I. Organism Information

A. Taxonomy Information

1. Species:
   1. Coxiella burnetii :
      1. Ontology: UMLS:C0010240
      2. GenBank Taxonomy No.: 777
      3. Description: Coxiella burnetii, the etiological agent of "Q fever," is a category B bioterrorism agent that is highly infective to both humans and livestock. In humans, the disease manifests as an acute flu-like illness, with a hallmark debilitating headache and cyclic fever. Instances of chronic disease are characterized by endocarditis (Seshadri et al., 2003). Although Coxiella was historically considered "Rickettsia-like," 16S rRNA gene sequence analysis and genome analysis (based on shared proteins across genomes and phylogenetic analysis of a set of 20 highly conserved proteins) indicate that it is a gamma-proteobacteria (order Legionellales) and thus is distant from the alpha-proteobacterial Rickettsia group. Coxiella is also distant from any other lineage within the gamma subgroup, its closest relationship is with Legionella pneumophila, a facultative intracellular human pathogen, and Rickettsiella grylli, an intracellular arthropod pathogen (Seshadri et al., 2003). Synonyms: Rickettsia diaporica, Rickettsia burneti (NCBI Taxonomy).
      4. Variant(s):
         • Coxiella burnetii (Phase I) :
           • Parent: Coxiella burnetii
           • Description: Coxiella burnetii displays antigenic variation similar to the smooth-rough variation of other Gram-negative bacteria and this variation is related to changes in the lipopolysaccharides (LPS) layer. Cells in phase I, which correspond to the smooth antigenic variants of other Gram-negative bacteria, are highly infectious and are found in naturally infected human beings, animals and arthropods (Woldehiwet, 2004).
         • Coxiella burnetii (Phase II) :
           • Parent: Coxiella burnetii
           • Description: Phase II, which corresponds to the rough variants of other Gram-negative bacteria, is less infectious and is obtained after serial passages in cell culture systems or embryonated eggs. Phase II is characterized by a truncated LPS and lacks some protein cell surface determinants. The two phases also differ with regard to the sugar composition of the LPS (Woldehiwet, 2004).
   2. Coxiella burnetii RSA 493 :
      1. GenBank Taxonomy No.: 227377
      2. Description: Isolate: Nine Mile RSA 493; Montana, tick, 1935 (Beare et al., 2006). This bacterium is an obligate intracellular acidophile that is highly adapted for life within the eukaryotic phagolysosome (Seshadri et al., 2003).
   3. Coxiella burnetii RSA 331 :
      1. GenBank Taxonomy No.: 360115
      2. Description: Isolate: Henzerling RSA 331; Italy, human blood, 1945 (Beare et al., 2006).
   4. Coxiella burnetii Dugway 7E9-12. :
      1. GenBank Taxonomy No.: 382253
      2. Description: Isolate: Dugway 7E9-12; Utah, rodents, 1958 (Beare et al., 2006).

B. Lifecycle Information :

1. Stage Information:
   1. Small cell variants (SCVs): :
      1. Size: The etiological agent of Q fever is highly pleomorphic, coccobacillary in shape with approximate dimensions of 0.3 by 1.0 um (Baca and Paretsky, 1983).
      1. Shape: Rod shaped and very compact (Heinzen et al., 1999).
      1. Picture(s):
         • Coxiella burnetii (NIAID Biodefense Image Library):
           
           
           
      1. Description: Coxiella burnetii, the bacteria that causes Q fever (Credit: Rocky Mountain Laboratories, NIAID, NIH) (NIAID Biodefense Image Library)
   2. Large cell variants (LCVs): :
      1. Size: By contrast with the SCVs, the LCVs can reach a length exceeding 1.0 um and are similar in form to typical Gram-negative bacteria in that they possess a clearly distinguishable outer membrane, periplasmic space and cytoplasmic membrane (Heinzen et al., 1999).
      1. Shape: The LCVs are more pleiomorphic than the SCVs, with a thinner cell wall and a very dispersed nucleoid (Heinzen et al., 1999).


2. Progression Information:
   1. Morphological differentiation -- From stage: Small cell variants (SCVs) , To stage: Large cell variants (LCVs) (Heinzen et al., 1999):
      1. Description: Exposure to low intraphagolysosomal pH and, perhaps, enzyme systems and/or nutrient sources present in the vacuole is postulated to trigger the vegetative differentiation of SCVs into more metabolically active large cell variants (LCVs). The possible biogenesis of a spore-like particle (SLP) has also been suggested. SLPs have been observed as electron-dense polar bodies in the LCV and are speculated to have endospore-like properties (Heinzen et al., 1999).

C. Genome Summary:

1. Genome of Coxiella burnetii
1. Description: Genetic variations among C. burnetii strains have been studied. The genome size, as determined by pulse field electrophoresis, varies from 1.5 to 2.4 Mb (Raoult et al., 2005). Most C. burnetii isolates harbor 1 of 4 autonomously replicating plasmids termed QpH1, QpRS, QpDV, and QpDG (Beare et al., 2006). Genetic variability among different C. burnetii strains, as demonstrated by different restriction fragment length polymorphism (RFLP)-based genomic groups, specific plasmid regions, and LPS variations, were tentatively related to virulence. Genomic groups I, II, and III were associated with animal, tick, or acute Q fever human isolates, referred to as acute strains, whereas groups IV and V were associated with human Q fever endocarditis isolates, referred to as chronic strains. Group VI isolates, obtained from feral rodents in Dugway (Utah), were of unknown pathogenicity. QpH1 plasmid was found in genomic groups I, II, and III and thus was associated with acute C. burnetii strains, whereas QpRS plasmid was found in genomic group IV and was associated with chronic strains (Maurin and Raoult, 1999).
2. Coxiella burnetii plasmid QpDV:
   1. GenBank Accession Number: NC_002131
   2. Size: 32,601 nt (NCBI Genome Sequence).
   3. Description: Topology: circular. Coding: 78%. Protein coding: 34 (NCBI Genome Sequence). A new plasmid, named QpDV, was found to be common to C. burnetii isolates obtained from acute and chronic Q fever (Valkova and Kazar, 1995). The plasmid QpDV was isolated from Russian isolates obtained from human pneumonia and cow milk. It was characterized previously. In the present study it is shown that this 33.5 kb plasmid with close relation to QpRS was also found in three French human isolates of different origin (Valkova and Kazar, 1995).


2. Genome of Coxiella burnetii RSA 493
1. Coxiella burnetii RSA493 chromosome (isolate Nine Mile):
   1. GenBank Accession Number: NC_002971
   2. Size: 1,995,281 nt (NCBI Genome Sequence).
   3. Gene Count: 2143 (NCBI Genome Sequence).
   4. Description: Topology: circular. Coding: 84%. Protein coding: 2016. Structural RNAs: 47 (NCBI Genome Sequence). Genome analysis revealed many genes with potential roles in adhesion, invasion, intracellular trafficking, host-cell modulation, and detoxification. A previously uncharacterized 13-member family of ankyrin repeat-containing proteins is implicated in the pathogenesis of this organism. Although the lifestyle and parasitic strategies of C. burnetii resemble that of Rickettsiae and Chlamydiae, their genome architectures differ considerably in terms of presence of mobile elements, extent of genome reduction, metabolic capabilities, and transporter profiles. The presence of 83 pseudogenes displays an ongoing process of gene degradation. Unlike other obligate intracellular bacteria, 32 insertion sequences are found dispersed in the chromosome, indicating some plasticity in the C. burnetii genome (Seshadri et al., 2003).
2. Coxiella burnetii RSA 493 plasmid QpH1 (isolate Nine Mile):
   1. GenBank Accession Number: NC_004704
   2. Size: 37,393 nt (NCBI Genome Sequence).
   3. Gene Count: 40 (NCBI Genome Sequence).
   4. Description: Topology: circular. Coding: 59%. Protein coding: 36 (NCBI Genome Sequence). The first C. burnetii plasmid, QpH1, was isolated and described by Samuel et al. This low copy plasmid was obtained from tick isolate Nine Mile, the prototype strain of acute Q fever (Valkova and Kazar, 1995). However, more recent findings by PCR analysis of C. burnetii strains from patients exhibiting chronic Q fever revealed that isolates containing either QpH1 or QpRS can cause endocarditis (Jager et al., 2002).


3. Genome of Coxiella burnetii RSA 331
1. Chromosome:
   1. GenBank Accession Number: NZ_AAQO00000000
   2. Size: 2,086,026 nt (NCBI Coxiella burnetii RSA 331 Sequencing Project)
   3. Gene Count: 2065 (NCBI Coxiella burnetii RSA 331 Sequencing Project)
   4. Description: Coxiella burnetii RSA 331, unfinished sequence, whole genome shotgun sequencing project (NCBI Coxiella burnetii RSA 331 Sequencing Project).


4. Genome of Coxiella burnetii Dugway 7E9-12.
1. Chromosome:
   1. GenBank Accession Number: NZ_AAQI00000000
   2. Size: 2,335,687 nt (NCBI Coxiella burnetii Dugway 7E9-12 Sequencing Project)
   3. Gene Count: 2043 (NCBI Coxiella burnetii Dugway 7E9-12 Sequencing Project)
   4. Description: Coxiella burnetii Dugway 7E9-12, unfinished sequence, whole genome shotgun sequencing project (NCBI Coxiella burnetii Dugway 7E9-12 Sequencing Project).

II. Epidemiology Information

Q fever has been described in almost every country, with New Zealand remaining an exception. In most countries, Q fever is not included in the list of nationally notifiable diseases. Thus, its epidemiology may only be extrapolated from investigations of defined outbreaks, from serosurveys conducted in humans or in animals in some areas, or from data obtained from public health laboratories or reference laboratories for rickettsial diseases (Maurin and Raoult, 1999). For unclear reasons, C. burnetii infection is less commonly recognized in the United States than in other developed countries, and cases of chronic Q fever are extremely rare (Karakousis et al., 2006).

A. Outbreak Locations:

1. AUSTRALIA. Between 1977 and 1994, 202 to 860 cases were reported annually despite the development of an effective vaccine, which had been available since 1989. Garner et al. have reviewed national notifications of Q fever which were made between 1991 and 1994 in Australia; this is the most recent evaluation of Q fever epidemiology in Australia. Data was collected by the National Notifiable Diseases Surveillance System (2,635 records) and the Laboratory Virus and Serology Reporting Scheme (1,407 records). Most cases were recorded from Queensland and New South Wales, and no cases were recorded from northern Tasmania. The national notification rates ranged from 3.11 to 4.99 per 100,000 population in the study period. Notification was 2.4 times greater in Queensland than in New South Wales and 8 times greater than in southern Australia. This data shows that Q fever usually affects adult males (sex ratio, 5:1) aged from 20 to 50 years, has no apparent seasonal incidence, and is found predominantly in eastern Australia, especially in southern Queensland and northern New South Wales. Q fever activity is still significantly associated with livestock and the meat industry. The incidence of chronic Q fever is unknown in Australia, and only five deaths attributed to Q fever were reported between 1982 and 1994. As in many other countries, Q fever is probably under reported in Australia because diagnosis of the disease often remains based upon the complement fixation test, which has poor sensitivity (Maurin and Raoult, 1999).
2. GERMANY. In May 2003 the Soest County Health Department was informed of an unusually large number of patients hospitalized with atypical pneumonia. In exploratory interviews patients mentioned having visited a farmers market where a sheep had lambed. Serologic testing confirmed the diagnosis of Q fever. We asked local health departments in Germany to identify notified Q fever patients who had visited the farmers market. To investigate risk factors for infection we conducted a case control study (cases were Q fever patients, controls were randomly selected Soest citizens) and a cohort study among vendors at the market. The sheep exhibited at the market, the herd from which it originated as well as sheep from herds held in the vicinity of Soest were tested for Coxiella burnetii (C. burnetii). A total of 299 reported Q fever cases was linked to this outbreak. The mean incubation period was 21 days, with an interquartile range of 14-24 days. The case control study identified close proximity to and stopping for at least a few seconds at the sheep's pen as significant risk factors. Vendors within approximately 6 meters of the sheep's pen were at increased risk for disease compared to those located farther away. Wind played no significant role. The clinical attack rate of adults and children was estimated as 20% and 3%, respectively, 25% of cases were hospitalized. The ewe that had lambed as well as 25% of its herd tested positive for C. burnetii antibodies (Porten et al., 2006). Q fever is a notifiable disease in Germany, and 27 to 100 cases are reported annually. In May 1996, a Q fever outbreak occurred in Rollshausen and five surrounding towns in the district of Lohra. In this rural area, two flocks of sheep (1,000 to 2,000 and 20 animals, respectively) had been kept near Rollshausen before the Q fever outbreak. Lambing occurred in December 1995 and January 1996. The Robert Koch Institute was invited to investigate the outbreak. A retrospective cohort study was conducted in Rollshausen residents who were older than 15 years of age. Sera from 200 inhabitants were tested by enzyme-linked immunosorbent assay for the presence of anti-C. burnetii antibodies. Of the 200 residents, 45 (23%) were considered to be infected with C. burnetii on the basis of clinical and/or serological investigation. The attack rates were similar in men and women and in the different age populations. Most patients suffered from fatigue (80%), fever (78%), malaise (76%), and chills (71%). All 35 symptomatic patients had pneumonia confirmed by chest X rays, and 4 (11%) were admitted to hospital. Living near the flocks of sheep was significantly associated with an increased risk of acquiring Q fever, and the predominant mode of contamination was considered to be by air. Anti-C. burnetii antibodies were found in the sera of 15 of 20 sheep from the largest flock investigated (Maurin and Raoult, 1999).
3. ITALY. A large outbreak of Q fever occurred in the summer and autumn of 1993 near Vicenza in northeastern Italy. The outbreak followed the crossing of populated areas near Vicenza by several flocks of sheep on their way to higher prealpine pastures. Whereas only 3 Q fever cases were officially reported in the province of Vicenza between 1983 and 1992, 58 cases were diagnosed serologically by the complement fixation test during the 5-month study period. Most cases were men (sex ratio, 2.8:1). The majority of patients presented with fever (100%), weakness (81%), headaches (76%), and chills (72%). Cough was recorded in 47% of patients, whereas abnormalities were present in 39 (81%) of the 48 chest X-rays performed. Hospitalization was necessary in 48% of patients. The only risk factor for acquisition of Q fever in this population was exposure to the migrating flocks of sheep. Of the 100 flocks investigated, 30 were found to be infected with C. burnetii, with seroprevalences ranging from 12 to 55% in a given flock (Maurin and Raoult, 1999).
4. SPAIN. Q fever is strongly endemic in the Basque Country. Many Q fever outbreaks have been recorded in the last 20 years in this region, representing over 300 cases. Montejo Baranda et al. reported 130 Q fever pneumonia cases serologically diagnosed between June 1981 and June 1984. This is the largest series of Q fever pneumonia reported anywhere in the world. Of these cases, 76 were sporadic whereas 54 occurred in three epidemic outbreaks. Most cases were in men (94 cases; male/female ratio, 3:1). The majority of infected men and women (86.9%) were between 11 and 40 years old. Most cases were diagnosed during three different Q fever outbreaks, whereas 52 cases were sporadic and occurred in patients who had regular or occasional contact with cattle, sheep, or goats or who had ingested unpasteurized milk. A high seasonal variation in incidence was noted, with the majority of cases occurring between March and July, corresponding to the peak in the lambing season (Maurin and Raoult, 1999).
5. SWITZERLAND. Only 30 to 90 Q fever cases are reported annually to the Federal Office of Public Health in Switzerland. A large outbreak of Q fever occurred in the Val de Bagnes (Valais, Switzerland) in the autumn of 1983. This outbreak was investigated after eight Q fever cases were diagnosed concomitantly at the Marigny hospital in patients who lived in the valley. Epidemiological investigation revealed that the outbreak had started 3 weeks after about 850 to 900 sheep descended from the alpine pasture and crossed several villages of the Val de Bagnes. Between October and December 1983, Q fever occurred in 21.1% of the more exposed population residing in villages situated in the lower part of the valley but in only 2.9% of the population of the higher villages away from the road crossed by the sheep. Altogether, Q fever was diagnosed serologically in 415 of the 3,036 inhabitants examined, including 240 men and 175 women. Most cases (224 of 415 (54%)) were asymptomatic, whereas more than 75% of the 191 patients with acute Q fever examined by physicians presented with prolonged fever, shivering, and headaches. However, only 8 patients (4%) required hospitalization, and no Q fever endocarditis cases had been diagnosed in 1987 at the time of the outbreak. A high prevalence of antibodies to C. burnetii antigens was found (38%) in sera from 448 sheep examined (Maurin and Raoult, 1999).
6. UNITED KINGDOM. Between 1980 and 1996, eight outbreaks in the United Kingdom were reported in the literature: 29 cases in Wales in 1982 in the community; 14 cases in southwestern England in the same year in laboratory staff after exposure to experimentally infected sheep; 25 cases in postal workers in Oxford in 1983; 2 laboratory-acquired cases in Northern Ireland in 1986; 5 cases in school students, presumably infected from school animals including poultry and goats, in southwestern England in 1987; 147 cases in the Midlands and 47 cases in Northern Ireland in 1989 in the community; and, more recently, 4 cases in 1992 on the Isle of Wight in waste disposal workers (Maurin and Raoult, 1999).
7. UNITED STATES. The prevalence of C. burnetii infection in humans and animals is poorly defined in the United States. The first major Q fever outbreaks were reported in 1946 in packing houses in Amarillo, Tex., and in Chicago, Ill. Studies performed between 1947 and 1950 showed that California was an area of endemic infection for Q fever. Between 1948 and 1977, a total of 1,169 human Q fever cases were reported to the Centers for Disease Control, including 785 (67%) from California. Fewer than 30 cases were reported annually between 1978 and 1986. A cat-associated Q fever outbreak occurred in 1989 in Goldsboro, Maine. Fifteen members of one family developed acute Q fever after exposure to a parturient cat that delivered in the family home about 2 weeks before the first Q fever case was diagnosed. Of the 15 family members, 11 presented clinical manifestations compatible with acute Q fever, including fever, headache, and myalgia in all cases. All members reported contact with the parturient cat, whereas none reported recent contact with cattle, sheep, goats, or rabbits. Interestingly, this outbreak occurred in Maine, a state near maritime Canada, where the majority of cat-related Q fever outbreaks have been described (Maurin and Raoult, 1999).

