many hosts, but the wild rodents were asymptomatic. Rodents may represent a significant reservoir of Cryptosporidium with a high potential for infection of man and livestock due to cohabitation (Chalmers et al., 1997).
-
Wild western mouse
(Website 88):
-
GenBank Taxonomy No.:
10096
-
Scientific Name:
Mus spretus (Website 88)
-
Description:
Five rodent and two insectivore species were investigated for Cryptosporidium at seven sites in north-eastern Spain. Of the 442 animals studied, 82 Apodemus sylvaticus, 1 A. flavicollis, 5 Mus spretus, 1 Rattus rattus, 8 Clethrionomys glareolus and 13 Crocidura russula were infected with only C. parvum. Eleven A. sylvaticus and 2 C. glareolus were infected with only C. muris and 16 A. sylvaticus, 1 M. spretus and 2 C. glareolus showed mixed infections. Both cryptosporidial species were found in most study areas. No causal relationship was found between intrinsic host factors (age and sex) and the parasitic prevalence in the most captured host species (A. sylvaticus and C. russula). Extrinsic factors such as collection site of host, seasonality and covering vegetation exerted different influence on the prevalence of Cryptosporidium. Small mammals could become one of the most important sources of cryptosporidial oocysts in those areas where neither farm animals nor significant human activity are present (Torres et al., 2000).
-
Norway rat
(Website 13):
-
GenBank Taxonomy No.:
10116
-
Scientific Name:
Rattus norvegicus (Website 13)
-
Description:
The potential of Norway rats (Rattus norvegicus) to spread the parasite Cryptosporidium parvum was investigated by examining parasite prevalence in relation to the structure and movements of three permanent rat populations living on farmland in Warwickshire (UK) from October 1994 to March 1997. One population lived among a group of farm buildings housing cattle, while the other two had no contact with livestock, one living around a pond and its outflowing stream and the other on a rubbish tip. Overall, parasite occurrence was 24%, but it varied according to body weight (age) with 40% of juveniles (less than or equal to 100 g) infected decreasing to 12% for adults greater than 400 g, suggesting that actively breeding populations are potentially more likely to spread the parasite than non-breeding populations. There was no difference in prevalence between the three populations. The parasite was detected in more males (29%) than females (19%). Seasonally, on the livestock farm, prevalence was significantly lower in autumn (10%), but varied little (31-36%) from winter to summer. In contrast, on the arable farm, prevalence peaked in summer (50%) with a trough in winter (6%). Infection in rats appeared to last less than 67 days. Rats living on the livestock farm had home ranges largely confined to the cattle sheds, thereby maintaining a potential source of infection for livestock if rodent control was not part of a decontamination program. Equally, rats living around the pond on the arable farm provided a source of oocysts to contaminate the pond water, as well as being able to carry the parasite to nearby farm buildings or even to neighboring farms (Quy et al., 1999).
-
Black rat
(Website 14):
-
GenBank Taxonomy No.:
10117
-
Scientific Name:
Rattus rattus (Website 14)
-
Description:
Five rodent and two insectivore species were investigated for Cryptosporidium at seven sites in north-eastern Spain. Of the 442 animals studied, 82 Apodemus sylvaticus, 1 A. flavicollis, 5 Mus spretus, 1 Rattus rattus, 8 Clethrionomys glareolus and 13 Crocidura russula were infected with only C. parvum (Torres et al., 2000).
-
Muskrat
(Website 89):
-
GenBank Taxonomy No.:
10060
-
Scientific Name:
Ondatra zibethicus (Website 89)
-
Description:
Southern analysis revealed 22 fecal samples containing Cryptosporidium small-subunit (SSU) ribosomal DNA; these included 10 of 91 white-tailed deer (Odocoileus virginianus) samples, 3 of 5 chipmunk (Tamias striatus) samples, 1 of 2 white-footed mouse (Peromyscus leucopus) samples, 1 of 2 striped skunk (Mephitis mephitis) samples, 1 of 5 racoon (Procyon lotor) samples, and 6 of 6 muskrat (Ondatra zibethicus) samples. All of the 15 SSU PCR products sequenced were characterized as Cryptosporidium parvum (Perz and Le Blancq, 2001).
-
White-footed mouse
(Website 90):
-
GenBank Taxonomy No.:
10041
-
Scientific Name:
Peromyscus leucopus (Website 90)
-
Description:
Southern analysis revealed 22 fecal samples containing Cryptosporidium small-subunit (SSU) ribosomal DNA; these included 10 of 91 white-tailed deer (Odocoileus virginianus) samples, 3 of 5 chipmunk (Tamias striatus) samples, 1 of 2 white-footed mouse (Peromyscus leucopus) samples, 1 of 2 striped skunk (Mephitis mephitis) samples, 1 of 5 racoon (Procyon lotor) samples, and 6 of 6 muskrat (Ondatra zibethicus) samples. All of the 15 SSU PCR products sequenced were characterized as Cryptosporidium parvum (Perz and Le Blancq, 2001).
-
Grey squirrel
(Website 91):
-
GenBank Taxonomy No.:
30640
-
Scientific Name:
Sciurus carolinensis (Website 91)
-
Description:
C. parvum has been recorded from 152 species of mammals. Among the genus Sciurus it was previously reported in S. carolinensis and S. niger. In rodents, C. parvum infects the small intestine causing cryptosporidiosis but is generally asymptomatic (Bertolino et al., 2003).
-
Fox squirrel
(Website 92):
-
GenBank Taxonomy No.:
34861
-
Scientific Name:
Sciurus niger (Website 92)
-
Description:
C. parvum has been recorded from 152 species of mammals. Among the genus Sciurus it was previously reported in S. carolinensis and S. niger. In rodents, C. parvum infects the small intestine causing cryptosporidiosis but is generally asymptomatic (Bertolino et al., 2003).
-
Eurasian red squirrel
(Website 93):
-
GenBank Taxonomy No.:
55149
-
Scientific Name:
Sciurus vulgaris (Website 93)
-
Description:
Cryptosporidium parvum was detected for the first time in the red squirrel (Sciurus vulgaris) during this study. Cryptosporidium is an obligate, intracellular protozoan parasite that invades the respiratory and gastro-intestinal tracts of vertebrate hosts. The life cycle is completed in a single host and results in the production of oocysts (containing the infective sporozoites) that pass into the feces and into the environment. Researchers recognize ten valid species of Cryptosporidium, but probably other cryptic species are still confused with those presently described. Two species infect small mammals: C. parvum which causes the diarrhoeal disease cryptosporidiosis that could be debilitating for animals and humans and C. muris the pathogenicity of which is not fully understood. C. parvum has been recorded from 152 species of mammals. Among the genus Sciurus it was previously reported in S. carolinensis and S. niger. In rodents, C. parvum infects the small intestine causing cryptosporidiosis but is generally asymptomatic (Bertolino et al., 2003).
-
California ground squirrel
(Website 94):
-
GenBank Taxonomy No.:
34862
-
Scientific Name:
Spermophilus beecheyi (Website 94)
-
Description:
Sixteen percent of California ground squirrels (Spermophilus beecheyi) were found to be shedding an average of 53,875 Cryptosporidium parvum oocysts/g of feces. Male squirrels had a higher prevalence and higher intensity of shedding than did female squirrels. The majority of C. parvum isolates matched a bovine-murine genotype, with a few isolates resembling a porcine genotype. Higher intensities of shedding by males may enhance dissemination and genotypic mixing of this protozoa given males' proclivity to disperse to nonnatal colonies (Atwill et al., 2001).
-
Siberian chipmunk
(Website 95):
-
GenBank Taxonomy No.:
64680
-
Scientific Name:
Tamias sibiricus (Website 95)
-
Description:
We isolated Cryptosporidium parvum-type oocysts from naturally infected siberian chipmunks (Tamias sibiricus) which originated in the People's Republic of China and examined the infectivity to rodents as experimental animals. The naturally infected chipmunks did not show any clinical symptoms. The oocysts were 4.8 x 4.2 micron on average in size. They were ovoid and morphologically similar to the C. parvum oocysts isolated from human and cattle. Experimental rodents were inoculated with 1.6 x 10(6) original oocysts each. SCID mice began to shed oocysts on day 7 and the OPG value was 10(5) from 50 days. The oocysts were found from ICR mice on days 13 and 16 by only sugar flotation method, however, any oocysts were not detected from the rats, guinea pigs and rabbits until 30 days. Two infected SCID mice were necropsied on days 100 and 102 and examined for coccidian organisms. Merozoites and oocysts were found in the low part of jejunum and ileum, however, no parasites were detected in the stomach. Consequently, it was considered that the present species was C. parvum and was probably genotype 2 from result of infectivity to rodents (Matsui et al., 2000).