B. Transmission Information:

1. From: Animals To: Human
   Mechanism: In humans, the infection usually occurs by inhaling contaminated particles from amniotic fluid or placenta, by contact with contaminated wool or materials contaminated with animal excreta, by ingestion of unpasteurized milk or milk products (Luksi et al., 2006). Many people with Q fever do not have direct contact with animals. Windborne spread is well-recognized, and studies suggest the organism can travel several kilometeres. Rural residents may be infected from trucks carrying cattle, sheep, or contaminated straw (Parker et al., 2006). The environmental survival of C. burnetii allows it to be transported by wind far away from its original source. This could account for the appearance of Q fever cases in urban areas, where an important percentage of patients fails to report direct contact with animals (Arricau-Bouvery and Rodolakis, 2005).
   
   
2. From: Human To: Human
   Mechanism: Person-to-person transmission is probably extremely rare. Although infrequent, sporadic human Q fever cases have occurred following contact with an infected parturient woman (in an obstetrician who performed an abortion on the pregnant woman), via transplacental transmission resulting in congenital infections, during autopsies, via intradermal inoculation, or via blood transfusion (Maurin and Raoult, 1999).
   
   
3. From: Ticks To: Animals
   Mechanism: C. burnetii organisms in ticks, as in mammals, are in phase I and thus are highly infectious. However, ticks are not considered essential in the natural cycle of C. burnetii infection in livestock, and animals which live in close contact have many other opportunities to become infected with C. burnetii. In contrast, ticks may play a significant role in the transmission of coxiellosis among the wild vertebrates, especially in rodents, lagomorphs, and wild birds (Maurin and Raoult, 1999). The possibility of C. burnetii being transmitted to humans via a tick bite has seldom been reported, and human Q fever as opposed to other rickettsial diseases is rarely if ever an arthropod-borne disease (Maurin and Raoult, 1999).
   
   
4. From: Tick To: Tick
   Mechanism: The transovarial transmission of C. burneti by the tick H. asiaticum was traced on three daughter generations during 751 days. The infection rate of the first generation ticks was found to be 5 times lower than that of the parental ones, of the second generations ticks--9 times lower while F3 population was characterized by 20 fold decrease in the infection rate. The transmission of C. burneti by the infected males of H. asiaticum to the females after copulation was observed in none of the 19 tests. Analysis of the material obtained has shown that the unrestrictedly long "vertical type" maintenance of the Q-rickettsiosis agent in nature is impossible (Daiter, 1977).
   
   

C. Environmental Reservoir:

1. Animal Reservoir :
   1. Description: The reservoir of C. burnetii is only partially known. Although farm animals such as cattle, goats, and sheep are considered primary reservoirs, pets including cats and dogs have also been reported to be infected, explaining urban outbreaks. When infected, all of these mammals shed the desiccation-resistant organisms in urine, feces, milk, and birth products (Brouqui and Raoult, 2001). Cats and dogs may represent reservoirs of C. burnetii (Maurin and Raoult, 1999). Domesticated ungulates, including cattle, sheep, and goats, are considered the primary reservoirs for human infection, but pets such as cats and dogs as well as ticks and other arthropods may also transmit infection (Karakousis et al., 2006).
2. C. burnetii in the environment :
   1. Survival Information: The organism can survive in the environment for long periods, with aerosols remaining infective for up to 2 weeks and contaminated soil for up to 5 months (Woldehiwet, 2004). C. burnetii withstands drying and can remain viable in contaminated soil for several years (Reimer, 1993). C. burnetii is capable of survival outside the host for extended periods of time; high-level resistance to UV radiation, heat, desiccation, pressure (50,000 psi (1 psi -6.89 kPa)), and osmotic and oxidative stress has been demonstrated (Seshadri et al., 2003).

D. Intentional Releases:

1. Intentional Release information :
   1. Description: Whether Q fever was used as a biological weapon during World War II is unclear, but many outbreaks of suspected or proven disease were reported. Most of these epidemics were linked to inhalation of presumably naturally occurring dust-borne C. burnetii. Several other outbreaks were reported in military personnel after World War II. The USA listed Q fever among the agents that can be used as weapons during its offensive biological programme that began in 1942 at Fort Detrick, MD, USA. In 1954, volunteer members of the Seventh Day Adventist Church, who wished to serve the USA without taking up arms, were exposed to aerosols of C. burnetii during the so-called Project Whitecoat. The stock-piling of bombs containing C. burnetii at some time in the USA has been speculated, but the biological warfare programme was terminated in 1969-70 by executive order. The Soviet Union's biological weapons programme was established in the late 1920s. Before World War II, Russia reportedly manufactured Q fever as a biological weapon. The programme continued through to at least the early 1990s. After the collapse of the Soviet Union, Russian President Boris Yeltsin signed a decree banning all biological weapons. Doubts have been expressed, however, about whether Russia has completely dismantled the old Soviet programme. The cult Aum Shinrinkyo, infamous for issuing a sarin gas attack on the Tokyo subway system in March, 1995, was doing research on several potential biological warfare agents, including C. burnetii, at the time it was dismantled. An outbreak of Q fever described in Oxfordshire, UK, in 1987, affected postmen. Postal workers were also victims of the anthrax bioterrrorist attacks in the USA in 2001. The outbreak in Oxfordshire was not related to bioterrorism. Although the source was never found, collection of mail from rural areas was suggested to have brought material contaminated with C. burnetii to the post office. Current high-speed mail-sorting equipment in central postal facilities has the potential to create aerosols and to widely disseminate mail contaminants (Madariaga et al., 2003). The agent is unlikely to represent a threat if used as a water or food contaminant. However, since panic is a major aim of bioterrorism, even the use of less-threatening methods of delivery might cause severe alarm in the civilian population. Q fever has sometimes been judged a trivial disease resembling influenza, but its course can be long term, with several chronic complications and with severe debility during convalescence (Madariaga et al., 2003). If used as a biological weapon in a civilian population, the degree of infectivity may rival that of anthrax, and although associated mortality will be low, Q fever can cause extensive acute and chronic morbidity (Madariaga et al., 2003).
   2. Emergency contact: Because its highly infectious nature and aerosol route of transmission make C. burnetii a potential agent of bioterrorism, human Q fever became a nationally notifiable disease in 1999. State health departments should report cases to CDC through the National Electronic Telecommunications System for Surveillance (NETSS) via event code 10255; to facilitate case reporting, Q fever case report forms are forms are available at http://www.cdc.gov/ncidod/dvrd/qfever/case_rep_fm.pdf. Additional information about Q fever is available at http://www.cdc.gov/ncidod/dvrd/qfever (Centers for Disease Control, 2002).
   3. Delivery mechanism: Interest in C. burnetii as a potential biological weapon stems from the fact that an aerosol of this agent could infect humans (Bossi et al., 2004). The possibility that C. burnetii could be used as a bioterrorism agent has resulted in renewed interest in the dynamics of aerosol transmission of this microorganism. It has been calculated that a concentration of 100 cells per m(3) and an exposure time of 30-60 min can deposit more than one cell in the lung and hence result in infection (Marrie, 2004). Additionally, another route of transmission of C. burnetii could be through sabotage of the food supply (Bossi et al., 2004).
   4. Containment: Standard precautions are recommended for hospital staff managing patients infected with C. burnetii. Precautions against exposure through contact by use of gowns and gloves, and through droplets by use of surgical masks within 3 feet of the patient because of large droplet splashes from secretions or body fluids should be taken during obstetrics procedures on infected patients. Staff handling samples suspected of containing C. burnetii must wear masks, surgical gloves, and protective gowns. Serological examinations and staining of tissue samples, although not recommended for safety reasons, can be done in biosafety level 2 cabinets. Cultures should be inoculated, manipulated, and harvested only in biosafety level 3 facilities. Spills of potentially infectious material should be decontaminated immediately by use of 0.05% hypochlorite, 5% peroxide, or phenol-based-solutions. Biohazardous waste should be decontaminated by autoclaving. Contaminated equipment or instruments can be decontaminated with approved disinfectants, or by autoclaving or boiling for 10 min. The spore-like form of C. burnetii may, however, be resistant to normal disinfection, dilute bleach, ultraviolet radiation, heat, desiccation, pressure, and osmotic and oxidative stress. Postmortem examination should avoid aerosolisation producing procedures and must be done taking respiratory precautions. Prophylaxis after exposure to infected individuals is not necessary. Individuals who have been exposed to C. burnetii or who have or are convalescing from Q fever should defer from donating blood or blood products. If an outbreak of Q fever or a potential biological attack is suspected, hospital and local public health authorities must be informed immediately. Q fever is listed by the US Centers for Disease Control and Prevention among the national notifiable infectious diseases (Madariaga et al., 2003).

III. Infected Hosts

1. Homo sapiens:
   1. Taxonomy Information:
      1. Species:
         1. Human :
            • Ontology: UMLS:C0086418
            • GenBank Taxonomy No.: 9606
            • Scientific Name: Homo sapiens (NCBI Taxonomy)
            • Description: Coxiella burnetii is an obligate intracellular bacterium that causes a worldwide zoonosis, Q fever, and can be misused as a biological warfare agent. Infection in animals (coxiellosis) is mostly persistent. Infection in humans is often asymptomatic, but it can manifest as an acute disease (usually a self-limited flu-like illness, pneumonia, or hepatitis) or as a chronic form (mainly endocarditis, but also hepatitis and chronic fatigue syndrome). C. burnetii infection in pregnant women may result in abortions, premature deliveries, and stillbirths (Kazar, 2005). Man is the only host of C. burnetii in which the Rickettsia regularly induce a clearly marked illness (Babudieri, 1959).
      
      
   2. Infection Process:
      1. Infectious Dose: When aerosolised C. burnetii is highly infectious-a sole organism can produce disease (Madariaga et al., 2003). Studies of airborne Q fever suggest that the infectious dose for man is one organism and that with larger doses each organism acts independently in the initiation of infection (Ormsbee, 1965).
      2. Description: The aerosol route is the principal mode of acquisition of C. burnetii infection in humans. Ingestion of high doses of C. burnetii via the digestive route (especially by consumption of contaminated dairy products) is considered a rare alternative for acquiring infection (Maurin and Raoult, 1999).
      
      
   3. Disease Information:
      1. Q fever :
         1. Pathogenesis Mechanism: C. burnetii probably attaches to the host cells by ankyrins, which are spectrin-binding proteins that mediate interaction of the membrane skeleton with the plasma membrane. The bacteria are internalised in the host cell by phagocytosis and remain in the phagolysosome throughout their life cycle. Coxiella can survive in the hostile environment of the phagolysosome by use of a sodium ion-proton exchanger, mechanosensitive ion channels, and transporters for osmoprotectants, which provide resistance to the acidic medium and to the osmotic stress. In addition Coxiella has greater biochemical abilities than do other intracellular bacteria and possesses enzymes for several important metabolic pathways that allow the production of nutrients and energy. Although humoral and cellular immunity play parts in controlling C. burnetii, cell-mediated immunity seems to ultimately eliminate the agent. In acute Q fever the T-lymphocyte-mediated response is very efficient; in the chronic disease this feature of cellular immunity is impaired. Different cytokines are involved in the process of clearing Coxiella infection and some of them have opposing effects-eg, interleukin 10 elicits the replication of C. burnetii in monocytes, whereas interferon gamma and tumour necrosis factor trigger C. burnetii killing. Immunological control of the infection has been reviewed elsewhere. Antibodies to phase I C. burnetii may play some part in clearing the bacteraemic stage in acute disease but they are not beneficial in the chronic stage. Furthermore, very high titres of these antibodies in the chronic phase lead to an increase in circulating immune complexes and produce pathology including glomerulonephritis and leucocytoclastic lesions (Madariaga et al., 2003).
         
         
         
         2. Incubation Period: The incubation period of Q fever may last from 2 to 3 weeks, depending on the C. burnetii inoculum (Maurin and Raoult, 1999). 2 to 6 weeks (Reimer, 1993).
         
         
         
         3. Prognosis: C. burnetii infection may present with acute or chronic clinical manifestations. However, almost 60% of Q fever cases are asymptomatic. Among the 40% of patients who are symptomatic, the majority (38% of the 40%) will experience a mild disease without the need for hospitalization. Hospitalized patients represent only 2% of infected individuals, whereas 1/10 of them (0.2%) suffer from chronic Q fever (Maurin and Raoult, 1999). Chronic Q fever is a severe illness for which the spontaneous death rate may exceed 65%. With appropriate antibiotic therapy, chronic Q fever-associated mortality may be significantly reduced, but the organism is difficult to eradicate, and a prolonged course of antibiotic treatment is necessary. In vitro data have shown that the pH within the acidified phagosomal compartment in which intracellular C. burnetii resides may be responsible for the lack of bactericidal activity of many antibiotics (Karakousis et al., 2006). In untreated patients, the prognosis of Q fever endocarditis is poor. In older studies, death was reported in 60% of patients, most probably related to diagnosis delay. Due to better treatment, prognosis has considerably improved, but Q fever endocarditis is still a severe disease with numerous relapses unless properly treated (Brouqui and Raoult, 2001).
         
         
         
         4. Diagnosis Overview: The organism may be cultured under special conditions, but isolation of C. burnetii by culture is generally not performed because of the high risk of infectivity to laboratory workers and the lack of sensitivity of the technique. Instead, serologic testing remains the most widely used diagnostic method. The specific techniques commonly used include complement fixation, indirect immunofluorescence assay or microimmunofluorescence, enzyme-linked immunosorbent assay, and microagglutination. C. burnetii exhibits antigenic phase variation (phases I and II), which is highly valuable in differentiating between acute and chronic Q fever. Acute Q fever is characterized by antibodies against phase II antigens, whereas chronic Q fever is characterized by the presence of anti-phase I antibodies, usually in the presence of anti-phase II antibodies. An IgG anti-phase I antibody titer of greater than or equal to 800 is considered diagnostic of Q fever endocarditis. High C. burnetii IgA titers were previously thought to correlate with chronic Q fever endocarditis, but a more recent study has shown that such reactions are not specific to this form of the infection (Karakousis et al., 2006). Indirect immunofluorescence is the current reference method for serological diagnosis of isolated cases of Q fever, because it is simple, readily available, and accurate. However, under the circumstances of an act of bioterrorism, this method would be difficult to scale up. In this situation ELISA is a sensitive method that might be better suited to population screening with haemolytic and anticomplementary serum samples, which may cause interpretation problems in other tests. Complement fixation antibody testing is less specific than immunofluorescence and has a poor sensitivity. It is also more time consuming and has an associated prozone effect. The test requires acute and convalescent samples. Dot immunoblotting, indirect haemolysis tests, microagglutination, RIA, and western immunoblotting have also been reported as potentially useful (Madariaga et al., 2003). The diagnosis of chronic Q fever may be delayed by many months because of the lack of specific signs and symptoms. Fever may be absent in more than 18% of cases, and vague constitutional symptoms, congestive heart failure, or valvular dysfunction may predominate. Peripheral manifestations of endocarditis including digital clubbing, purpuric rash, hepatomegaly, splenomegaly, immune complex glomerulonephritis, and embolic phenomena are common. Cardiac vegetations are visible by echocardiography in as few as 12% of patients, as these vegetations tend to be smaller and located beneath endothelial surfaces (Karakousis et al., 2006).
         
         
         
         5. Symptom Information :
            • General Description: In 1935 an outbreak of a fever of unknown etiology occurred among abattoir workers in Brisbane, Australia. R. Cilento, Director-General of Health and Medical Services for Queensland, requested E. H. Derrick, Director of the Laboratory of Microbiology and Pathology of the Queensland Health Department at Brisbane, to investigate the nature of the disease. Derrick's classic paper provided the name "Q" (for Query) fever for the disease and accurately described most of the clinical features of the infection (Baca and Paretsky, 1983). Symptomatic acute Q fever manifests primarily as a self-limited febrile illness, atypical pneumonia, or a granulomatous hepatitis, whereas endocarditis is the more common presentation of chronic Q fever. However, because the clinical manifestations of Q fever are often unspecific, the disease should be systematically considered in febrile patients with recent contact with parturient animals (Maurin and Raoult, 1999). Q fever has been rarely described in children, because C. burnetii in children infection is not apparent or causes a milder illness than it does in adults (Luksi et al., 2006).
            • Syndrome -- Acute Q fever:
              • Description: Acute Q fever cases were classified according to the principal clinical presentation as (a) undifferentiated febrile illness greater than or equal to 38 C without pneumonia or hepatitis, (b) pneumonia: pronounced respiratory symptoms and lung findings verified by x-ray, (c) hepatitis: liver transaminases at least twice the highest reference values, and (d) pneumonia and hepatitis: x-ray-verified finding in the lungs and elevated liver transaminases (Luksi et al., 2006) The disease is usually mild, as is typical for viral atypical pneumonia. Clinical signs are often lacking on physical examination. The most frequent finding is inspiratory crackles. About 5% of acute Q fever pneumonia patients have splenomegaly. Radiographic findings may include single or multiple opacities of rounded configuration, increased reticular markings, atelectasis, and pleural effusion. Complications associated with acute Q fever pneumonia are rare and may include encephalitis, renal failure, congestive heart failure, respiratory failure, and myocarditis (Maurin and Raoult, 1999).
              • Observed: The fatality rate is lower than 3%, and death often occurs in patients with previous pulmonary or cardiac defects (Maurin and Raoult, 1999).
              
              
              Symptoms Shown in the Syndrome:
              
              
              • Fever:
                • Ontology: UMLS:C0015967
                • Description: In acute Q fever patients, the fever may reach from 39 to 40 C, usually remaining elevated all day. Fever typically increases to a plateau within 2 to 4 days, and then after 5 to 14 days the temperature returns rapidly to normal. The fever is usually accompanied by severe headaches. However, in untreated patients, fever may last from 5 to 57 days. Thus, acute Q fever is a cause of prolonged fever of unknown etiology (Maurin and Raoult, 1999). Symptomatology can vary from one individual to another, but fever, usually higher than 38.5 C, is invariable present (Reimer, 1993).
                • Observed: 88-100% (Maurin and Raoult, 1999) 98.1% (Luksi et al., 2006).
              • Fatigue:
                • Ontology: UMLS:C0015672
                • Observed: 97-100% (Maurin and Raoult, 1999)
              • Headache:
                • Ontology: UMLS:C0018681
                • Observed: 68-98% (Maurin and Raoult, 1999) 86.5% (Luksi et al., 2006)
              • Sweats:
                • Ontology: UMLS:C0038984
                • Observed: 31-98% (Maurin and Raoult, 1999)
              • Cough:
                • Ontology: UMLS:C0010200
                • Observed: 24-90% (Maurin and Raoult, 1999) 63.9% (Luksi et al., 2006).
              • Chills:
                • Ontology: UMLS:C0085593
                • Description: Typical patients have acute onset of high fever, chills with rigors, severe headache and/or retroorbital pain, general malaise, and myalgia (Reimer, 1993).
                • Observed: 68-88% (Maurin and Raoult, 1999)
              • Malaise:
                • Ontology: UMLS:
                • Description: Although symptoms frequently disappear in 10 days, a feeling of general malaise might persist for months (Madariaga et al., 2003).
                • Observed: 74.2% (Luksi et al., 2006).
              • Myalgia:
                • Ontology: UMLS:C0231528
                • Observed: 47-69% (Maurin and Raoult, 1999) 50.3% (Luksi et al., 2006)
              • Pneumonia and Hepatitis:
                • Ontology: UMLS:
                • Description: Acute Q fever presents as a nonspecific febrile illness, with pneumonia and/or hepatitis, with other organ systems less frequently involved (Luksi et al., 2006). Clinically, Q fever most commonly presented with pneumonia and hepatitis (Luksi et al., 2006).
                • Observed: 60% (Luksi et al., 2006).
              • Hepatomegaly:
                • Ontology: UMLS:
                • Observed: 54.2% (Luksi et al., 2006).
              • Nausea:
                • Ontology: UMLS:C0027497
                • Description: Additional symptoms may include chest pain, cough nausea, vomiting, and diarrhea (Reimer, 1993).
                • Observed: 22-49% (Maurin and Raoult, 1999)
              • Chest pain:
                • Ontology: UMLS:C0008031
                • Observed: 10-45% (Maurin and Raoult, 1999)
              • Vomiting:
                • Ontology: UMLS:C0042963
                • Observed: 13-42% (Maurin and Raoult, 1999)
              • Pneumonia:
                • Ontology: UMLS:
                • Description: Acute Q fever presents as a nonspecific febrile illness, with pneumonia and/or hepatitis, with other organ systems less frequently involved (Luksi et al., 2006). Pneumonia was the principal clinical presentation in Q fever epidemics in northern Croatia, Switzerland, some regions of Spain, and on the island of Crete, whereas hepatitis was more frequently recorded in France and California, USA. Q fever may vary in its clinical presentation between two regions of the same country, e.g. Canada, where hepatitis is more common in Ontario and pneumonia in Nova Scotia (Luksi et al., 2006).
                • Observed: Pneumonia was observed in 85.8% and hepatitis in 69.0% of Q fever cases (Luksi et al., 2006). Q fever is usually described as an atypical pneumonia, although the actual incidence of respiratory illness with infection ranges widely, from few affected patients to greater than 90%. Pneumonia occurs less frequently with disease acquired from research facilities than with disease acquired from other sporadic exposures (Reimer, 1993).
              • Diarrhea:
                • Ontology: UMLS:C0011991
                • Observed: 5-22% (Maurin and Raoult, 1999)
              • Hepatitis:
                • Ontology: UMLS:C0019158
                • Description: Hepatitis can be symptomatic or clinically silent. It might be manifested only by chemical abnormalities. However, there could be disparity between functional tests and histological reaction, and patients with mildly raised enzymes may have focal hepatocellular necrosis with infiltration of round cells and eosinophils in the pathology. More severe cases have liver-cell necrosis with granulomata (Madariaga et al., 2003). Acute Q fever presents as a nonspecific febrile illness, with pneumonia and/or hepatitis, with other organ systems less frequently involved (Luksi et al., 2006). Acute Q fever may also present as hepatitis with features suggestive of viral hepatitis (Reimer, 1993).
                • Observed: 9.0% (Luksi et al., 2006). Pneumonia was observed in 85.8% and hepatitis in 69.0% of Q fever cases. Pneumonia was the principal clinical presentation in Q fever epidemics in northern Croatia, Switzerland, some regions of Spain, and on the island of Crete, whereas hepatitis was more frequently recorded in France and California, USA. Q fever may vary in its clinical presentation between two regions of the same country, e.g. Canada, where hepatitis is more common in Ontario and pneumonia in Nova Scotia (Luksi et al., 2006).
              • Splenomegaly:
                • Ontology: UMLS:C0038002
                • Description: Physical signs of infection often include hepatomegaly and splenomegaly (Reimer, 1993)
                • Observed: About 5% (Maurin and Raoult, 1999) 14.2% (Luksi et al., 2006).
              • Rash:
                • Ontology: UMLS:
                • Description: In contrast to physical signs of other rickettsial diseases, rash is distinctly unusual (Reimer, 1993). The Q fever rash is nonspecific and may correspond to pink macular lesions or purpuric red papules of the trunk (Maurin and Raoult, 1999).
                • Observed: 2.6% (Luksi et al., 2006). Skin lesions have been found in 5 to 21% of Q fever patients in different series (Maurin and Raoult, 1999).
              • Pericarditis:
                • Ontology: UMLS:C0031046
                • Description: Pericarditis usually occurs as a clinical manifestation of acute Q fever and may be associated with concomitant myocarditis or pleuritis. Clinical manifestations of Q fever pericarditis are not specific and most often correspond to a fever with thoracic pain. An electrocardiogram may reveal abnormalities, especially on T wave, whereas an echocardiogram may show the presence of pericardial effusion. Although the disease usually resolves spontaneously, recurrent forms have been described. Pericarditis may also be associated with Q fever endocarditis in chronically infected patients (Maurin and Raoult, 1999).
                • Observed: Approximately 1% of Q fever cases diagnosed (Maurin and Raoult, 1999).
              • Meningoencephalitis:
                • Ontology: UMLS:C0025309
                • Description: A few cases of encephalitis, meningoencephalitis, and encephalomyelitis have been reported to occur late in the course of acute Q fever (Maurin and Raoult, 1999). Cerebrospinal fluid examination may reveal the presence of leukocytes, composed mainly of mononuclear cells, increased protein concentration, and usually normal glucose concentration. Such clinical manifestations, however, should be differentiated from embolic manifestations in Q fever endocarditis patients. The most common residual disorder of Q fever meningitis is disturbance of vision (Maurin and Raoult, 1999).
                • Observed: Approximately 1% of Q fever cases diagnosed (Maurin and Raoult, 1999).
              • Myocarditis:
                • Ontology: UMLS:C0027059
                • Description: Myocarditis is a rare but life-threatening clinical manifestation of acute Q fever (Maurin and Raoult, 1999). In most patients, myocarditis is revealed only by abnormalities on the electrocardiogram. Thus, it is probable that myocarditis is an underestimated clinical manifestation of Q fever disease. The most frequent electrocardiogram abnormality is T-wave change. Myocarditis may also be revealed clinically through tachycardia, hypoxemia requiring ventilatory support, and cardiac failure, which may lead to death (Maurin and Raoult, 1999).
                • Observed: 0.5-1% of Q fever cases diagnosed (Maurin and Raoult, 1999).
            • Syndrome -- Chronic Q Fever-Endocarditis:
              • Description: Chronic Q fever generally manifests as endocarditis, vascular graft or aneurysm infection, or chronic hepatitis or osteoarthritis, and has a very poor prognosis (Luksi et al., 2006). Most consider chronic disease to imply the presence of endocarditis, but in one series of 16 patients, 7 had endocarditis, 2 had possible other intravascular graft infections, and 7 had chronic febrile illnesses with high serologic titers for Q fever but no specific organ involvement (Reimer, 1993). Chronic Q fever may develop many months to years after initial infection, manifesting as bacterial culture-negative endocarditis in up to 75% of cases. Chronic Q fever occurs almost exclusively in patients with predisposing conditions, including those with heart valve lesions, vascular abnormalities, and immunosuppression. In addition to endocarditis, chronic Q fever less frequently presents as vascular infections, osteoarticular infections, chronic hepatitis, chronic pulmonary infections, and chronic fatigue syndrome. Over 90% of Q fever endocarditis cases occur in persons with underlying heart disease, which may be congenital, rheumatic, degenerative, or syphilitic or may involve prosthetic valves (Karakousis et al., 2006)
              • Observed: A small number of patients, probably fewer than 1% of those infected with C. burnetii, do not clear the organism and develop disease long after the initial illness or exposure (Reimer, 1993).
              