-
Eastern chipmunk
(Website 96):
-
GenBank Taxonomy No.:
45474
-
Scientific Name:
Tamias striatus (Website 96)
-
Description:
Southern analysis revealed 22 fecal samples containing Cryptosporidium small-subunit (SSU) ribosomal DNA; these included 10 of 91 white-tailed deer (Odocoileus virginianus) samples, 3 of 5 chipmunk (Tamias striatus) samples, 1 of 2 white-footed mouse (Peromyscus leucopus) samples, 1 of 2 striped skunk (Mephitis mephitis) samples, 1 of 5 racoon (Procyon lotor) samples, and 6 of 6 muskrat (Ondatra zibethicus) samples. All of the 15 SSU PCR products sequenced were characterized as Cryptosporidium parvum (Perz and Le Blancq, 2001).
-
Sirenia
(Website 97):
-
GenBank Taxonomy No.:
9774
-
Scientific Name:
Sirenia (Website 97)
-
Description:
Cryptosporidium parvum and C. parvum-like oocysts have been reported from the following members of the Order Sirenia: Dugong dugon (dugong) (Fayer et al., 2000).
-
Dugong
(Website 98):
-
GenBank Taxonomy No.:
29137
-
Scientific Name:
Dugong dugon (Website 98)
-
Description:
The Cryptosporidium "human" genotype was identified in a paraffin-embedded tissue section from a dugong (Dugong dugon) by 2 independent laboratories. DNA sequencing and polymerase chain reaction/restriction fragment length polymorphism analysis of the 18S ribosomal RNA gene and the acetyl CoA synthethase gene clearly identified the genotype as that of the Cryptosporidium variant that infects humans. This is the first report of the human Cryptosporidium genotype in a nonprimate host (Morgan et al., 2000).
-
Infection Process:
No infection process information is currently available here.
-
Disease Information:
No disease information is currently available here.
-
Prevention:
No prevention information is currently available here.
-
Model System:
No model system information is currently available here.
IV. Labwork Information
A. Biosafety Information:
-
Biosafety information for
:
Cryptosporidium parvum
:
-
Biosafety Level: 2
-
Precautions:
-
Biosafety Level 2 practices and facilities are recommended for activities with infective stages of the parasites listed. Primary containment (e.g., biological safety cabinet) or personal protection (e.g., face shield) may be indicated when working with cultures of Naegleria fowleri, or Cryptosporidium (Website 104).
B. Culturing Information:
-
Culture in Different Host Cells
:
-
Description:
The most successful host cells used to study C. parvum are epithelial-like. These include human colonic adenocarcinoma (Caco-2), human endometrial carcinoma (RL95-2), galactose-adapted human colonic carcinoma (HT29.74), human ileocaecal adenocarcinoma (HCT-8), and Madin-Darby canine kidney (MDCK). When development of C. parvum was compared in 11 different host cells, it was concluded that the yield of parasites in HCT-8 cells was superior to all other cells based on counts of live parasites grown in monolayers on coverslips. Both Caco-2 and MDCK cells are more delicate than HCT-8 cells, however, and host cells as well as parasites are easily disrupted when coverslips are inverted onto microscope slides, compromising observation and counting. MCDK cells were found superior to other cells in a similar study. Nevertheless, these studies demonstrate that one of the most important factors determining successful in vitro cultivation of C. parvum is the choice of host cell (Upton, 1997).
-
Medium:
-
N-[2-hydroxyethyl]peperazine-N'[2-ethanesulfonic acid] (HEPES), the most commonly used buffer for in vitro cultivation of coccidia, has a pKa of 7.5 at 25 degrees celcius and useful buffering in a pH range of 6.8 to 8.2. When cultures of host cells are placed in a CO2 incubator, the pH falls well into the acidic range. Because C. parvum sporozoites are most infective in a pH range of 7.2 to 7.6, other types of biological buffers may prove more useful. Considering that Plasmodium spp gametocyte emergence and exflagellation can be induced by increasing the pH to 7.7 - 8.0 or by ion exchange mechanisms, the reason that so few C. parvum oocysts are generated in vitro may, in part, reflect microgamete inactivity at suboptimal pH (Upton, 1997).
A medium was formulated that enhanced the numbers of C. parvum in vitro tenfold. This formula consisted of RPMI 1640 containing L-glutamate, supplemented with an additional 2mM L-glutamine, 15 mM HEPES buffer, 50 mM glucose, 35 ug/ml Asorbic acid, 4.0 ug/ml para-aminobenzoic acid, 2.0 ug/ml calcium pantothenate, and 1.0 ug/ml folic acid. After adjusting the pH to 7.4 and filter sterilizing the mixture, fetal bovine serum (FBS) was added to a concentration of 10%. Insulin and antibiotics were eliminated, however, 100 U/ml penicillin, 100 ug;/ml streptomycin, and 0.25 ug/ml amphotericin B can be used, if desired. Macrolides at high concentrations must be avoided as they inhibit C. parvum development in vitro (Upton, 1997).
-
Optimal pH:
Both pH and extracellular ions significantly effect motility and penetration of host cells by Coccidian sporozoites. C. parvum sporozoites are most infective in a pH range of 7.2 to 7.6. Considering that Plasmodium spp gametocyte emergence and exflagellation can be induced by increasing the pH to 7.7 - 8.0 or by ion exchange mechanisms, the reason that so few C. parvum oocysts are generated in vitro may, in part, reflect microgamete inactivity at suboptimal pH (Upton, 1997).
-
doubling-time:
Parasite numbers reach a maximum approximately 48 to 72 h after inoculation. A general rule of thumb is that developing stage number will equal (or roughly double) the number of original oocysts or sporozoites in the inoculum (Arrowood, 2002).
-
Note:
Numbers of parasites used to infect cultures will greatly influence the final number of developmental stages. Generally lower parasite to host cell ratios result in proportionally higher levels of infection. An oocyst-to-host cell ratio of about 1:1 or 1:2 is generally optimal for C. parvum. A higher ratio should be employed for short-term binding assays (Upton, 1997).
Truly ideal and routine methods that support cryptosporidial development in vitro are not yet available. Methods that permit continuous development (as is routinely used with Toxoplasma spp.), efficient production of mature, infectious oocysts, and cryopreservation methods that would allow cloned stocks to be developed are missing. Consequently, primary isolates from clinical specimens are quite valuable for ongoing research studies (Arrowood, 2002).
C. Diagnostic Tests
:
-
Organism Detection Tests:
-
Differential Staining Methods:
-
Description:
Conventional detection methods include concentration and staining of fecal smears. Differential staining methods including safranin-methylene blue stain, Kinyoun, Ziehl-Neelsen and DMSO-carbol fuchsin stain oocysts red and counterstain the background. Differential staining, however, is time consuming and varies in sensitivity and specificity. Fluorochrome stains, although sensitive, are complex and oocyst-like structures in fecal debris often take up the stain. Negative staining techniques with nigrosin, light green, merbromide and malachite green stain background yeasts and bacteria but not oocysts. Many of these stains require an experienced microscopist, however, and are labor-intensive (Fayer et al., 2000).
The "gold standard" and perhaps most widely used test for the detection of Cryptosporidium oocysts in stool remains the modified acid-fast or Kinyoun stain. The test should be specifically requested, because it will not be performed as part of a routine examination for ova and parasites. Interpretation of the stained smear requires experience, because other organisms in the stool may stain acid fast (Leav et al., 2003).
Conventionally, diagnosis is made by concentration of stools followed by acid-fast staining (AF) or immunofluorescent staining. The threshold of detection in human stool specimens by these methods may require the presence of 50,000 (immunofluorescent staining) to 500,000 (AF) oocysts per g of stool (Balatbat et al., 1996).
-
Indirect Immunofluorescent Assays:
-
Description:
Immunologic techniques for the detection of cryptosporidia in stool specimens were introduced in 1985 and 1986. Indirect immunofluorescent assays were described for the detection of oocysts employing convalescent human serum and oocyst-immunized rabbit antiserum. Innumofluorescent assays employing oocyst-reactive monoclonal antibodies were also introduced. The immunofluorescent methodologies showed significantly increased sensitivities and specificities compared to conventional staining techniques and have found widespread application in research and clinical laboratories, as well as for monitoring oocyst presence in environmental samples. The assays generally work well with fresh or preserved stools (formalin, potassium dichromate), but some fixatives can cause problems (e.g. MIF) (Arrowood, 1997).