              
              Symptoms Shown in the Syndrome:
              
              
              • Endocarditis:
                • Ontology: UMLS:
                • Description: The best-described chronic entity with C. burnetii is endocarditis. Symptoms begin gradually as long as 1 to 20 years after initial infection. Endocarditis tends to occur in older patients (average age of 50), with the majority being males. Symptoms are present for several months before medical care is sought, by which time patients have typical manifestations of endocarditis: fever, hepatomegaly, splenomegaly, elevated liver function test results, microscopic hematuria, hypergammaglobulinemia, thrombocytopenia, petechiae, splinter hemorrhages, clubbing, and occasional evidence of emboli. About 90% of the time, patients with endocarditis have either a history of or current findings suggesting valvular heart disease. Almost half of all cases involve both valves, and the rest have not been specified. Unlike other causes of endocarditis and characteristic of this infection, routine blood cultures are negative. In any patient population with potential animal exposure, Q fever should always be considered a possible cause of culture-negative endocarditis, and appropriate serologic tests should be obtained (Reimer, 1993).
                • Observed: Culture-negative endocarditis is the most prevalent chronic form and represents 78% of cases of chronic Q fever (Brouqui and Raoult, 2001). Whereas C. burnetii accounts for 3% of all endocarditis cases diagnosed in England and Wales and at least 5% of cases in France, there have been only seven reported cases of Q fever endocarditis in the United States (Karakousis et al., 2006). However, the true number of chronic Q fever cases in the United States is unknown and is likely under represented in the literature, since many cases may have occurred prior to the advent of national reporting in 1999. In addition, patients with endocarditis may have received multiple antibiotics prior to valve replacement, making isolation of the organism from infected tissue less likely (Karakousis et al., 2006).
            • Syndrome -- Chronic Q Fever-Osteoarticular infections:
              • Description: Three types of C. burnetii osteoarticular infections, including osteomyelitis, osteoarthritis, and aortic graft infection with contiguous spinal osteomyelitis, have been reported. C. burnetii infection of bones has been found more frequently in children suffering from coxitis or spondylodiskitis and is not associated with specific host factors in this population. Bone infections have also been reported in adults who are immunocompromised or have a joint prosthesis (Maurin and Raoult, 1999).
              • Observed: C. burnetii osteoarticular infection is probably an under reported disease. Five (4%) of the 200 chronic Q fever cases diagnosed in Unite des Rickettsies laboratory were osteomyelitis (Maurin and Raoult, 1999).
            • Syndrome -- Chronic Q Fever-Pulmonary infections:
              • Description: Chronic lung involvement is rare and may correspond to pulmonary fibrosis or pseudotumors. Pneumonic fibrosis has been reported as a complication of chronic Q fever in the former USSR. Inflammatory pseudotumor of the lung was first described by Janigan and Marrie. The disease may radiologically mimic lung neoplasm and may lead to lung tissue resection. In the case described by Janigan and Marrie, histological examination of resected lung specimens revealed the presence of mononuclear cells obstructing the bronchioles and infiltrating the alveoli and septa (Maurin and Raoult, 1999).
              • Observed: In Unite des Rickettsies series of 200 chronic Q fever patients, only 2 (1%) presented with pseudotumor of the lungs and none presented with lung fibrosis (Maurin and Raoult, 1999).
            • Syndrome -- Chronic Q Fever-Vascular infections:
              • Description: C. burnetii vascular infection is a rare but life-threatening condition (Maurin and Raoult, 1999). Most cases have been reported over recent years because of improved knowledge and recognition of the disease by clinicians (Maurin and Raoult, 1999). Thus, among the 13 C. burnetii vascular infection cases reported in the literature, 10 have been diagnosed in Unite des Rickettsies laboratory and 7 have been diagnosed in the past 7 years. The patients were usually men aged of 66.5 plus or minus 11.5 years (mean +/- standard deviation) with a previous aortic abnormality (mainly infrarenal aneurysm or vascular graft), and a history of environmental exposure. Almost all patients presented with a severe inflammatory syndrome, including a highly elevated erythrocyte sedimentation rate and high levels of C-reactive protein and fibrinogen in serum. A total of 70% were febrile at presentation (Maurin and Raoult, 1999).
              • Observed: In authors experience, 7 (3%) of 200 cases of chronic Q fever diagnosed in Unite des Rickettsies laboratory were vascular infections; however, the disease is probably under reported (Maurin and Raoult, 1999).
            • Syndrome -- Chronic Q Fever-Hepatitis:
              • Description: Although chronic Q fever involvement of the liver is frequently associated with endocarditis, a few cases of chronic hepatitis without Q fever endocarditis have been described (Maurin and Raoult, 1999). The fact that diagnosis of Q fever endocarditis based on echocardiographic examination of cardiac valves is often difficult to establish means that diagnosis of chronic hepatitis without endocarditis should always be regarded with caution (Maurin and Raoult, 1999).
              • Observed: Only one case of chronic hepatitis without endocarditis was diagnosed in Unite des Rickettsies laboratory among 200 chronic Q fever cases (Maurin and Raoult, 1999).
            • Syndrome -- Q fever fatigue syndrome:
              • Description: A non-fatal, but debilitating complication of Q fever is a disorder similar to chronic fatigue syndrome. An assessment of its incidence has been hampered by debate about its existence and by inadequately designed studies. Q fever fatigue syndrome has been reported in Australia since 1990, and the disorder has a definition accepted by an international working group. The syndrome is characterised by fatigue, myalgia, arthralgia, night sweats, and changes in mood and sleep pattern. Up to 20% of acute primary Q fever cases may develop chronic fatigue. This syndrome may be caused by cytokine dysregulation, particularly by raised concentrations of interleukin 6 (Madariaga et al., 2003). Characteristically, such patients complained of fatigue, sweating, breathlessness on exertion, and blurring of vision; in some patients, these symptoms persisted for many years. Harvey-Sutton also reported the possibility of bradycardia. Thus, human C. burnetii infection may induce a persistent debilitating syndrome in convalescing patients, as is occasionally observed in patients with chronic typhoid fever or chronic brucellosis. The post-Q fever chronic fatigue syndrome should, however, be distinguished from chronic Q fever disease (especially Q fever endocarditis), including the demonstration of the absence or low level of anti-phase I antibodies in the former patients (Maurin and Raoult, 1999).
              • Observed: Chronic fatigue syndrome has been reported infrequently as a possible clinical manifestation following acute Q fever. The disease was first documented in Australia in abattoir workers who had probable recurrent contact with C. burnetii-infected animals (Maurin and Raoult, 1999).
            • Syndrome -- Chronic Q Fever-Pregnancy Complications:
              • Description: If contracted during pregnancy, Q fever can lead to miscarriage and neonatal death, premature births, and low birth weight, but it can also be asymptomatic. Infection during the first trimester results in miscarriage, and in the second trimester it mostly results in prematurity. Chronic Q fever can develop during pregnancy irrespective of treatment (Madariaga et al., 2003). Q fever during pregnancy corresponds mainly to placentitis. C. burnetii was recovered by culture from 12 of 19 placentas examined. The pathogenesis of fetal disease remains unexplained. Immune complexes, which are frequent during Q fever disease, may lead to vasculitis or vascular thrombosis and placental insufficiency. However, C. burnetii may cause direct fetal injury (Maurin and Raoult, 1999).
              • Observed: Twenty-seven Q fever cases during pregnancy have been reported so far in France, the United Kingdom, the United States, Italy, Czechoslovakia, Israel, and Canada. The cases were in females aged between 18 and 39 years. Premature birth was reported in eight cases (i.e., 25.9%), and one healthy premature infant (1.88 kg) was born after cesarean delivery because of maternal illness. Chronic Q fever in a woman was responsible for recurrent cases of premature birth. Spontaneous abortion was reported in six cases (i.e., 22.2%) (Maurin and Raoult, 1999).
         
         
         6. Treatment Information:
            • Tetracycline: The tetracyclines are still considered the mainstay of antibiotic therapy of acute Q fever, whereas antibiotic combinations administered over prolonged periods are necessary to prevent relapses in Q fever endocarditis patients (Maurin and Raoult, 1999).
              • Applicable: Tetracyclines are still the best for treating acute Q fever (Maurin and Raoult, 1999).
              • Contraindicator: Tetracyclines are contraindicated in patients hypersensitive to any of the tetracyclines (AHFS, 2006).
              • Complication: The most frequent adverse reactions to tetracyclines are dose-related GI effects including nausea, vomiting; diarrhea, bulky loose stools, anorexia, flatulence, abdominal discomfort, and epigastric burning and distress (AHFS, 2006).
              • Success Rate: Although tetracycline administered at 500 mg four times a day (q.i.d.) reduced the duration of fever by 50%, antibiotic treatment had to be started during the first 3 days of the illness to be effective (Maurin and Raoult, 1999).
            • Doxycycline: Doxycycline at 200 mg daily for 14 days is the current recommended regimen for acute Q fever (Maurin and Raoult, 1999).
              • Applicable: For treatment of acute Q fever, doxycycline is the drug of choice. Initiation of therapy is warranted in patients with disease demonstrating clinical and epidemiologic features compatible with Q fever. Because antibiotic treatment is most effective during the early phase of the illness, treatment should not be withheld pending results of confirmatory laboratory antibody tests, which provide a retrospective diagnosis. For patients with pre-existing valvular disease, progression of acute disease to endocarditis is best prevented by combination long-term therapy with doxycycline and hydroxychloroquine. This regimen also is recommended for patients with active Q fever endocarditis. If the infection does not resolve with antibiotic therapy, the patient might require excision and replacement of the damaged heart valve; however, this will not necessarily ensure elimination of C. burnetii, and the new valve might fail if appropriate antimicrobial treatment is not initiated or is withdrawn prematurely (Centers for Disease Control, 2002).
              • Contraindicator: Although doxycycline remains the preferred antibiotic in the treatment of acute Q fever, its administration should be limited in patients with gastric intolerance and is contraindicated in children of less than 8 years old and in pregnant women (Maurin and Raoult, 1999).
              • Complication: The most frequent adverse reactions to tetracyclines are dose-related GI effects including nausea, vomiting; diarrhea, bulky loose stools, anorexia, flatulence, abdominal discomfort, and epigastric burning and distress (AHFS, 2006).
              • Success Rate: In a nonrandomized comparison of acute Q fever treatments, the mean duration of fever was 3.3 days in untreated patients, 2 days in patients treated with tetracycline at 500 mg q.i.d. and 1.7 days in patients receiving doxycycline at 100 mg twice a day (b.i.d.) (Maurin and Raoult, 1999).
            • Doxycycline and hydroxychloroquine.: For the treatment of acute Q fever in patients with preexisting valvular heart disease, the CDC recommends a doxycycline dosage of 200 mg daily given in conjunction with hydroxychloroquine (465 mg (600 mg of hydroxychloroquine sulfate) daily; dosage adjusted to maintain plasma concentrations at 1 +/- 0.2 mcg/mL); the recommended duration of treatment is 1 year to prevent progression of acute disease to endocarditis. For the treatment of chronic Q fever endocarditis, the same regimen of doxycycline and hydroxychloroquine should be given for 1.5-3 years (AHFS, 2006).
              • Applicable: Chronic Q fever endocarditis (Raoult et al., 1999).
      