Immunofluorescence assays demonstrating cryptosporidial life-cycle stages (e.g. oocysts) in infected tissues or biopsy specimens have been reported and can be performed using reagents available in commercial diagnostic kits. These immuno histological assays are primarily of research value, given the broad availability of stool-based diagnostic assays and the ready identification of Cryptosporidium in tissue sections (cryptosporidia are uniquely found on the lumenal surface of epithelial cells and are apparent in specimens stained with hematoxylin and eosin or other routine histology stains (Arrowood, 1997).
Several immunofluorescent assays and EIA kits have become commercially available and show promising sensitivity and specificity. These tests use antibodies against Cryptosporidium antigens to detect the parasite in stool specimens. One of these kits, the ColorPAC Cryptosporidium/Giardia rapid assay (Becton-Dickinson), was recently recalled because of a cluster of false-positive results (Leav et al., 2003).
-
Direct Fluorescent Antibody:
-
Description:
Direct Fluorescent antibody. The most widely used antigen detection immunoassays for Giardia and Cryptosporidium are the direct fluorescent-antibody (DFA) tests, which detect intact organisms, and enzyme immunoassays (EIAs), which detect soluble stool antigen. DFA tests utilize fluorescein-labeled antibodies directed against cell wall antigens of Giardia cysts and Cryptosporidium oocysts and allow visualization of the intact parasites, providing a definitive diagnosis. The sensitivity and specificity of the most commonly used commercial DFA test, the MERIFLUOR DFA test, have been reported to be 96 to 100% and 99.8 to 100%, respectively, for both Giardia and Cryptosporidium. This test has a greater sensitivity than traditional examination of permanent smears for Giardia and a sensitivity equal to or greater than that of traditional examination of permanent smears prepared from concentrated stool specimens for Cryptosporidium (Johnston et al., 2003).
-
Oocyst concentration:
-
Description:
The flotation-concentration method by Sheather was found to provide the best results of all selected methods. The merthiolate iodine formaldehyde concentration (MIFC) method was the least specific one. The least suitable method concerning sensitivity and costs was the flotation method with caesium chloride (CsCl) with a specificity of 29% (Kvac et al., 2003).
Only Sheather's method detected all samples as positive (Kvac et al., 2003).
-
Immunoassay Tests:
-
Antigen-capture ELISA:
-
Description:
The diagnosis of the small (4- to 6-microns) Cryptosporidium oocysts is labor intensive and relies on stool concentration, with subsequent staining and microscopy. The primary purpose of this study was to evaluate the clinical utility of an antigen capture enzyme-linked immunosorbent assay (ELISA) in detecting Cryptosporidium oocysts in human stools. A total of 591 specimens (76 diarrheal, 515 control) obtained from 213 inhabitants of an urban slum in northeastern Brazil were examined by both ELISA and conventional microscopic examination (CME) of formalin-ethyl acetate- concentrated stool samples stained with modified acid-fast and auramine stains. Forty-eight diarrheal stools (63.2%) were positive for Cryptosporidium oocysts by CME, with 40 of these positive by ELISA. Thirty-five control stools (6.8%) had Cryptosporidium oocysts detected by CME, with 15 of these also positive by ELISA. All of the 480 nondiarrheal stools and all but one of the diarrheal stools negative by CME were negative by ELISA. The test had an overall sensitivity of 66.3% and a specificity of 99.8% (positive predictive value, 98.2%; negative predictive value, 94.8%). In the evaluation of human diarrheal stool samples, the test sensitivity increased to 83.3%, with a specificity of 96.4%, and, in analysis of samples from individual patients with diarrhea, the sensitivity was 87.9%, with a specificity of 100%. These results indicate that this stool ELISA is sensitive and specific for the detection of Cryptosporidium oocysts in human diarrheal stool specimens but has limited use in epidemiologic studies for the diagnosis of asymptomatic Cryptosporidium infection (Newman et al., 1993).
-
False Positive:
We evaluated a commercially produced enzyme-linked immunosorbent assay (ELISA; LMD Laboratories, Inc.) for the detection of Cryptosporidium spp. in 296 stool specimens submitted to the Mayo Clinic parasitology laboratory for routine examination. Eight ELISA false negatives and one false positive were observed (Rosenblatt and Sloan, 1993).
-
False Negative:
We evaluated a commercially produced enzyme-linked immunosorbent assay (ELISA; LMD Laboratories, Inc.) for the detection of Cryptosporidium spp. in 296 stool specimens submitted to the Mayo Clinic parasitology laboratory for routine examination. Eight ELISA false negatives and one false positive were observed (Rosenblatt and Sloan, 1993).
-
Enzyme immunoassays (EIAs):
-
Description:
The most widely used antigen detection immunoassays for Giardia and Cryptosporidium are the direct fluorescent-antibody (DFA) tests, which detect intact organisms, and enzyme immunoassays (EIAs), which detect soluble stool antigen (Johnston et al., 2003). Commercially available EIAs use antibodies for the qualitative detection of Giardia- and Cryptosporidium-specific antigens in preserved stool specimens. The reported sensitivities of EIAs range from 94 to 97% and specificities range from 99 to 100%. Advantages of the EIA are as follows: (i) numerous samples can be screened at one time, and tests can be read objectively on a spectrophotometer instead of subjectively on a fluorescence microscope. However, problems with false-positive and false-negative test results have been reported (Johnston et al., 2003).
-
False Positive:
62 false-positive results obtained with the Alexon ProSpecT Cryptosporidium enzyme immunoassay were deemed false-positive based on negative results obtained from extensive microscopic examinations (Doing et al., 1999).
-
Combination cassette format nonenzymatic rapid immunoassay for detection of Giardia and Cryptosporidium antigens :
-
Time to Perform:
minutes-to-1-hour
-
Description:
For Cryptosporidium, the detection system consisted of an immobilized monoclonal capture antibody and a colloidal-carbon-labeled monoclonal detector antibody, both directed against oocyst antigens. The assay procedure involved the addition of 2 drops of sample treatment buffer to a tube, the pipeting of 60 microliters (ul) of stool specimen diluted in fixative or transport medium into the tube, the addition of 2 drops of a Giardia capture antibody conjugate, and the addition of 2 drops of a colloidal-carbon-conjugated detection reagent for Giardia and Cryptosporidium. After the sample was mixed, it was immediately poured into the test device. Assay results were read after 10 min. Positive results were visualized as grey-black lines in the appropriate position in the results window. Samples showing discrepancies between microscopy and the rapid assay were analyzed using microplate EIAs for Giardia and Cryptosporidium (Chan et al., 2000).
-
False Positive:
The six Cryptosporidium false-positive samples came from two patients, indicating that the positive rapid assay results were reproducible across specimens from the same individuals. Testing of these samples using the Cryptosporidium microplate EIA showed them all to be Cryptosporidium negative, as did reexamination of the microscopy slides (Chan et al., 2000).
-
ImmunoCard STAT! Cryptosporidium/Giardia rapid assay (Meridian Bioscience, Inc.):
-
Time to Perform:
minutes-to-1-hour
-
Description:
The ImmunoCard STAT! Cryptosporidium/Giardia rapid assay (Meridian Bioscience, Inc.) is a solid-phase qualitative immunochromatographic assay that detects and distinguishes between Giardia lamblia and Cryptosporidium parvum in aqueous extracts of human fecal specimens (fresh, frozen, unfixed, or fixed in 5 or 10% formalin or sodium acetate-acetic acid-formalin). By using specific antibodies, antigens specific for these organisms are isolated and immobilized on a substrate. After the addition of appropriate reagents, a positive test is detected visually by the presence of a gray-black color bar (regardless of the intensity) next to the organism name printed on the test device (Garcia et al., 2003). The assay can be performed in approximately 12 min on formalin-fixed (5 or 10% formalin or sodium acetate-acetic acid-formalin) or unfixed stool specimens (Garcia et al., 2003).
-
False Negative:
The one specimen false negative for C. parvum was confirmed to be positive by immunofluorescene (Garcia et al., 2003).
-
Immunochromatographic Dip-Strip Test for the Detection of Cryptosporidium Oocysts in Stool Specimens:
-
Time to Perform:
minutes-to-1-hour
-
Description:
In the Crypto-Strip immunochromatographic test, liquid sample migrates by capillary action up the test strip, first rehydrating a specific anti-Cryptosporidium, gold-conjugate, monoclonal mouse antibody and then reaching a nitrocellulose membrane. A first line in the membrane (detection line) presents anti-Cryptosporidium monoclonal antibodies. A second line (control line) displays anti-mouse-immunoglobulin antibodies. On reaching the second line, the remaining conjugate is blocked. Gold-conjugate antibody fixed on either line appears as a pink/purple color. In order to perform the test, approximately 50 mg of stool sample is added to a tube containing 0.5 ml of a dilution buffer provided with the kit. After mixing and waiting for 1-2 min, one test strip is dipped into the stool suspension for 5-10 min at room temperature before being read (Llorente et al., 2002).