      
   4. Prevention:
      1. Preventing infection of animals:
         • Description: Q-fever control and prevention measures have been reviewed. Apart from the thorough control of imported domestic animals, raw materials, and movement of domestic animals within a country, prevention measures should include adequate disinfection and disposal of animal products of conception and strict hygienic measures in cattle, sheep, and goat farms; plants processing products of these animals; boiling or pasteurization of milk at 62.8 C for 30 minutes or at 71.7 C for 15 seconds; and vaccination (Serbezovet al., 1999). For vaccination of domestic animals, corpuscular phase I (in Slovakia) or phase II (e.g., in France) were used. The fact that phase-II vaccine did not protect goats from shedding C. burnetii in milk (30) confirmed that an effective Q-fever vaccine should consist of or be prepared from phase-I C. burnetii. Efficient recombinant vaccines, however, should also be pursued (Serbezovet al., 1999).
         • Efficacy:
           • Rate: Mass vaccination of cattle in Slovakia in the 1970s, followed by selective vaccination of cattle in serologically positive herds and elimination of positive reactors in the 1980s could lessen not only distribution of C. burnetii among domestic animals, but also its transmission to humans. However, absence of vaccination of domestic animals in Bulgaria could contribute to the maintenance of C. burnetii and therefore to increased possibility of human infection, though basic natural conditions for circulation of this agent in either country have been similar. Moreover, gradual changes in agriculture in Slovakia during the 1990s resulted in reduced numbers of cattle and sheep but not in the dramatic increase in goat numbers seen in Bulgaria after the collapse of state farms and cooperative units. One can conclude that in Bulgaria there is a permanent threat of more Q-fever outbreaks unless preventive measures, including improvement of veterinary services and vaccination of domestic animals, particularly goats, are established. In Slovakia, because of surveillance, veterinary control, and vaccination of domestic animals, the situation is much better; however, attention should still be paid to avoid introduction of C. burnetii by imported animals and raw materials and the possibility of coxiellosis outbreaks among domestic animals and consequently Q fever in humans (Serbezovet al., 1999).
      2. Postexposure Chemoprophylaxis:
         • Description: If exposure of field troops to aerosolised Q fever is a concern, use of aerosol-cloud detectors and respirators might be necessary. Postexposure chemoprophylaxis after a biological attack might be considered for individuals or groups who have essential roles, and for those classified as being at high risk of acute disease in epidemiological analyses, but is not recommended for the general public. Postexposure prophylaxis would be most effective if the size of the inoculum is small and the period of incubation delayed. Chemoprophylaxis with tetracycline 500 mg every 6 h or doxycycline every 12 h for 5-7 days is effective if begun 8-12 days after exposure. Chemoprophylaxis is not effective and might prolong the onset of disease if given earlier than 7 days after exposure (Madariaga et al., 2003).
      3. Vaccination:
         • Ontology: UMLS:C0872996
         • Description: At present, three types of Q-fever vaccine are available for human use: a Formalin-inactivated whole-cell phase-I C. burnetii vaccine used in Australia, a chloroform-methanol residue subunit of phase-I C. burnetii recommended by American authors, and Q-fever chemovaccine (a soluble subunit vaccine obtained by treatment with trichloroacetic acid of phase-I cells) developed and used in Romania and the former Czechoslovakia (Serbezovet al., 1999). A formalin-inactivated Q fever vaccine (Q-Vax; Commonwealth Serum Laboratories), prepared from phase I C. burnetii Henzerling strain, was approved for the general market in Australia in March 1989 (Maurin and Raoult, 1999). Vaccination should be recommended for such patients who are specifically exposed, but currently an effective vaccine is available only in Australia (Brouqui and Raoult, 2001).
         • Efficacy:
           • Rate: Since Q fever in humans is often an occupational hazard, vaccination should be considered primarily in exposed populations. Thus, Q fever vaccine should be recommended for livestock handlers, processors of animal products (including abattoir workers), persons in contact with dairy products, veterinarians, and laboratory personnel working with C. burnetii-infected animals, especially pregnant sheep. However, recent epidemiological investigations have shown that Q fever cases are increasingly reported in urban areas, especially in persons in contact with pets during parturition. Thus, vaccination should probably be considered in persons not professionally exposed but at risk for chronic Q fever, including patients with cardiac valve defects, vascular aneurysms, or prostheses and immunocompromised patients. However, investigations into the prophylactic effectiveness and safety of a Q fever vaccine in such populations are lacking. A single-dose vaccine is currently recommended because more frequent local and systemic reactions are likely when repeat injections are performed (Maurin and Raoult, 1999). Vaccine use in Australian abattoirs costs US$4699 per quality-adjusted life-year (QALY) gained (Parker et al., 2006).
           • Duration: Recent investigations of abattoir workers in the same country, using the Q-Vax vaccine, have shown 100% protection for at least 5 years, although natural Q fever infection supervened in 2 of 2,553 vaccinated subjects in the latter investigation a few days following vaccination, before specific immunity had developed (Maurin and Raoult, 1999).
         • Contraindicator: To prevent severe postvaccination reactions (including local erythema, induration, granulomas, sterile abscesses, and systemic reactions), vaccination should not be performed in patients previously sensitized by natural Q fever infection. Ideally, both humoral and cellular immune responses to C. burnetii should be assessed prior to vaccination. Skin and lymphocyte proliferation tests have been reported to be more predictive of postvaccination adverse effects than is serology (Maurin and Raoult, 1999).
         • Complication: Although highly immunogenic, this type of vaccine may induce adverse effects, especially when administered in previously infected populations (Maurin and Raoult, 1999).
      