-
False Negative:
Forty-nine of the 50 known positive samples tested positive with the Crypto-Strip test, whereas all 25 negative samples tested negative (Llorente et al., 2002).
-
EIA. ColorPAC Giardia/Cryptosporidium rapid assay and ProSpecT Giardia/Cryptosporidium microplate assay for detection of Giardia and Cryptosporidium in fecal specimens:
-
Time to Perform:
unknown
-
Description:
Detection of Giardia and Cryptosporidium in clinical stool specimens using the ColorPAC and ProSpecT enzyme immunoassays revealed 98.7% agreement for Giardia detection and 98.1% agreement for Cryptosporidium detection. Sensitivities were uniformly 100%. The specificities of the ColorPAC immunoassay for Giardia and Cryptosporidium detection were 100 and 99.5%, respectively, and those for the ProSpecT assay were 98.4 and 98.6%, respectively. The false-positive reactions with the ProSpecT assay occurred with specimens that were grossly bloody (Katanik et al., 2001).
-
False Positive:
There was one false positive for Cryptosporidium in the ColorPAC test, and 3 in the ProSpecT test (Katanik et al., 2001)
-
Nucleic Acid Detection Tests:
:
-
Nested PCR:
-
Description:
PCR assays have been introduced as a very sensitive method to detect pathogens in clinical specimens. This laborious technology requires experience and it still is too expensive for routine screening, but it may detect more cases of cryptosporidiosis. However, no standardized, simple and commercial protocol for extraction of Cryptosporidium DNA from feces has been published so far. Ubiquitous PCR inhibitors in fecal specimens can cause significant problems. We established two nested PCR assays targeting genes commonly used for PCR assays to detect Cryptosporidium spp. Although the COWP PCR targets a single copy gene it was as sensitive as the 18S rDNA targeting a five-copy sequence. The detection limit of our COWP nested PCR assay, i.e., 0.1 fg of cloned DNA and less than 25 oocysts per sample, is in accordance with detection limits reported for several nested PCR assays targeting either the same gene or the 18S rDNA. The sensitivity of the PCR assays to detect C. parvum in fecal samples was identical to the antigen EIA, which is known to be superior to non-immunofluorescence staining methods. A sensitivity of 97% of the nested PCR assays is in accordance with recently published data (Bialek et al., 2002).
-
Primers:
-
C. parvum 18S rDNA PCR (18S PCR) Outer primers
-
Forward:
Outer primer set CPr I (5'-AAA CCC CTT TAC AAG TAT CAA TTG GA-3') (Bialek et al., 2002)
-
Reverse:
Outer primer set CPr II (5'-TTC CTA TGT CTG GAC CTG GTG AGT T-3') (Bialek et al., 2002)
-
Product
-
Size: 676 bp sequence
-
Product GenBank Accession Number:
AF093492
-
C. parvum 18S rDNA PCR (18S PCR) Inner primers
-
Forward:
Inner primer set CPr III (5'-TGC TTA AAG CAG GCA TAT GCC TTG AA-3') (Bialek et al., 2002)
-
Reverse:
Inner primer set CPr IV (5'-AAC CTC CAA TCT CTA GTT GGC ATA GT-3') (Bialek et al., 2002)
-
Product
-
Size: 285 bp sequence
-
Product GenBank Accession Number:
AF093492
-
C. parvum oocyst wall protein PCR (COWP PCR) Outer primers
-
C. parvum oocyst wall protein PCR (COWP PCR) Inner primers
-
Forward:
Inner primer CP 3 (5'-CCT GGA TAT CTC GAC AAT GGA TCA G-3') (Bialek et al., 2002)
-
Reverse:
Inner primer CP 4 (5'- GCG AAC TAA TCG ATC TCT CTA CGC AA-3') (Bialek et al., 2002)
-
Product
-
TaqMan PCR:
-
Description:
We have developed a TaqMan polymerase chain reaction (PCR) test that accurately quantifies C. parvum oocysts in treated and untreated water samples. The protocol consisted of the following successive steps: Envirochek capsule filtration, immunomagnetic separation (IMS), thermal lysis followed by DNA purification using Nanosep centrifugal devices and, finally, real-time PCR using fluorescent TaqMan technology. Quantification was accomplished by comparing the fluorescence signals obtained from test samples with those from standard dilutions of C. parvum oocysts. This IMSreal-time PCR assay permits rapid and reliable quantification over six orders of magnitude, with a detection limit of five oocysts for purified oocyst solutions and eight oocysts for spiked water samples. Replicate samples of spiked tap water and Seine River water samples (with approximately 78 and 775 oocysts) were tested. C. parvum oocyst recoveries, which ranged from 47.4% to 99% and from 39.1% to 68.3%, respectively, were significantly higher and less variable than those reported using the traditional US Environmental Protection Agency (USEPA) method 1622. This new molecular method offers a rapid, sensitive and specific alternative for C. parvum oocyst quantification in water (Fontaine and Guillot, 2003).
-
Primers:
-
Pair of primers
-
Forward:
5'-CGCTTCTCTAGCCTTTCATGA-3' (Fontaine and Guillot, 2003)
-
Reverse:
5'-CTTCACGTGTGTTTGCCAAT-3' (Fontaine and Guillot, 2003)
-
Real-time-probe:
The fluorescent TaqMan probe (CCAATCACAGAATCATCAGAATCGACTGGTATC) was labeled at the 5'-end with the 6-carboxyfluorescein reporter dye and at the 3'-end with the 6-carboxy-tetramethylrhodamine quencher dye (Fontaine and Guillot, 2003)
-
Product
-
Size: 138-bp fragment
-
Product GenBank Accession Number:
AF188110
-
PCR using Frozen Fecal Material:
-
Description:
The polymerase chain reaction (PCR) offers one of the most sensitive methods for detecting Cryptosporidium parvum but its sensitivity in fecal material can be greatly reduced by a variety of poorly defined inhibitors'. Methods that separate the parasitic oocyst from fecal material prior to DNA extraction circumvent inhibitor interference but are problematic for frozen specimens since `intact' oocysts are required for separation. We report here a relatively low-cost, rapid method for extracting C. parvum DNA from frozen fecal materials that can be used in a PCR assay for detection of single parasitic oocysts (Ward and Wang, 2001).
-
Primers:
-
Pair of primers
-
Pair of primers
-
Nested PCR Directly from Stool Samples:
-
Description:
In this study, a nested PCR assay was developed to detect C. parvum DNA directly from stool specimens. After extraction of DNA from formalinized stool, a 400-bp fragment of C. parvum DNA was amplified with two 26-mer outer primers. The amplicon from this reaction was amplified with a second primer pair. With these nested primers, a 194-bp DNA fragment was amplified and confirmed as C. parvum DNA by internal probing with an enzyme-linked chemiluminescence system. This PCR-based test allowed the detection of 500 oocysts per g of stool or 100 ng of C. parvum DNA. Studies indicate that the primers utilized are specific for the DNA of C. parvum. DNA sequences were also detected in stool specimens from 4 of 28 patients previously reported negative by AF. In summary, a rapid, sensitive, and specific assay for the detection of C. parvum directly from stool specimens has been developed. This test has the potential for detecting asymptomatic infection, monitoring the response to therapy, and detecting the organism in environmental sources (Balatbat et al., 1996).
-
Primers:
-
Outer primers
-
Inner primers
-
PCR with RFLP Primers:
-
Description:
A micromanipulation method by which known numbers of C. parvum oocysts, even a single oocyst, can be delivered to a test matrix for detection sensitivity is presented. Using newly developed nested PCR-restriction fragment length polymorphism primers, PCR sensitivity was evaluated with 1, 2, 3, 4, 5, 7, or 10 oocysts. PCR detection rates (50 samples for each number of oocysts) ranged from 38% for single oocysts to 92% for 5 oocysts, while 10 oocysts were needed to achieve 100% detection. The nested PCR conditions amplified products from C. parvum, Cryptosporidium baileyi, and Cryptosporidium serpentis but no other Cryptosporidium sp. or protozoan tested. Restriction enzyme digestion with VspI distinguished between C. parvum genotypes 1 and 2. Restriction enzyme digestion with DraII distinguished C. parvum from C. baileyi and C. serpentis. Use of known numbers of whole oocysts encompasses the difficulty of liberating DNA from the oocyst and eliminates the standard deviation inherent within a dilution series. To our knowledge this is the first report in which singly isolated C. parvum oocysts were used to evaluate PCR sensitivity. This achievement illustrates that PCR amplification of a single oocyst is feasible, yet sensitivity remains an issue, thereby illustrating the difficulty of dealing with low oocyst numbers when working with environmental water samples (Sturbaum et al., 2001). PCR sensitivity was evaluated with single and multiple C. parvum genotype 2 oocysts. PCR amplification rates were as follows: 100% for PCR tubes with 10 oocysts, 94% for tubes containing 7 oocysts, 92% for tubes containing 5 oocysts, 88% for tubes containing 4 oocysts, 76% for tubes containing 3 oocysts, 56% for tubes with 2 oocysts, and 38% for tubes containing a single oocyst (Sturbaum et al., 2001).