      
   5. Model System:
      1. Murine model of aerosol infection:
         1. Ontology: UMLS:C0025929
         2. Model Host: BALB/c (Stein et al., 2005)
         3. Model Pathogens:
            • Coxiella burnetii . C. burnetii prototype strains Nine Mile phase I and Q 212 phase I (Stein et al., 2005).
         4. Description: Authors used an aerosol exposure apparatus to challenge immunocompetent (BALB/c) and severe combined immunodeficient (SCID) mice with two different strains (strain Nine Mile and strain Q 212) of C. burnetii at two different inocula. Pathological lesions and dissemination of the bacteria were related to the size of the inoculum. SCID mice showed major pulmonary lesions, whereas similarly infected BALB/c mice were more able to eliminate the bacteria. Pathological differences were found between the strains, with Nine Mile showing more severe histological lesions and quantified spread of bacteria (Stein et al., 2005).
      2. A guinea pig model for Q fever endocarditis:
         1. Ontology: UMLS:C0085979
         2. Model Host: Hartley guinea pigs (La Scola et al., 1998).
         3. Model Pathogens:
            • Coxiella burnetii . Coxiella burnetii Nine Mile phase I strain (La Scola et al., 1998).
         4. Description: The ready susceptibility of guinea pigs to infection by C. burnetii has made the animal a useful model for studying the pathobiology of Q fever. Guinea pigs infected with a low-virulence strain of C. burnetii (Grita M-44) developed mild endocarditis, hepatitis, and granulomatic and necrotic livers. Animals infected with the more virulent Nine Mile strain had elevated blood glucose and greater activities in serum of alkaline phosphatase, glutamic oxalacetic transaminase, and ,B-hydroxybutyric dehydrogenase 3 to 5 days p.i.; creatine phosphokinase activity increased both 3 and 10 days p.i. At 10 days p.i. hypoglycemia, hypophosphemia, splenomegaly, and hepatomegaly developed. Epicarditis with myocardial lesions became visible at 6 days p.i. Experimentally induced respiratory infection in guinea pigs resulted in interstitial pneumonia accompanied by lesions of lungs, spleen, liver, and heart, lymphoreticular myocarditis, and splenomegaly (Baca and Paretsky, 1983). A new model of experimental endocarditis, using electrocoagulation of native aortic valves, was used for the study of Q fever endocarditis. In the 20 guinea pigs electrocoagulated and inoculated with Coxiella burnetii Nine Mile phase I strain, 10 presented with infective endocarditis. Of these, 7 died spontaneously. All guinea pigs with endocarditis presented with blood cultures positive for C. burnetii, and C. burnetii antigen was found in their cardiac valves. Positive blood cultures or valvular immunopositive cells were not identified in either nonelectrocoagulated or noninoculated controls. This experimental model demonstrates that Q fever in an animal with previously damaged valves results in endocarditis (La Scola et al., 1998).
      3. Monkey models of acute Q fever after aerosol exposure to phase-I Coxiella burnetii:
         1. Ontology: UMLS:C0026447
         2. Model Host: Macaca fascicularis, Macaca mulatta (Waag et al., 1999)
         3. Model Pathogens:
            • Coxiella burnetii . Coxiella burnetii Henzerling phase I strain (Waag et al., 1999).
         4. Description: METHODS: Both species of monkeys were challenged with aerosolized 10(5) virulent phase-I Coxiella burnetii Henzerling strain, and clinical and serologic responses were determined. RESULTS: Radiographic changes were observed in seven of eight monkeys of both species; however, changes in cynomolgus monkeys tended to be more significant. Between 7 and 10 days after challenge, all rhesus monkeys and 88% of cynomolgus monkeys were bacteremic. Sequential increases in antibody responses to C. burnetii phase-I and phase-II whole cells and phase-I lipopolysaccharide were observed in both species. Although the maximal rectal temperature increase was similar in both species, duration of fever was slightly longer in rhesus monkeys. Clinical features were similar to those described in human acute Q fever patients (Waag et al., 1999).
2. Vertebrata:
   1. Taxonomy Information:
      1. Species:
         1. African buffalo :
            • Ontology: UMLS:C0325254
            • GenBank Taxonomy No.: 9970
            • Scientific Name: Syncerus caffer (NCBI Taxonomy)
            • Description: Antibodies to Coxiella burnetii were recorded from approximately 13% of 469 ungulates which had been examined by means of micro-CFT (complement fixation test) (Schroder, 1998). 1 out of 8 Syncerus caffer was positive for C. burnetii (Schroder, 1998).
         2. American black bear :
            • Ontology: UMLS:C0325019
            • GenBank Taxonomy No.: 9643
            • Scientific Name: Ursus americanus (NCBI Taxonomy)
            • Description: Sera obtained from 66 free-ranging Florida black bears (Ursus americanus floridanus) from three geographic areas of Florida (USA) between November 1993 and August 1995 were tested for antibodies to 13 disease agents. Antibody prevalences were 3 positive of 37 tested (8%) for Coxiella burnetii (Dunbar et al., 1998).
         3. American moose :
            • Ontology: UMLS:C0325226
            • GenBank Taxonomy No.: 9854
            • Scientific Name: Alces alces americana (NCBI Taxonomy)
            • Description: Moose are found only in the northern parts of North America and Eurasia. We are not aware of previous reports of C. burnetii infection of moose. Sixteen percent of the moose in our study had antibodies for C. burnetii phase I antigen. The antibody titers were very high; 8% had a titer greater than or equal to 1:32 (Marrie et al., 1993).
         4. Alpaca :
            • Ontology: UMLS:C0002186
            • GenBank Taxonomy No.: 30538
            • Scientific Name: Lama pacos (NCBI Taxonomy)
            • Description: Antibodies to Coxiella burnetii were recorded from approximately 13% of 469 ungulates which had been examined by means of micro-CFT (complement fixation test) (Schroder, 1998). 1 out of 9 Lama guanicoe f. pacos was positive for C. burnetii (Schroder, 1998).
         5. Arabian camel :
            • Ontology: UMLS:C0013127
            • GenBank Taxonomy No.: 9838
            • Scientific Name: Camelus dromedarius (NCBI Taxonomy)
            • Description: Q-fever-seropositive blood samples were taken from 11 Arab camel and 4 Arab cattle breeders (seroprevalence 1%). Being a camel breeder was associated with Q-fever seropositivity in humans (OR=9). Camels had the highest Q-fever seroprevalence (80%) among livestock species (Schelling et al., 2003).
         6. Armenian hamster :
            • Ontology: UMLS:C0018558
            • GenBank Taxonomy No.: 10032
            • Scientific Name: Cricetulus migratorius (NCBI Taxonomy)
            • Description: Grey hamsters (Cricetulus migratorius) were found naturally infected with C. burnetii in Czechoslovakia (Burgdorfer et al., 1963).
         7. Asiatic black bear :
            • Ontology: UMLS:C0325020
            • GenBank Taxonomy No.: 9642
            • Scientific Name: Ursus thibetanus (NCBI Taxonomy)
            • Description: One hundred and thirty-four (26%) of 511 sera from 11 wild animal species in eight prefectures in Japan had antibody titers to Coxiella burnetii by the enzyme-linked immunosorbent assay. High prevalences were observed in Japanese black bears (Ursus thibetanus) (78%), Hokkaido deer (Cervus nippon yesoensis) (69%), Japanese hares (Lepus brachyurus) (63%), Japanese deer (Cervus nippon centralis) (56%), and to some extent in Japanese monkeys (Macaca fuscata) (28%) (Ejercito et al., 1993).
         8. Asiatic elephant :
            • Ontology: UMLS:C0325155
            • GenBank Taxonomy No.: 9783
            • Scientific Name: Elephas maximus (NCBI Taxonomy)
            • Description: Antibodies to Coxiella burnetii were recorded from approximately 13% of 469 ungulates which had been examined by means of micro-CFT (complement fixation test) (Schroder, 1998). 1 out of 10 Elephas maximus was positive for C. burnetii (Schroder, 1998).
         9. Aurochs :
            • Ontology: UMLS:C0325251
            • GenBank Taxonomy No.: 9909
            • Scientific Name: Bos primigenius (NCBI Taxonomy)
            • Description: Antibodies to Coxiella burnetii were recorded from approximately 13% of 469 ungulates which had been examined by means of micro-CFT (complement fixation test) (Schroder, 1998). 1 out of 10 Bos primigenius f. taurus were positive for C. burnetii (Schroder, 1998).
         10. Bactrian camel :
             • Ontology: UMLS:C0325203
             • GenBank Taxonomy No.: 9837
             • Scientific Name: Camelus bactrianus (NCBI Taxonomy)
             • Description: Antibodies to Coxiella burnetii were recorded from approximately 13% of 469 ungulates which had been examined by means of micro-CFT (complement fixation test) (Schroder, 1998). 2 out of 8 Camelus ferus f. bactrianus were positive for C. burnetii (Schroder, 1998).
         11. Bank vole :
             • Ontology: UMLS:C0686895
             • GenBank Taxonomy No.: 51090
             • Scientific Name: Clethrionomys glareolus (NCBI Taxonomy)
             • Description: The bank vole (Clethrionomys glareolus) was found naturally infected with C. burnetii in Czechoslovakia (Burgdorfer et al., 1963).
         12. Barbary striped grass mouse :
             • Ontology: UMLS:C1017841
             • GenBank Taxonomy No.: 54111
             • Scientific Name: Lemniscomys barbarus (NCBI Taxonomy)
             • Description: Two species of mice, Apodemus sylvaticus and Lemnisomys barberus, were also found naturally infected in Morocco (Babudieri, 1959).
         13. Bighorn sheep :
             • Ontology: UMLS:C0325319
             • GenBank Taxonomy No.: 37174
             • Scientific Name: Ovis canadensis (NCBI Taxonomy)
             • Description: Of the 268 bighorn sheep tested 109 were male and 159 female. Twenty-seven bighorn tested positive (11 male and 16 female), 25 having titers of 1:20, 1 each had titers of 1:40 and 1:80. None of the animals appeared ill (DeForge and Cone, 2006).
         14. Black rat :
             • Ontology: UMLS:C0682511
             • GenBank Taxonomy No.: 10117
             • Scientific Name: Rattus rattus (NCBI Taxonomy)
             • Description: Field rat (Rattus rattus, Rattus norvegicus). 3/21 tested were sero-positive for Q fever
         15. Black rhinoceros :
             • Ontology: UMLS:C0325185
             • GenBank Taxonomy No.: 9805
             • Scientific Name: Diceros bicornis (NCBI Taxonomy)
             • Description: Antibodies to Coxiella burnetii were recorded from approximately 13% of 469 ungulates which had been examined by means of micro-CFT (complement fixation test) (Schroder, 1998). 1 out of 2 Diceros bicornis was positive for C. burnetii (Schroder, 1998).
         16. Black-tailed jackrabbit :
             • Ontology: UMLS:C1013736
             • GenBank Taxonomy No.: 48087
             • Scientific Name: Lepus californicus (NCBI Taxonomy)
             • Description: Coxiella burnetii was isolated from Oryctolagus cuniculus (rabbit) in Spain and Morocco in 1952 and 1956, respectively. Sidwell and others used a complement fixation test to determine phase II antibody titers in a large number of wild animals in Utah. Four hundred forty-six of 2,770 jackrabbits (16%) (Lepus californicus) has such antibodies (Marrie et al., 1993).
         17. Brazilian tapir :
             • Ontology: UMLS:C0325181
             • GenBank Taxonomy No.: 9801
             • Scientific Name: Tapirus terrestris (NCBI Taxonomy)
             • Description: Antibodies to Coxiella burnetii were recorded from approximately 13% of 469 ungulates which had been examined by means of micro-CFT (complement fixation test) (Schroder, 1998). 1 out of 1 Tapirus terrestris was positive for C. burnetii (Schroder, 1998).
         18. Brown bear :
             • Ontology: UMLS:C0325021
             • GenBank Taxonomy No.: 9644
             • Scientific Name: Ursus arctos (NCBI Taxonomy)
             • Description: Sera from 22 (13 wild and nine captive) European brown bears (Ursus arctos) from Croatia were tested to 18 viral and rickettsial agents. Serologic evidence of exposure was found to the following agents (number positive/number examined): Bhanja virus (3/15), Tahyna virus (3/15), West Nile virus (4/15), Naples sandfly fever virus (1/15), human adenovirus (1/22), influenza A (1/22) and B (1/22) virus, cytomegalovirus (1/22), parainfluenza virus 1 (2/22), Chlamydia psittaci (1/22), Coxiella burnetii (2/22), and canine parvovirus 2 (CPV-2) (7/22) (Madic et al., 1993).
         19. Burchell's zebra :
             • Ontology: UMLS:C0325175
             • GenBank Taxonomy No.: 200155
             • Scientific Name: Equus burchellii antiquorum (NCBI Taxonomy)
             • Description: Antibodies to Coxiella burnetii were recorded from approximately 13% of 469 ungulates which had been examined by means of micro-CFT (complement fixation test) (Schroder, 1998). 3 out of 17 Equus quagga antiquorum were positive for C. burnetii (Schroder, 1998).
         20. Bushy-tailed woodrat :
             • Ontology: UMLS:C1048730
             • GenBank Taxonomy No.: 105147
             • Scientific Name: Neotoma cinerea (NCBI Taxonomy)
             • Description: 1 of 20 woodrats (Neotoma cinerea cinerea) was positive for C. burnetii (Burgdorfer et al., 1963).
         21. California ground squirrel :
             • Ontology: UMLS:C1005339
             • GenBank Taxonomy No.: 34862
             • Scientific Name: Spermophilus beecheyi (NCBI Taxonomy)
             • Description: Of 759 individual rodents tested, 21 (2.8%) were seropositive. The highest prevalence of antibodies was found among muskrats (11%), rats (10%), Beechey ground squirrels (6%) and wood rats (5%) (Riemann et al., 1979). Otospermophilus beecheyi (Beechey ground squirrel). 112 tested for agglutinating antibodies against C. burnetii, 7 positive (6%) (Riemann et al., 1979).
         22. Cat :
             • Ontology: UMLS:C0007450
             • GenBank Taxonomy No.: 9685
             • Scientific Name: Felis catus (NCBI Taxonomy)
             • Description: The seroprevalence of Coxiella burnetii infection among pet cats in Japan and Korea and stray cats in Japan was investigated by an indirect fluorescent antibody technique and PCR test. Forty-four (14.2%) of 310 pet cats in Japan were seropositive, as were 15 (41.7%) of 36 stray cats in Japan and 10 (8.6%) of 116 pet cats in Korea. The antibody positive rate in stray cats was significantly higher than that in pet cats, but there was no correlation between the rates in Japanese and Korean pet cats. In this study, the prevalence of C. burnetii infection among cats in different living environments was found and it is difficult to deny that stray cats would be one of the important sources of infection for human Q fever (Komiya et al., 2003).
         23. Cattle :
             • Ontology: UMLS:C1140701
             • GenBank Taxonomy No.: 9913
             • Scientific Name: Bos taurus (NCBI Taxonomy)
             • Description: The agent originates from the major reservoirs of C. burnetii-dairy cows, sheep, and goats. Infected cows shed enormous numbers of rickettsiae in their milk, birth fluids, and colostrum although appearing healthy. In southern California, with up to 98% of dairy herds seropositive for Q fever, 300 human cases were also reported (Baca and Paretsky, 1983).
         24. Cervus elaphus bactrianus :
             • Ontology: UMLS:C0325228
             • GenBank Taxonomy No.: 164931
             • Scientific Name: Cervus elaphus bactrianus (NCBI Taxonomy)
             • Description: Antibodies to Coxiella burnetii were recorded from approximately 13% of 469 ungulates which had been examined by means of micro-CFT (complement fixation test) (Schroder, 1998). 4 out of 4 Cervus elaphus bactrianus were positive for C. burnetii (Schroder, 1998).
         25. Cervus elaphus hippelaphus :
             • Ontology: UMLS:C0325228
             • GenBank Taxonomy No.: 46360
             • Scientific Name: Cervus elaphus hippelaphus (NCBI Taxonomy)
             • Description: Antibodies to Coxiella burnetii were recorded from approximately 13% of 469 ungulates which had been examined by means of micro-CFT (complement fixation test) (Schroder, 1998). 3 out of 15 Cervus elaphus hippelaphus were positive for C. burnetii (Schroder, 1998).
         26. Cervus nippon pseudaxis :
             • Ontology: UMLS:C0325222
             • GenBank Taxonomy No.: 92868
             • Scientific Name: Cervus nippon pseudaxis (NCBI Taxonomy)
             • Description: Antibodies to Coxiella burnetii were recorded from approximately 13% of 469 ungulates which had been examined by means of micro-CFT (complement fixation test) (Schroder, 1998). 4 out of 7 Cervus nippon pseudaxis were positive for C. burnetii (Schroder, 1998).
         27. Chisel-toothed kangaroo rat :
             • Ontology: UMLS:C1042659
             • GenBank Taxonomy No.: 94248
             • Scientific Name: Dipodomys microps (NCBI Taxonomy)
             • Description: Kangaroo rats (Dipodomys microps) were found naturally infected with C. burnetii in Utah, USA (Burgdorfer et al., 1963).
         28. Dall sheep :
             • Ontology: UMLS:C0325320
             • GenBank Taxonomy No.: 9943
             • Scientific Name: Ovis dalli (NCBI Taxonomy)
             • Description: Antibodies to Q fever rickettsia were found in sera of 12 of 15 (80%) Dall sheep (Zarnke et al., 1983).
         29. Deer mice :
             • Ontology: UMLS:C0025915
             • GenBank Taxonomy No.: 10042
             • Scientific Name: Peromyscus maniculatus (NCBI Taxonomy)
             • Description: Deer mouse (Peromyscus maniculatus) was found naturally infected with C. burnetii in Utah, USA (Burgdorfer et al., 1963).
         30. Dog :
             • Ontology: UMLS:C0012984
             • GenBank Taxonomy No.: 9615
             • Scientific Name: Canis familiaris (NCBI Taxonomy)
             • Description: In the present study, we found that two of four animal health technicians in an animal hospital showed a positive serological reaction for C. burnetii at the start of the study. PCR positivity was later confirmed in two dogs that were housed in the animal hospital (Komiya et al., 2003).
         31. Dusky footed-woodrat :
             • Ontology: UMLS:C1048773
             • GenBank Taxonomy No.: 105199
             • Scientific Name: Neotoma fuscipes (NCBI Taxonomy)
             • Description: Of 759 individual rodents tested, 21 (2.8%) were seropositive. The highest prevalence of antibodies was found among muskrats (11%), rats (10%), Beechey ground squirrels (6%) and wood rats (5%) (Riemann et al., 1979). Neotoma fuscipes (woodrat). 21 tested for agglutinating antibodies against C. burnetii, 1 positive (5%) (Riemann et al., 1979).
         32. Eptesicus isabellinus :
             • Scientific Name: Eptesicus isabellinus (Burgdorfer et al., 1963)
             • Description: Bats (Eptesicus isabellinus) were found naturally infected with C. burnetii in Morocco (Burgdorfer et al., 1963).
         33. Erethizon :
             • Ontology: UMLS:C1271420
             • GenBank Taxonomy No.: 34843
             • Scientific Name: Erethizon (NCBI Taxonomy)
             • Description: In the U.S.A., Parker et al. obtained positive reactions with sera from a species of porcupine (Erethizon epixanthum epixanthum) (Babudieri, 1959).
         34. Eurasian pygmy shrew :
             • Ontology: UMLS:C1023350
             • GenBank Taxonomy No.: 62280
             • Scientific Name: Sorex minutus (NCBI Taxonomy)
             • Description: Isolation of Coxiella burnetii in shrew mouse Sorex minutus in the focus of Q fever in northwestern Czechoslovakia (Syrucek et al., 1957).
         35. European bison :
             • Ontology: UMLS:C0325259
             • GenBank Taxonomy No.: 9902
             • Scientific Name: Bison bonasus (NCBI Taxonomy)
             • Description: Comprehensive serological and histopathological examinations of 47 free living European bison (Bison bonasus Linnaeus, 1758) were performed. Of these animals, 36 were serologically positive due to Coxiella burnetii, which confirmed the presence of Q fever epizootic foci in this population of wild animals in Poland. The presence of multiple foci of mononuclear cells typical for Q fever was a consistent finding in all tissues of the majority of C. burnetii seropositive animals under study. Pathomorphological changes observed in myocardium as the focal coagulation necrosis, and in kidneys, resembled the glomerular lesion observed in humans with Q fever, as well as in the experimental Q-fever infections in laboratory animals. These changes were absent in bison showing a C. burnetii seronegative reaction (Szarek et al., 1994).
         36. European shrew :
             • Ontology: UMLS:C1010036
             • GenBank Taxonomy No.: 42254
             • Scientific Name: Sorex araneus (NCBI Taxonomy)
             • Description: Isolation of Coxiella burnetii from the common shrew (Sorex araneus) caught in a focus of Q-rickettsiosis in Northeastern Bohemia (Rehn amd Radvan, 1959).
         37. European suslik :
             • Ontology: UMLS:C0999636
             • GenBank Taxonomy No.: 100387
             • Scientific Name: Spermophilus citellus relictus (NCBI Taxonomy)
             • Description: Suslik (Citellus relictus) was found naturally infected with C. burnetii in the USSR and in Czechoslovakia (Burgdorfer et al., 1963).
         38. European woodmouse :
             • Ontology: UMLS:C0999696
             • GenBank Taxonomy No.: 10129
             • Scientific Name: Apodemus sylvaticus (NCBI Taxonomy)
             • Description: Two species of mice, Apodemus sylvaticus and Lemnisomys barberus, were also found naturally infected in Morocco (Babudieri, 1959).
         39. Fallow deer :
             • Ontology: UMLS:C0325214
             • GenBank Taxonomy No.: 30532
             • Scientific Name: Dama dama (NCBI Taxonomy)
             • Description: Antibodies to Coxiella burnetii were recorded from approximately 13% of 469 ungulates which had been examined by means of micro-CFT (complement fixation test) (Schroder, 1998). 2 out of 18 Dama dama were positive for C. burnetii (Schroder, 1998).
         40. Garden dormouse :
             • Ontology: UMLS:C1017273
             • GenBank Taxonomy No.: 53277
             • Scientific Name: Eliomys quercinus (NCBI Taxonomy)
             • Description: Dormice (Eliomys quercinus) were found naturally infected with C. burnetii in Spain (Burgdorfer et al., 1963).
         41. Goat :
             • Ontology: UMLS:C0018019
             • GenBank Taxonomy No.: 9925
             • Scientific Name: Capra hircus (NCBI Taxonomy)
             • Description: A cross-sectional study of Q fever was conducted in a representative sample of the human and animal population in Cyprus in order to assess the seroprevalence of Q fever and the prevalence of related risk factors. A total of 583 human and 974 ruminant animal serum samples were collected and tested for the detection of antibodies against Coxiella burnetii phase II antigen using an indirect immunofluorescent assay. One hundred forty-one ticks were collected from the infested animals examined; the polymerase chain reaction and the shell-vial technique were used to detect and isolate C. burnetii (Psaroulaki et al., 2006). The prevalence of IgG antibodies against C. burnetii phase II antigen was estimated at 52.7% for humans, 48.2% for goats, 18.9% for sheep, and 24% for bovines (Psaroulaki et al., 2006). Risk factors related to Q fever seropositivity were identified by logistic regression analysis and included age, residence, occupation, use of manure in the garden, ownership of animals (especially goats), and the presence of tick-infested or aborting animals. Q fever poses an occupational hazard to humans living in close contact with sheep and/or goats (Psaroulaki et al., 2006).
         42. Goitered gazelle :
             • Ontology: UMLS:C1021590
             • GenBank Taxonomy No.: 59529
             • Scientific Name: Gazella subgutturosa (NCBI Taxonomy)
             • Description: Antibodies to Coxiella burnetii were recorded from approximately 13% of 469 ungulates which had been examined by means of micro-CFT (complement fixation test) (Schroder, 1998). 6 out of 7 Gazella subgutturosa were positive for C. burnetii (Schroder, 1998).
         43. Golden-bellied Water Rat :
             • Ontology: UMLS:C1076560
             • GenBank Taxonomy No.: 160448
             • Scientific Name: Hydromys chrysogaster (NCBI Taxonomy)
             • Description: Freeman et al., in Australia had positive serologic reactions with two rats, Rattus culmorum youngi and Hydromys chrysogaster (Babudieri, 1959).
         44. Golden-mantled ground squirrel :
             • Ontology: UMLS:C1032127
             • GenBank Taxonomy No.: 76772
             • Scientific Name: Spermophilus lateralis (NCBI Taxonomy)
             • Description: 2 of 111 golden-mantled ground squirrel (Citellus lateralis tescorum) were positive for C. burnetii (Burgdorfer et al., 1963).
         45. Gray four-eyed opossum :
             • Ontology: UMLS:C0999407
             • GenBank Taxonomy No.: 9272
             • Scientific Name: Philander opossum (NCBI Taxonomy)
             • Description: Of the 117 rodents, 42 marsupials, 86 bats, 69 birds, and 47 batrachians captured around Cayenne and tested, only 4 Proechimys species, 4 Philander opossum, 1 Didelphis marsupialis, and 1 Progne chalybea had antibodies to C. burnetii (Gardon et al., 2001).
         46. Least weasel :
             • Ontology: UMLS:C1006148
             • GenBank Taxonomy No.: 36239
             • Scientific Name: Mustela nivalis (NCBI Taxonomy)
             • Description: The weasel (Mustela nivalis) was found naturally infected with C. burnetii in Czechoslovakia (Burgdorfer et al., 1963).
         47. Hokkaido sika deer :
             • Ontology: UMLS:C0325222
             • GenBank Taxonomy No.: 223998
             • Scientific Name: Cervus nippon yesoensis (NCBI Taxonomy)
             • Description: One hundred and thirty-four (26%) of 511 sera from 11 wild animal species in eight prefectures in Japan had antibody titers to Coxiella burnetii by the enzyme-linked immunosorbent assay. High prevalences were observed in Japanese black bears (Ursus thibetanus) (78%), Hokkaido deer (Cervus nippon yesoensis) (69%), Japanese hares (Lepus brachyurus) (63%), Japanese deer (Cervus nippon centralis) (56%), and to some extent in Japanese monkeys (Macaca fuscata) (28%) (Ejercito et al., 1993).
         48. Hondo sika deer :
             • Ontology: UMLS:C0325222
             • GenBank Taxonomy No.: 151525
             • Scientific Name: Cervus nippon centralis (NCBI Taxonomy)
             • Description: One hundred and thirty-four (26%) of 511 sera from 11 wild animal species in eight prefectures in Japan had antibody titers to Coxiella burnetii by the enzyme-linked immunosorbent assay. High prevalences were observed in Japanese black bears (Ursus thibetanus) (78%), Hokkaido deer (Cervus nippon yesoensis) (69%), Japanese hares (Lepus brachyurus) (63%), Japanese deer (Cervus nippon centralis) (56%), and to some extent in Japanese monkeys (Macaca fuscata) (28%) (Ejercito et al., 1993).
         49. House mouse :
             • Ontology: UMLS:C0025914
             • GenBank Taxonomy No.: 10090
             • Scientific Name: Mus musculus (NCBI Taxonomy)
             • Description: The house mouse (Mus musculus) was found naturally infected with C. burnetii in Czechoslovakia (Burgdorfer et al., 1963).
         50. House shrew :
             • Ontology: UMLS:C0999460
             • GenBank Taxonomy No.: 9378
             • Scientific Name: Suncus murinus (NCBI Taxonomy)
             • Description: Shrew (Suncus murinus). 1/21 tested were sero-positive for Q fever
         51. Japanese macaque :
             • Ontology: UMLS:C1621298
             • GenBank Taxonomy No.: 9542
             • Scientific Name: Macaca fuscata (NCBI Taxonomy)
             • Description: One hundred and thirty-four (26%) of 511 sera from 11 wild animal species in eight prefectures in Japan had antibody titers to Coxiella burnetii by the enzyme-linked immunosorbent assay. High prevalences were observed in Japanese black bears (Ursus thibetanus) (78%), Hokkaido deer (Cervus nippon yesoensis) (69%), Japanese hares (Lepus brachyurus) (63%), Japanese deer (Cervus nippon centralis) (56%), and to some extent in Japanese monkeys (Macaca fuscata) (28%) (Ejercito et al., 1993).
         52. Kulan :
             • Ontology: UMLS:C0325168
             • GenBank Taxonomy No.: 73334
             • Scientific Name: Equus hemionus kulan (NCBI Taxonomy)
             • Description: Antibodies to Coxiella burnetii were recorded from approximately 13% of 469 ungulates which had been examined by means of micro-CFT (complement fixation test) (Schroder, 1998). 1 out of 5 Equus hemionus kulan was positive for C. burnetii (Schroder, 1998).
         53. Lepus brachyurus :
             • Ontology: UMLS:C1074751
             • GenBank Taxonomy No.: 156448
             • Scientific Name: Lepus brachyurus (NCBI Taxonomy)
             • Description: One hundred and thirty-four (26%) of 511 sera from 11 wild animal species in eight prefectures in Japan had antibody titers to Coxiella burnetii by the enzyme-linked immunosorbent assay. High prevalences were observed in Japanese black bears (Ursus thibetanus) (78%), Hokkaido deer (Cervus nippon yesoensis) (69%), Japanese hares (Lepus brachyurus) (63%), Japanese deer (Cervus nippon centralis) (56%), and to some extent in Japanese monkeys (Macaca fuscata) (28%) (Ejercito et al., 1993).
         54. Llama :
             • Ontology: UMLS:C0023919
             • GenBank Taxonomy No.: 9844
             • Scientific Name: Lama glama (NCBI Taxonomy)
             • Description: Antibodies to Coxiella burnetii were recorded from approximately 13% of 469 ungulates which had been examined by means of micro-CFT (complement fixation test) (Schroder, 1998). 1 out of 12 Lama guanicoe f. glama was positive for C. burnetii (Schroder, 1998).
         55. Long-clawed ground squirrel :
             • Ontology: UMLS:C1045909
             • GenBank Taxonomy No.: 99871
             • Scientific Name: Spermophilopsis leptodactylus (NCBI Taxonomy)
             • Description: The squirrel (Spermophilopsis leptodactylus) was found naturally infected with C. burnetii in the USSR (Burgdorfer et al., 1963).
         56. Long-eared hedgehog :
             • Ontology: UMLS:C1265466
             • GenBank Taxonomy No.: 217708
             • Scientific Name: Hemiechinus auritus (NCBI Taxonomy)
             • Description: Hedgehog (Hemiechinus auritus) was found naturally infected with C. burnetii in Czechoslovakia (Burgdorfer et al., 1963).
         57. Mountain zebra :
             • Ontology: UMLS:C0325177
             • GenBank Taxonomy No.: 73335
             • Scientific Name: Equus zebra hartmannae (NCBI Taxonomy)
             • Description: Antibodies to Coxiella burnetii were recorded from approximately 13% of 469 ungulates which had been examined by means of micro-CFT (complement fixation test) (Schroder, 1998). 11 out of 15 Equus zebra hartmannae were positive for C. burnetii (Schroder, 1998).
         58. Mouflon :
             • Ontology: UMLS:C0325321
             • GenBank Taxonomy No.: 9938
             • Scientific Name: Ovis aries musimon (NCBI Taxonomy)
             • Description: Antibodies to Coxiella burnetii were recorded from approximately 13% of 469 ungulates which had been examined by means of micro-CFT (complement fixation test) (Schroder, 1998). 1 out of 9 Ovis ammon musimon was positive for C. burnetii (Schroder, 1998).
         59. Muskrat :
             • Ontology: UMLS:C1095815
             • GenBank Taxonomy No.: 10060
             • Scientific Name: Ondatra zibethicus (NCBI Taxonomy)
             • Description: Of 759 individual rodents tested, 21 (2.8%) were seropositive. The highest prevalence of antibodies was found among muskrats (11%), rats (10%), Beechey ground squirrels (6%) and wood rats (5%) (Riemann et al., 1979). Ondatra zebethica (muskrat). 19 tested for agglutinating antibodies against C. burnetii, 2 positive (11%) (Riemann et al., 1979).
         60. Nilgai :
             • Ontology: UMLS:C0325244
             • GenBank Taxonomy No.: 9917
             • Scientific Name: Boselaphus tragocamelus (NCBI Taxonomy)
             • Description: Antibodies to Coxiella burnetii were recorded from approximately 13% of 469 ungulates which had been examined by means of micro-CFT (complement fixation test) (Schroder, 1998). 1 out of 2 Boselaphus tragocamelus was positive for C. burnetii (Schroder, 1998).
         61. Nutria :
             • Ontology: UMLS:C0324991
             • GenBank Taxonomy No.: 10157
             • Scientific Name: Myocastor coypus (NCBI Taxonomy)
             • Description: One hundred and thirty-four (26%) of 511 sera from 11 wild animal species in eight prefectures in Japan had antibody titers to Coxiella burnetii by the enzyme-linked immunosorbent assay. High prevalences were observed in Japanese black bears (Ursus thibetanus) (78%), Hokkaido deer (Cervus nippon yesoensis) (69%), Japanese hares (Lepus brachyurus) (63%), Japanese deer (Cervus nippon centralis) (56%), and to some extent in Japanese monkeys (Macaca fuscata) (28%). A low prevalence (13%) was observed in nutrias (Myocastor coypus) (Ejercito et al., 1993).
         62. Onager :
             • Ontology: UMLS:C0325168
             • GenBank Taxonomy No.: 9794
             • Scientific Name: Equus hemionus (NCBI Taxonomy)
             • Description: Antibodies to Coxiella burnetii were recorded from approximately 13% of 469 ungulates which had been examined by means of micro-CFT (complement fixation test) (Schroder, 1998). 1 out of 5 Equus hemionus holdereri was positive for C. burnetii (Schroder, 1998).
         63. Ord's kangaroo rat :
             • Ontology: UMLS:C0324914