-
Primers:
-
External primers
-
Nested primers
-
Forward:
NesCry3 (GCG AAA AAA CTC GAC TTT ATG GAA GGG) (Sturbaum et al., 2001)
-
Reverse:
NesCry4 (GGA GTA TTC AAG GCA TAT GCC TGC) (Sturbaum et al., 2001)
-
Product
-
Size: A 593-bp fragment from genotype 1 and a 590-bp fragment from genotype 2 (Sturbaum et al., 2001).
-
Product GenBank Accession Number:
AF093491 AF164102
-
Nested Multiplex PCR:
-
Description:
A nested multiplex polymerase chain reaction (PCR) approach was adopted for the simultaneous detection of 4 human infective genotypes of the protozoan parasite Cryptosporidium. Specific PCR primers were designed for the heat shock protein 70 gene of 2 genotypes of Cryptosporidium parvum (human and bovine types), Cryptosporidium canis, and Cryptosporidium felis. These 4 genotypes have all been found in human fecal samples. The primers amplified DNA fragments of specific sizes, each representing a unique genotype. The limit of detection of the method was found to vary between 10 and 100 oocysts per 1 ml fecal material. There appeared to be no cross-reactivity with other organisms commonly present in feces and soil, and the approach has a high specificity (Lindergard et al., 2003).
-
Primers:
-
SSU rRNA outer primers
-
SSU rRNA inner primers
-
HSP-70 human
-
HSP-70 canis
-
HSP-70 felis
-
HSP-70 bovine
-
Other Types of Diagnostic Tests:
-
Flow cytometric detection of Cryptosporidium oocysts in human stool samples:
-
Time to Perform:
unknown
-
Description:
In the present study, we fluorescently labeled and counted C. parvum oocysts by flow cytometry (FC) and developed a simple and efficient method of processing human stool samples for FC analysis. Formed stool (suspended in phosphate-buffered saline) from an asymptomatic, healthy individual was seeded with known concentrations of oocysts, and oocysts were labeled with a cell wall-specific monoclonal antibody and detected by FC. The method described herein resulted in a mean oocyst recovery rate of 45% +/- 16% (median, 42%), which consistently yielded a fourfold increase in sensitivity compared to direct fluorescent-antibody assay of seeded stool samples. However, in many instances, FC detected as few as 10(3) oocysts per ml. Thus, FC provides a reproducible and sensitive method for C. parvum oocyst detection (Valdez et al., 1997).
-
Immunomagnetic separation-reverse transcription polymerase chain reaction (IMS-RT-PCR) test for sensitive and rapid detection of viable waterborne Cryptosporidium parvum:
-
Time to Perform:
unknown
-
Description:
In this study, we report the development of a viability assay for C. parvum oocysts based on immunomagnetic separation and reverse transcription polymerase chain reaction (IMS-RT-PCR). The detection limit of the IMS-RT-PCR assay, which targets the hsp70 heat shock-induced mRNA, was in the range of ten viable oocysts per 100-l tap water samples. Purified Cryptosporidium parvum oocysts were exposed to heating, freezing and three chemical disinfection treatments namely, chlorination, chlorine dioxide treatment and ozonation under conventional doses used in water treatment plants, then detected by IMS-PCR and IMS-RT-PCR. The results obtained by IMS-PCR showed that none of the treatments had an effect on oocyst detection. The inactivation of oocysts by boiling resulted in no RT-PCR signal. Chlorine as well as chlorine dioxide did not influence oocyst viability as determined by IMS-RT-PCR. Ozone more effectively inactivated oocysts. The IMS-RT-PCR assay in conjunction with IMS-PCR marks the development of a combined detection and viability test which can be used for drinking water quality control as well as for reliable evaluation of treatment efficiency (Hallier-Soulier and Guillot, 2003). A detection limit of ten spiked viable oocysts in 100 l dechlorinated tap water samples was achieved on agarose gel electrophoresis (Hallier and Guillot, 2003).
V. References
A. Journal References:
Abe and Iseki:
Abe N ,
Iseki M Identification of genotypes of Cryptosporidium parvum isolates from ferrets in Japan .
Parasitology Research .
2003 ;
89 ( 5 ):
422 -
424 .
[PubMed:
12632159].
Amadi et al., 2002:
Amadi B,
Mwiya M,
Musuku J, Watuka A, Sianongo S, Ayoub A, Kelly P. Effect of nitazoxanide on morbidity and mortality in Zambian children with cryptosporidiosis: a randomised controlled trial..
Lancet.
2002;
360(9343):
1375 -
1380.
[PubMed:
12423984].
Arrowood, 2002:
Arrowood MJ In Vitro Cultivation of Cryptosporidium Species .
Clinical Microbiology Reviews .
2002 ;
15 ( 3 ):
390 -
400 .
[PubMed:
12097247].
Atwill et al., 2001:
Atwill ER,
Camargo SM,
Phillips R, Alonso LH, Tate KW, Jensen WA, Bennet J, Little S, Salmon TP. Quantitative shedding of two genotypes of Cryptosporidium parvum in California ground squirrels (Spermophilus beecheyi)..
Appl Environ Microbiol.
2001;
67(6):
2840 -
2843.
[PubMed:
11375204].
Bajer et al., 2002:
Bajer A,
Bednarska M,
Pawelczyk A, Behnke JM, Gilbert FS, Sinski E. Prevalence and abundance of Cryptosporidium parvum and giardia spp. in wild rural rodents from the Mazury Lake District region of Poland..
Parasitology.
2002;
125(Pt 1):
21 -
34.
[PubMed:
12166517].
Balatbat et al., 1996:
Balatbat AB ,
Jordan GW ,
Tang YJ , Silva Jr, J Detection of Cryptosporidium parvum DNA in Human Feces by Nested PCR .
Journal of Clinical Microbiology .
1996 ;
34 ( 7 ):
1769 -
1772 .
[PubMed:
8784586].
Bankier et al., 2003:
Bankier AT,
Spriggs HF,
Fartmann B, Konfortov BA, Madera M, Vogel C, Teichmann SA, Ivens A, Dear PH. Integrated mapping, chromosomal sequencing and sequence analysis of Cryptosporidium parvum..
Genome Res.
2003;
13(8):
1787 -
1799.
[PubMed:
12869580].
Bertolino et al., 2003:
Bertolino S.,
Wauters LA,
De Bruyn L, Canestri-Trotti G. Prevalence of coccidia parasites (Protozoa) in red squirrels ( Sciurus vulgaris): effects of host phenotype and environmental factors..
Oecologia.
2003;
Pubmed ahead of print():
-
.
[PubMed:
12898385].
Bialek et al., 2002:
Bialek R,
Binder N,
Dietz K, Joachim A, Knobloch J, Zelck UE. Comparison of fluorescence, antigen and PCR assays to detect Cryptosporidium parvum in fecal specimens..
Diagn Microbiol Infect Dis.
2002;
43(4):
283 -
288.
[PubMed:
12151188].
Causape et al., 2002:
Causape AC,
Quilez J,
Sanchez-Acedo C, del Cacho E, Lopez-Bernad F. Prevalence and analysis of potential risk factors for Cryptosporidium parvum infection in lambs in Zaragoza (northeastern Spain)..
Vet Parasitol.
2002;
104(4):
287 -
298.
[PubMed:
11836029].
Chalmers et al., 1997:
Chalmers RM,
Sturdee AP,
Bull SA, Miller A, Wright SE. The prevalence of Cryptosporidium parvum and C. muris in Mus domesticus, Apodemus sylvaticus and Clethrionomys glareolus in an agricultural system..
Parasitology Research.
1997;
83(5):
478 -
482.
[PubMed:
9197396].
Chan et al., 2000:
Chan R,
Chen J,
York MK, Setijono N, Kaplan RL, Graham F, Tanowitz HB. Evaluation of a combination rapid immunoassay for detection of Giardia and Cryptosporidium antigens.
J Clin Microbiol..
2000;
38(1):
393 -
394.
[PubMed:
10618122].
da Silva et al., 2003:
da Silva AJ,
Caccio S,
Williams C, Won KY, Nace EK, Whittier C, Pieniazek NJ, Eberhard ML. Molecular and morphologic characterization of a Cryptosporidium genotype identified in lemurs..
Veterinary Parasitology.
2003;
111(4):
297 -
307.
[PubMed:
12559709].
de Graaf et al., 1999:
de Graaf DC,
Vanopdenbosch E,
Ortega-Mora LM, Abbassi H, Peeters JE. A review of the importance of cryptosporidiosis in farm animals..
International Journal for Parasitology.
1999;
29(8):
1269 -
1287.
[PubMed:
10576578].
Deng et al., 2000:
Deng MQ,
Peterson RP,
Cliver DO First findings of Cryptosporidium and Giardia in California sea lions (Zalophus californianus)..
J Parasitol..
2000;
86(3):
490 -
494.
[PubMed:
10864244].
Dillingham et al., 2002:
Dillingham RA ,
Lima AA ,
Gruerrant RL Cryptosporidiosis: epidemiology and impact .
Microbes and Infection .
2002 ;
4 ( 10 ):
1059 -
1066 .
[PubMed:
12191656].
Doing et al., 1999:
Doing KM,
Hamm JL,
Jellison JA, Marquis JA, Kingsbury C. False-positive results obtained with the Alexon ProSpecT Cryptosporidium enzyme immunoassay.
J Clin Microbiol..
1999;
37(5):
1582 -
1583.
[PubMed:
10203528].
Fayer et al., 2000:
Fayer R.,
Morgan U.,
Upton S Epidemiology of Cryptosporidium: transmission, detection and identification.
International Journal for Parasitology.
2000;
30(12-13):
1305 -
1322.
[PubMed:
11113257].
Fontaine and Guillot, 2003:
Fontaine M,
Guillot G An immunomagnetic separation-real-time PCR method for quantification of Cryptosporidium parvum in water samples.
J Microbiol Methods.
2003;
54(1):
29 -
36.
[PubMed:
12732419].
Garcia et al., 2003:
Garcia LS,
Shimizu RY,
Novak S, Carroll M, Chan F. Commercial assay for detection of Giardia lamblia and Cryptosporidium parvum antigens in human fecal specimens by rapid solid-phase qualitative immunochromatography..
J Clin Microbiol.
2003;
41(1):
209 -
212.
[PubMed:
10970380].
Gomez et al., 1996:
Gomez MS,
Vila T,
Feliu C, Montoliu I, Gracenea M, Fernandez J. A survey for Cryptosporidium spp. in mammals at the Barcelona Zoo..
International Journal for Parasitology.
1996;
26(11):
1331 -
1333.
[PubMed:
9024881].
Gomez et al., 2000:
Gomez MS,
Torres J,
Gracenea M, Fernandez-Moran J, Gonzalez-Moreno O. Further report on Cryptosporidium in Barcelona zoo mammals..
Parasitol Res.
2000;
86(4):
318 -
323.
[PubMed:
10780741].
Gracenea et al., 2002:
Gracenea M,
Gomez MS,
Torres J, Carne E, Fernandez-Moran J. Transmission dynamics of Cryptosporidium in primates and herbivores at the Barcelona zoo: a long-term study..
Veterinary Parasitology.
2002;
104(1):
19 -
26.
[PubMed:
11779652].
Graczyk et al., 1998:
Graczyk TK,
Cranfield MR,
Dunning C, Strandberg JD. Fatal cryptosporidiosis in a juvenile captive African hedgehog (Ateletrix albiventris)..
Journal of Parasitology.
1998;
84(1):
178 -
180.
[PubMed:
9488362].
Graczyk et al., 2001:
Graczyk TK,
DaSilva AJ,
Cranfield R, Nizeyi JB, Kalema GR, Pieniazek NJ. Cryptosporidium parvum genotype 2 infections in free-ranging mountain gorillas (Gorilla gorilla beringei) of the Bwindi Impenetrable National Park, Uganda..
Parasitol Res.
2001;
87(5):
368 -
370.
[PubMed:
11403378].
Griffiths, 1998:
Griffiths JK. Human cryptosporidiosis: epidemiology, transmission, clinical disease, treatment, and diagnosis.
Adv Parasitol..
1998;
40:
37 -
85.
[PubMed:
9554070].
Hallier and Guillot, 2003:
Hallier-Soulier S,
Guillot E An immunomagnetic separation-reverse transcription polymerase chain reaction (IMS-RT-PCR) test for sensitive and rapid detection of viable waterborne Cryptosporidium parvum..
Environ Microbiol..
2003;
5(7):
592 -
598.
[PubMed:
12823191].
Higgins et al., 2001:
Higgins JA,
Fayer R,
Trout JM, Xiao L, Lal AA, Kerby S, Jenkins MC. Real-time PCR for the detection of Cryptosporidium parvum..
J Microbiol Methods.
2001;
47(3):
323 -
337.
[PubMed:
11714523].
Hunter and Nichols, 2002:
Hunter PR ,
Nichols G Epidemiology and Clinical Features of Cryptosporidium Infection in Immunocompromised Patients .
Clinical Microbiology Reviews .
2002 ;
15 ( 1 ):
145 -
154 .
[PubMed:
11781272].
Johnston et al., 2003:
Johnston SP,
Ballard MM,
Beach MJ, Causer L, Wilkins PP. Evaluation of three commercial assays for detection of Giardia and Cryptosporidium organisms in fecal specimens.
J Clin Microbiol.
2003;
41(2):
623 -
626.
[PubMed:
12574257].
Juranek, 1995:
Juranek DD Cryptosporidiosis: sources of infection and guidelines for prevention. .
Clinical Infectious Diseases .
1995 ;
21 ( Suppl1 ):
S57 -
S61 .
[PubMed:
8547513].
Kadappu et al., 2002:
Kadappu KK,
Nagaraja MV,
Rao PV, Shastry BA. Azithromycin as treatment for cryptosporidiosis in human immunodeficiency virus disease.
.
J Postgrad Med..
2002;
48(3):
179 -
181.
[PubMed:
12432190].
Katanik et al., 2001:
Katanik MT,
Schneider SK,
Rosenblatt JE, Hall GS, Procop GW. Evaluation of ColorPAC Giardia/Cryptosporidium rapid assay and ProSpecT Giardia/Cryptosporidium microplate assay for detection of Giardia and Cryptosporidium in fecal specimens..
J Clin Microbiol.
2001;
39(12):
4523 -
4525.
[PubMed:
11724874].
Khan et al., 2001:
Khan AS,
Serdlow DL,
Juranek DD Precautions against biological and chemical terrorism directed at food and water supplies.
Public Health Reports.
2001;
116(1):
3 -
14.
[PubMed:
11571403].
Kvac et al., 2003:
Kvac M,
Kvetonova D,
Puzova G, Ditrich O. Comparison of selected diagnostic methods for identification of Cryptosporidium parvum and Cryptosporidium andersoni in routine examination of faeces.
.
J Vet Med B Infect Dis Vet Public Health..
2003;
50(8):
405 -
411.
[PubMed:
14633212].
Leav et al., 2003:
Leav BA,
Mackay M,
Ward HD Cryptosporidium species: new insights and old challenges.
Clinical Infectious Diseases.
2003;
36(7):
903 -
908.
[PubMed:
12652391].
Levy et al., 1998:
Levy DA,
Bens MS,
Craun GF, Calderon RL, Herwaldt BL. Surveillance for waterborne-disease outbreaks--United States, 1995-1996.
MMWR CDC Surveill Summ.
1998;
47(5):
1 -
34.
[PubMed:
9859954].
Lindergard et al., 2003:
Lindergard G,
Nydam DV,
Wade SE, Schaaf SL, Mohammed HO. A novel multiplex polymerase chain reaction approach for detection of four human infective Cryptosporidium isolates: Cryptosporidium parvum, types H and C, Cryptosporidium canis, and Cryptosporidium felis in fecal and soil samples..
J Vet Diagn Invest..
2003;
15(3):
262 -
267.
[PubMed:
12735348].
Lindsay et al., 1988:
Lindsay DS,
Hendrix CM,
Blagburn BL Experimental Cryptosporidium parvum infections in opossums (Didelphis virginiana)..
J Wildl Dis..
1988;
24(1):
157 -
159.
[PubMed:
3352085].
Llorente et al., 2002:
Llorente MT ,
Clavel A ,
Varea M , Olivera S, Castillo FJ, Sahagun J, Rubio MC, Gomez-Lus R. Evaluation of an Immunochromatographic Dip-Strip Test for the Detection of Cryptosporidium Oocysts in Stool Specimens .
European Journal of Clinical Microbiology and Infectious Diseases .
2002 ;
21 ( 8 ):
624 -
625 .
[PubMed:
12226697].
Marshall et al., 1997:
Marshall MM ,
Naumovitz D ,
Ortega Y , Sterling, CR Waterborne protozoan pathogens .
Clinical Microbiology Reviews .
1997 ;
10 ( 1 ):
67 -
85 .
[PubMed:
8993859].
Matsui et al., 2000:
Matsui T,
Fujino T,
Kajima J, Tsuji M. Infectivity to experimental rodents of Cryptosporidium parvum oocysts from Siberian chipmunks (Tamias sibiricus) originated in the People's Republic of China..
Parasitology.
2000;
62(5):
487 -
489.
[PubMed:
10852396].
Moran, 2002:
Moran GJ Threats in bioterrorism II: CDC category B and C agents.
Emerg Med Clin N Am.
2002;
20(2):
311 -
330.
[PubMed:
12120481].
Morgan et al., 1999:
Morgan UM,
Sturdee AP,
Singleton G, Gomez MS, Gracenea M, Torres J, Hamilton SG, Woodside DP, Thompson RC. The Cryptosporidium "mouse" genotype is conserved across geographic areas..
J Clin Microbiol.
1999;
37(5):
1302 -
1305.
[PubMed:
10203475].
Morgan et al., 2000:
Morgan UM,
Xiao L,
Hill BD, O'Donoghue P, Limor J, Lal A, Thompson RC. Detection of the Cryptosporidium parvum "human" genotype in a dugong (Dugong dugon)..
J Parasitol..
2000;
86(6):
1352 -
1354.
[PubMed:
11191916].
Newman et al., 1993:
Newman RD,
Jaeger KL,
Wuhib T, Lima AA, Guerrant RL, Sears CL. Evaluation of an antigen capture enzyme-linked immunosorbent assay for detection of Cryptosporidium oocysts.
Journal of Clinical Microbiology.
1993;
31(8):
2080 -
2084.
[PubMed:
8370732].
O'Donoghue, 1995:
O'Donoghue PJ Cryptosporidium and cryptosporidiosis in man and animals..
Int J Parasitol..
1995;
25(2):
139 -
195.
[PubMed:
7622324].
Perz and Le Blancq, 2001:
Perz JF,
Le Blancq SM Cryptosporidium parvum infection involving novel genotypes in wildlife from lower New York State..
Appl Environ Microbiol.
2001;
67(3):
1154 -
1162.
[PubMed:
11229905].
Piper et al., 1998:
Piper MB ,
Bankier AT ,
Dear PH A Happy Map of Cryptosporidium parvum .
Genome Research .
1998 ;
8 ( 12 ):
1299 -
1307 .
[PubMed:
9872984].
Quy et al., 1999:
Quy RJ,
Cowan DP,
Haynes PJ, Sturdee AP, Chalmers RM, Bodley-Tickell AT, Bull SA. The Norway rat as a reservoir host of Cryptosporidium parvum..
J Wildl Dis.
1999;
35(4):
660 -
670.
[PubMed:
10574524].
Rademacher et al., 1999:
Rademacher U,
Jakob W,
Bockhardt I Cryptosporidium infection in beech martens (Martes foina)..
J Zoo Wildl Med..
1999;
30(3):
421 -
422.
[PubMed:
10572868].
Rasmussen and Healey, 1992:
Rasmussen KR,
Healey MC Cryptosporidium parvum: experimental infections in aged Syrian golden hamsters..
J Infect Dis.
1992;
165(4):
769 -
772.
[PubMed:
1552209].
Reduker et al., 1985:
Reduker DW,
Speer CA,
Blixt JA Ultrastructure of Cryptosporidium parvum oocysts and excysting sporozoites as revealed by high resolution scanning electron microscopy.
Journal of Protozoology.
1985;
32(4):
708 -
711.
[PubMed:
4067883].
Rehg et al., 1988:
Rehg JE,
Gigliotti F,
Stokes DC Cryptosporidiosis in ferrets..
Lab Anim Sci..
1988;
38(2):
155 -
158.
[PubMed:
3374090].
Rosenblatt and Sloan, 1993:
Rosenblatt JE,
Sloan LM Evaluation of an enzyme-linked immunosorbent assay for detection of Cryptosporidium spp. in stool specimens.
Journal of Clinical Microbiology.
1993;
31(6):
1468 -
1471.
[PubMed:
8314988].
Sestak et al., 2002:
Sestak K,
Ward LA,
Sheoran A, Feng X, Akiyoshi DE, Ward HD, Tzipori S. Variability among Cryptosporidium parvum genotype 1 and 2 immunodominant surface glycoproteins.
.
Parasite Immunol..
2002;
24(4):
213 -
219.
[PubMed:
12120593].
Snyder, 1988:
Snyder DE Indirect immunofluorescent detection of oocysts of Cryptosporidium parvum in the feces of naturally infected raccoons (Procyon lotor)..
Journal of Parasitology.
1988;
74(6):
1050 -
1052.
[PubMed:
3057164].
Spano and Crisanti, 2000:
Spano F,
Crisanti A Cryptosporidium parvum: the many secrets of a small genome.
Int J Parasitol..
2000;
30(4):
553 -
565.
[PubMed:
10731576].
Sturbaum et al., 2001:
Sturbaum GD ,
Reed C ,
Hoover PJ , Jost BH, Marshall MM, Sterling CR. Species-Specific, Nested PCR-Restriction Fragment Length Polymorphism Detection of Single Cryptosporidium parvum Oocysts .
Applied and Environmental Microbiology .
2001 ;
67 ( 6 ):
2665 -
2668 .
[PubMed:
11375178].
Sturdee et al., 1999:
Sturdee AP,
Chalmers RM,
Bull SA Detection of Cryptosporidium oocysts in wild mammals of mainland Britain..
Veterinary Parasitology.
1999;
80(4):
273 -
280.
[PubMed:
9950333].
Tetley et al., 1988:
Tetley L,
Brown SMA,
McDonald V, Coombs, GH. Ultrastructural analysis of the sporozoite of Cryptosporidium parvum.
Microbiology.
1998;
144(Pt 12):
3249 -
3255.
[PubMed:
9884216].
Theodos et al., 1998:
Theodos CM,
Griffiths JK,
D'Onfro J, Fairfield A, Tzipori S. Efficacy of nitazoxanide against Cryptosporidium parvum in cell culture and in animal models..
.
1998;
42(8):
1959 -
1965.
[PubMed:
9687390].
Torres et al., 2000:
Torres J,
Gracenea M,
Gomez MS, Arrizabalaga A, Gonzalez-Moreno O. The occurrence of Cryptosporidium parvum and C. muris in wild rodents and insectivores in Spain.
.
Veterinary Parasitology.
2000;
92(4):
253 -
260.
[PubMed:
10996736].
Trad et al., 2003:
Trad O,
Jumaa P,
Uduman S, Nawaz A. Eradication of Cryptosporidium in four children with acute lymphoblastic leukemia.
J Trop Pediatr..
2003;
49(2):
128 -
130.
[PubMed:
12729299].
Tzipori, 1998:
Tzipori S Cryptosporidiosis: laboratory investigations and chemotherapy.
Advances in Parasitology.
1998;
40:
187 -
221.
[PubMed:
9554074].
Tzipori and Griffiths, 2002:
Tszipori S,
Griffiths JK Natural history and biology of Cryptosporidium parvum..
Advances in Parasitology.
1998;
40:
5 -
36.
[PubMed:
9554069].
Tzipori and Ward, 2002:
Tzipori S,
Ward H Cryptosporidiosis: biology, pathogenesis and disease.
Microbes Infect.
2002;
4(10):
1047 -
1058.
[PubMed:
12191655].
Valdez et al., 1997:
Valdez LM,
Dang H,
Okhuysen PC, Chappell, CL Flow cytometric detection of Cryptosporidium oocysts in human stool samples..
J Clin Microbiol..
1997;
35(8):
2013 -
2017.
[PubMed:
9230372].
Ward and Wang, 2001:
Ward LA,
Wang Y Rapid methods to isolate Cryptosporidium DNA from frozen feces for PCR.
Diagn Microbiol Infect Dis..
2001;
41(1-2):
37 -
42.
[PubMed:
11687312].
Xiao et al., 2000:
Xiao L,
Limor JR,
Sulaiman IM, Duncan RB, Lal AA. Molecular characterization of a Cryptosporidium isolate from a black bear..
J Parasitol..
2000;
86(5):
1166 -
1170.
[PubMed:
11128505].
B. Book References:
Arrowood, 1997:
Arrowood MJ Diagnosis .
43 -
64 .
In: Fayer R Cryptosporidium and Cryptosporidiosis 1997 .
CRC Press ,
Boca Raton, New York, Tokyo .
Blagburn and Soave, 1997:
Blagburn BL ,
Soave R Prophylaxis and Chemotherapy: Human and Animal .
111 -
128 .
In: Fayer R Cryptosporidium and Cryptosporidiosis 1997 .
CRC Press ,
Boca Raton, New York, Tokyo .
Casemore et al., 1997:
Casemore DP ,
Wright SE ,
Coop RL Cryptosporidiosis: Human and Animal Epidemiology .
66 -
92 .
In: Fayer R Cryptosporidium and Cryptosporidiosis 1997 .
CRC Press ,
Boca Raton, New York, Tokyo .
Fayer et al., 1997:
Fayer R ,
Speer CA ,
Dubey JP The General Biology of Cryptosporidium .
1 -
41 .
In: Fayer R Cryptosporidium and Cryptosporidiosis 1997 .
CRC Press ,
Boca Raton, New York, Tokyo .
Lindsay, 1997:
Lindsay DS Laboratory Models of Cryptosporidiosis .
209 -
223 .
In: Fayer R Cryptosporidium and Cryptosporidiosis 1997 .
CRC Press ,
Boca Raton, New York, Tokyo .
Rose et al., 1997:
Rose JB ,
Lisle JT ,
LeChevallier M Waterborne Cryptosporidiosis: Incidence, Outbreaks, and Treatment Strategies .
93 -
109 .
In: Fayer R Cryptosporidium and Cryptosporidiosis 1997 .
CRC Press ,
Boca Raton, New York, Tokyo .
Ungar, 1990:
Ungar BLP Cryptosporidiosis in Humans (Homo sapiens) .
59 -
82 .
In: Dubey JP ,
Speer CA ,
Fayer R Cryptosporidiosis of Man and Animals 1990 .
CRA Press ,
Boca Raton, Ann Arbor, Boston .
Upton, 1997:
Upton SJ In Vitro Cultivation .
181 -
207 .
In: Fayer R Cryptosporidium and Cryptosporidiosis 1997 .
CRC Press ,
Boca Raton, New York, Tokyo .
C. Website References:
Website 1:
Cryptosporidium parvum [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=5807&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 2:
Homo sapiens [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Tree&id=9606&lvl=3&keep=1&srchmode=1&unlock
].
Website 3:
Bos taurus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9913
].
Website 4:
Ovis aries [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9940&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 5:
Capra hircus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9925
].
Website 6:
Sus scrofa [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9823&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 7:
Equus caballus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9796
].
Website 8:
Canis familiaris [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9615&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 9:
Procyon lotor [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9654&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 10:
Mustela putorius furo [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9669&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 11:
Oryctolagus cuniculus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9986&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 12:
Sylvilagus floridanus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9988&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 13:
Rattus norvegicus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=10116&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 14:
Rattus rattus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=10117&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 15:
Mesocricetus auratus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=10036&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 16:
Primates [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9443&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 17:
Ateles belzebuth hybridus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=129801&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 18:
Cercocebus torquatus torquatus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=81944&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 19:
Eulemur macaco [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=30602&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 20:
Eulemur macaco macaco [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=30603&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 21:
Gorilla gorilla beringei [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9594&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 22:
Hylobates syndactylus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9590&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 23:
Lemur catta [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9447&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 24:
Varecia variegata [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9455&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 25:
Lophocebus albigena [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=75567&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 26:
Macaca thibetana [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=54602&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 27:
Mandrillus leucophaeus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9568&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 28:
Pithecia pithecia [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=43777&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 29:
Saimiri sciureus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9521&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 30:
Cetartiodactyla [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=91561&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 31:
Propithecus verreauxi coquereli [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=122226&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 32:
Addax nasomaculatus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=59515&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 33:
Antilope cervicapra [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=59525&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 34:
Bison bison [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9901&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 35:
Bison bonasus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9902&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 36:
Boselaphus tragocamelus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9917&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 37:
Bubalus depressicornis [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=27596&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 38:
Camelus bactrianus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9837&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 39:
Camelus dromedarius [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9838&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 40:
Cervus dama [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=30532&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 41:
Cervus elaphus canadensis [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9861&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 42:
Cervus unicolor [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9862&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 43:
Connochaetes taurinus taurinus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=101659&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 44:
Gazella dorcas [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=37751&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 45:
Giraffa camelopardalis [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9894&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 46:
Hexaprotodon liberiensis [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=56798&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 47:
Hippotragus niger [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=37189&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 48:
Kobus ellipsiprymnus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9962&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 49:
Lama guanicoe [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9840&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 50:
Muntiacus reevesi [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9886&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 51:
Odocoileus virginianus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9874&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 52:
Oryx dammah [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=59534&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 53:
Oryx gazella callotis [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=59548&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 54:
Ovis aries musimon [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9938&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 55:
Syncerus caffer [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9970&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 56:
Pecari tajacu [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9829&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 57:
Tragelaphus eurycerus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=69297&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 58:
Carnivora [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=33554&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 59:
Felis catus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9685&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 60:
Martes foina [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9659&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 61:
Meles meles [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9662&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 62:
Mephitis mephitis [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=30548&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 63:
Ursus americanus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9643&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 64:
Vulpes vulpes [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9627&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 65:
Zalophus californianus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9704&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 66:
Chiroptera [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9397&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 67:
Myotis adversus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=59461&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 68:
Insectivora [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9362&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 69:
Atelerix albiventris [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9368&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 70:
Erinaceus europaeus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9365&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 71:
Sorex araneus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=42254&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 72:
Crocidura russula [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=36802&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 73:
Sorex minutus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=62280&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 74:
Lagomorpha [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9975&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 75:
Metatheria [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9263&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 76:
Didelphis virginiana [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9267&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 77:
Perissodactyla [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9787&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 78:
Ceratotherium simum simum [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=73337&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 79:
Tapirus terrestris [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9801&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 80:
Proboscidea [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9779&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 81:
Loxodonta africana [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9785&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 82:
Rodentia [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9989&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 83:
Apodemus flavicollis [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=54292&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 84:
Apodemus sylvaticus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=10129&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 85:
Clethrionomys glareolus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=51090&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 86:
Microtus arvalis [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=47230&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 87:
Mus musculus domesticus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=10092&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 88:
Mus spretus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=10096&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 89:
Ondatra zibethicus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=10060&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 90:
Peromyscus leucopus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=10041&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 91:
Sciurus carolinensis [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=30640&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 92:
Sciurus niger [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=34861&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 93:
Sciurus vulgaris [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=55149&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 94:
Spermophilus beecheyi [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=34862&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 95:
Tamias sibiricus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=64680&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 96:
Tamias striatus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=45474&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 97:
Sirenia [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9774&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 98:
Dugong dugon [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=29137&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 99:
Cryptosporidiosis [
http://www.dpd.cdc.gov/dpdx/HTML/ImageLibrary/Cryptosporidiosis_il.htm
].
Website 100:
Life cycle of Cryptosporidium parvum and C. hominis. [
http://www.dpd.cdc.gov/dpdx/HTML/ImageLibrary/Cryptosporidiosis_il.htm
].
Website 101:
Cryptosporidium parvum chromosome 6, complete sequence. [
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_uids=32456060&dopt=GenBank
].
Website 102:
Mammalia [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=40674&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 103:
Cryptosporidiosis [
http://author.emedicine.com/ped/topic516.htm
].
Website 104:
BMBL Section VII. Agent Summary Statements. Section VII-C: Parasitic Agents [
http://www.cdc.gov/OD/OHS/BIOSFTY/bmbl4/bmbl4s7c.htm
].
D. Thesis References:
No thesis or dissertation references used.
VI. Curation Information
-
Curators:
Rebecca Wattam (wattam@vbi.vt.edu); Herman Formadi (eformadi@vt.edu)
-
Date: 05 August 2003
-
Version: 1.0
-
Note: Cryptosporidium parvum background information
-
Contact information:
- Email: pathinfo@vbi.vt.edu