             • GenBank Taxonomy No.: 10020
             • Scientific Name: Dipodomys ordii (NCBI Taxonomy)
             • Description: Kangaroo rats (Dipodomys ordii) were found naturally infected with C. burnetii in Utah, USA (Burgdorfer et al., 1963).
         64. Ovibos moschatus :
             • Ontology: UMLS:C0325314
             • GenBank Taxonomy No.: 37176
             • Scientific Name: Ovibos moschatus (NCBI Taxonomy)
             • Description: Antibodies to Coxiella burnetii were recorded from approximately 13% of 469 ungulates which had been examined by means of micro-CFT (complement fixation test) (Schroder, 1998). 2 out of 3 Ovibos moschatus were positive for C. burnetii (Schroder, 1998).
         65. Peromyscus :
             • Ontology: UMLS:C0031171
             • GenBank Taxonomy No.: 10040
             • Scientific Name: Peromyscus (NCBI Taxonomy)
             • Description: Of 759 individual rodents tested, 21 (2.8%) were seropositive. The highest prevalence of antibodies was found among muskrats (11%), rats (10%), Beechey ground squirrels (6%) and wood rats (5%). The most frequently trapped rodents, because of their almost ubiquitous distribution in nature, were the three species of Peromyscus common in California; P. maniculatus, P. truei, and P. boylei. Of 306 Peromyscus tested, only 5 (2%) were seropositive (Riemann et al., 1979). Peromyscus spp. (deer and brush mouse). 306 tested for agglutinating antibodies against C. burnetii, 5 positive (2%) (Riemann et al., 1979).
         66. Proechimys :
             • Ontology: UMLS:C0999712
             • GenBank Taxonomy No.: 10162
             • Scientific Name: Proechimys (NCBI Taxonomy)
             • Description: Of the 117 rodents, 42 marsupials, 86 bats, 69 birds, and 47 batrachians captured around Cayenne and tested, only 4 Proechimys species, 4 Philander opossum, 1 Didelphis marsupialis, and 1 Progne chalybea had antibodies to C. burnetii. High titers were found in Proechimys species (Gardon et al., 2001).
         67. Przewalski's horse :
             • Ontology: UMLS:C1541715
             • GenBank Taxonomy No.: 9798
             • Scientific Name: Equus przewalskii (NCBI Taxonomy)
             • Description: Antibodies to Coxiella burnetii were recorded from approximately 13% of 469 ungulates which had been examined by means of micro-CFT (complement fixation test) (Schroder, 1998). 4 out of 39 Equus przewalskii were positive for C. burnetii (Schroder, 1998).
         68. Norway rat :
             • Ontology: UMLS:C0034693
             • GenBank Taxonomy No.: 10116
             • Scientific Name: Rattus norvegicus (NCBI Taxonomy)
             • Description: Norway rats are infected with C. burnetii in the United Kingdom, with highest prevalence being found on dairy farmsteads that have sheep present (Comer et al., 2001). Rattus spp. (Norway and brown rat). 30 tested for agglutinating antibodies against C. burnetii, 3 positive (10%) (Riemann et al., 1979).
         69. Rabbit :
             • Ontology: UMLS:C0034493
             • GenBank Taxonomy No.: 9986
             • Scientific Name: Oryctolagus cuniculus (NCBI Taxonomy)
             • Description: In the Nefifik forest, the very common wild rabbit, Oryctolagus cuniculus, is frequently infected with C. burnetii (Babudieri, 1959). Rabbits (Oryctolagus cuniculus) were found naturally infected with C. burnetii in the Spain and Morocco (Burgdorfer et al., 1963).
         70. Raccoon :
             • Ontology: UMLS:C0999544
             • GenBank Taxonomy No.: 9654
             • Scientific Name: Procyon lotor (NCBI Taxonomy)
             • Description: Enright and others also showed that two (8%) of 26 raccoons tested had antibodies to C. burnetii. This compares with 9.5% in our study. All the raccoons in our study were trapped within the Halifax (the largest city in Nova Scotia) city limits. These animals are now very numerous in our city, and they represent a reservoir for urban spread of Q fever (Marrie et al., 1993).
         71. Rattus tunneyi culmorum :
             • GenBank Taxonomy No.: 95534
             • Scientific Name: Rattus tunneyi culmorum (NCBI Taxonomy)
             • Description: Freeman et al., in Australia had positive serologic reactions with two rats, Rattus culmorum youngi and Hydromys chrysogaster (Babudieri, 1959).
         72. Rhombomys opimus :
             • Ontology: UMLS:C1646173
             • GenBank Taxonomy No.: 186474
             • Scientific Name: Rhombomys opimus (NCBI Taxonomy)
             • Description: The gerbil (Rhombomys opimus) was found naturally infected with C. burnetii in the USSR (Burgdorfer et al., 1963).
         73. Saiga tatarica :
             • Ontology: UMLS:C0325326
             • GenBank Taxonomy No.: 59529
             • Scientific Name: Saiga tatarica (NCBI Taxonomy)
             • Description: Antibodies to Coxiella burnetii were recorded from approximately 13% of 469 ungulates which had been examined by means of micro-CFT (complement fixation test) (Schroder, 1998). 1 out of 32 Saiga tatarica was positive for C. burnetii (Schroder, 1998).
         74. Shaw's jird :
             • Ontology: UMLS:C1006852
             • GenBank Taxonomy No.: 37435
             • Scientific Name: Meriones shawi (NCBI Taxonomy)
             • Description: The desert rat Meriones shawi, which lives in North Africa, was found infected in Morocco (Babudieri, 1959).
         75. Sheep :
             • Ontology: UMLS:C1123019
             • GenBank Taxonomy No.: 9940
             • Scientific Name: Ovis aries (NCBI Taxonomy)
             • Description: In October 1998, two abortions associated with Coxiella burnetii occurred in a group of 34 pregnant ewes in the sheep flock belonging to INRA Tours-Nouzilly. The flock was kept in groups of approximately 40 ewes, which were housed together in the same accommodation. The prevalence of C burnetii infection in the groups was investigated by using ELISA and PCR tests, which revealed a high prevalence of C burnetii. The ewes were treated with oxytetracycline to reduce the shedding of C burnetii and to prevent further abortions. Nevertheless, five abortions attributed to C burnetii occurred in January and March 1999 in three groups of ewes, and 24 of the ewes still shed the bacteria into their vaginal tracts. In addition, a serological study was carried out during the first year of life of the female lambs born in 1999 and 2000; 12 per cent of 113 lambs born in 1999 were seropositive for C burnetii by ELISA, and half of the ELISA-positive lambs were born either to serologically positive ewes or to dams that excreted the pathogen into their vaginal tracts. However, all the 150 lambs born in 2000 were ELISA-negative, suggesting that the preventive measures undertaken had suppressed both the abortions and the shedding of C burnetii, and reduced the transmission of the agent (Berri et al., 2005).
         76. Short-nosed bandicoots :
             • Ontology: UMLS:C1007138
             • GenBank Taxonomy No.: 37888
             • Scientific Name: Isoodon (NCBI Taxonomy)
             • Description: In Australia, the bandicoot, Isoodon torosus is to a considerable extent a carrier of C. burnetii (Babudieri, 1959). Animal or bird found infected with Q Fever: Isoodon torosus. Found in 3 of 109 bandicoots in Australia in 1953 (Waag et al., 1991).
         77. Small five-toed jerboa :
             • Ontology: UMLS:C1030280
             • GenBank Taxonomy No.: 73861
             • Scientific Name: Allactaga elater (NCBI Taxonomy)
             • Description: Jerboa (Allactaga elater) were found naturally infected with C. burnetii in Czechoslovakia (Burgdorfer et al., 1963).
         78. Snowshoe hare :
             • Ontology: UMLS:C1013735
             • GenBank Taxonomy No.: 48086
             • Scientific Name: Lepus americanus (NCBI Taxonomy)
             • Description: We found that C. burnetii infection was very common among the hare population of Nova Scotia; 49% of the 730 hares tested had antibodies to phase I antigen. The snowshoe hare (Lepus americanus) is the only species of hare found in Nova Scotia (Marrie et al., 1993).
         79. Southern opossum :
             • Ontology: UMLS:C0999405
             • GenBank Taxonomy No.: 9268
             • Scientific Name: Didelphis marsupialis (NCBI Taxonomy)
             • Description: Of the 117 rodents, 42 marsupials, 86 bats, 69 birds, and 47 batrachians captured around Cayenne and tested, only 4 Proechimys species, 4 Philander opossum, 1 Didelphis marsupialis, and 1 Progne chalybea had antibodies to C. burnetii (Gardon et al., 2001).
         80. Swine :
             • Ontology: UMLS:C1135183
             • GenBank Taxonomy No.: 9823
             • Scientific Name: Sus scrofa (NCBI Taxonomy)
             • Description: Blood samples were collected from trapped or hunter-killed wild hogs (Sus scrofa) in 4 areas of California. Sera were tested for antibodies against 7 zoonotic disease agents. Antibodies against Brucella sp were detected in 21 (15%) of 136 samples. Antibodies against Coxiella burnetii were found in 50% of the collected samples (67 of 135 tested) (Clark et al., 1983).
         81. Tamias spp (includes Eutamias) :
             • Ontology: UMLS:C0015185
             • GenBank Taxonomy No.: 13712
             • Scientific Name: Tamias spp (includes Eutamias) (NCBI Taxonomy)
             • Description: Eutamias spp. (chipmunk). 85 tested for agglutinating antibodies against C. burnetii, 1 positive (1%) (Riemann et al., 1979).
         82. Waterbuck :
             • Ontology: UMLS:C0325268
             • GenBank Taxonomy No.: 91878
             • Scientific Name: Kobus ellipsiprymnus ellipsiprymnus (NCBI Taxonomy)
             • Description: Antibodies to Coxiella burnetii were recorded from approximately 13% of 469 ungulates which had been examined by means of micro-CFT (complement fixation test) (Schroder, 1998). 1 out of 6 Kobus ellipsiprymnus ellipsiprymnus was positive for C. burnetii (Schroder, 1998).
         83. Waipiti :
             • Ontology: UMLS:C0325228
             • GenBank Taxonomy No.: 9861
             • Scientific Name: Cervus elaphus canadensis (NCBI Taxonomy)
             • Description: Antibodies to Coxiella burnetii were recorded from approximately 13% of 469 ungulates which had been examined by means of micro-CFT (complement fixation test) (Schroder, 1998). 1 out of 2 Cervus elaphus canadensis was positive for C. burnetii (Schroder, 1998).
         84. Western roe deer :
             • Ontology: UMLS:C0325219
             • GenBank Taxonomy No.: 9858
             • Scientific Name: Capreolus capreolus (NCBI Taxonomy)
             • Description: Between 1986 and 1991, sera were collected from 33 roe deer (Capreolus capreolus), 24 red deer (Cervus elaphus), four fallow deer (Dama dama), two mouflon (Ovis musimon), 34 wild boars (Sus scrofa), and 48 hares (Lepus europaeus) shot in two areas of the Czech Republic. Collectively, the sera contained antibodies to Coxiella burnetii (prevalence of 12%), Francisella tularensis (4%), Brucella spp. (2%), Central European tick-borne encephalitis virus (8%), Tahyna (California serogroup) virus (36%), and Calovo (= Batai) virus (23%). We propose that these mammals may play a role in maintaining natural foci of Q-fever, Tahyna fever and Calovo virus infection (Hubalek et al., 1993). Species: Roe deer. 2 seropositive for Coxiella burnetii out of 33 tested (6%) (Hubalek et al., 1993).
         85. White-tailed deer :
             • Ontology: UMLS:C0325224
             • GenBank Taxonomy No.: 9874
             • Scientific Name: Odocoileus virginianus (NCBI Taxonomy)
             • Description: Forty-nine percent of the hares had a positive phase I antibody titer to C. burnetii while 12% had an antibody titer to phase II antigen. Four percent of the deer showed evidence of previous infection. The deer had a higher prevalence of antibody to phase II antigen than to phase I antigen (Marrie et al., 1993).
         86. Yellow-pine chipmunk :
             • Ontology: UMLS:C1032127
             • GenBank Taxonomy No.: 64679
             • Scientific Name: Tamias amoenus (NCBI Taxonomy)
             • Description: 1 of 46 chipmunks (Eutamias amoenus) were positive for C. burnetii (Burgdorfer et al., 1963).
         87. American crow :
             • Ontology: UMLS:C0326393
             • GenBank Taxonomy No.: 85066
             • Scientific Name: Corvus brachyrhynchos (NCBI Taxonomy)
             • Description: Of the 583 birds from 33 species that were tested for antibodies against C. burnetii, 118 (20%) were seropositive. The highest rates of infection were among the "sparrows", i.e., gold crowned- (80%), white crowned- (57%), and English- (50%). These high prevalence levels were followed by those for coot (45%), Brewer's blackbird (33%), crow (29%), robin (16%), pigeon(10%), and mallard duck (7%) (Riemann et al., 1979). Covus brachyrhynchos (crow). 41 tested for agglutinating antibodies against C. burnetii, 12 positive (29%) (Riemann et al., 1979).
         88. Common redstart :
             • Ontology: UMLS:C1058499
             • GenBank Taxonomy No.: 121423
             • Scientific Name: Phoenicurus phoenicurus (NCBI Taxonomy)
             • Description: The redstart (Phoenicurus phoenicurus) was found naturally infected with C. burnetii in Czechoslovakia (Burgdorfer et al., 1963).
         89. Chicken :
             • Ontology: UMLS:C0008051
             • GenBank Taxonomy No.: 9031
             • Scientific Name: Gallus gallus (NCBI Taxonomy)
             • Description: Of 1,951 domestic birds tested, 41(2%) had the antibodies to C. burnetii. Antibody positive birds included quail (1 to 4%), muscovy ducks (0 to 10%), domestic chickens (1 to 3%) and domestic mallards (2%) (To et al., 1998).
         90. Common quail :
             • Ontology: UMLS:C0325643
             • GenBank Taxonomy No.: 9091
             • Scientific Name: Coturnix coturnix (NCBI Taxonomy)
             • Description: Of 1,951 domestic birds tested, 41(2%) had the antibodies to C. burnetii. Antibody positive birds included quail (1 to 4%), muscovy ducks (0 to 10%), domestic chickens (1 to 3%) and domestic mallards (2%) (To et al., 1998).
         91. Common starling :
             • Ontology: UMLS:C0326711
             • GenBank Taxonomy No.: 9172
             • Scientific Name: Sturnus vulgaris (NCBI Taxonomy)
             • Description: Sturnus vulgaris (starling). 157 tested for agglutinating antibodies against C. burnetii, 18 positive (11%) (Riemann et al., 1979).
         92. Corvus corone :
             • Ontology: UMLS:C1003236
             • GenBank Taxonomy No.: 30422
             • Scientific Name: Corvus corone ()
             • Description: Of 1,951 domestic birds tested, 41(2%) had the antibodies to C. burnetii. Antibody positive birds included quail (1 to 4%), muscovy ducks (0 to 10%), domestic chickens (1 to 3%) and domestic mallards (2%) (To et al., 1998).
         93. Columba fasciata :
             • Ontology: UMLS:C1202820
             • GenBank Taxonomy No.: 177142
             • Scientific Name: Columba fasciata (NCBI Taxonomy)
             • Description: Serum samples from 15 species of rodents and 33 species of birds were tested for agglutinins against Coxiella burnetii by the microagglutination test Of 583 birds tested, 118 (20%) were seropositive. This included white crowned sparrows, Zonotrichia leucophrys, gold crowned sparrows, Z. atricapilla, and English sparrows, Passer domesticus, (68% in the composite); coots, Fulica americana, (29%); blackbirds, Euphagus cyanocephalus, (33%); crows, Corvus brachyrhyncos, (29%); robins, Turdus migratorius, (16%); pigeons, Columba fasciata, (10%); and mallard ducks, Anas platyrhynchos, (7%) (Riemann et al., 1979). Columba fasciata (band-tail pigeon). 31 tested for agglutinating antibodies against C. burnetii, 3 positive (10%) (Riemann et al., 1979).
         94. Domestic pigeon :
             • Ontology: UMLS:C0999232
             • GenBank Taxonomy No.: 8932
             • Scientific Name: Columba livia (NCBI Taxonomy)
             • Description: Pigeon (Columba livia). 1/11 tested were sero-positive for Q fever
         95. Common mynah :
             • Ontology: UMLS:C1479699
             • GenBank Taxonomy No.: 279927
             • Scientific Name: Acridotheres tristis (NCBI Taxonomy)
             • Description: Mynah (Aeridotheres tristis [sic], Sturnus contra). 19/69 tested were sero-positive for Q fever
         96. Euphagus cyanocephalus :
             • Ontology: UMLS:C1086477
             • GenBank Taxonomy No.: 84817
             • Scientific Name: Euphagus cyanocephalus (NCBI Taxonomy)
             • Description: Of the 583 birds from 33 species that were tested for antibodies against C. burnetii, 118 (20%) were seropositive. The highest rates of infection were among the"sparrows", i.e., gold crowned- (80%), white crowned- (57%), and English- (50%). These high prevalence levels were followed by those for coot (45%), Brewer's blackbird (33%), crow (29%), robin (16%), pigeon(10%), and mallard duck (7%) (Riemann et al., 1979). Euphagus cyanocephalus (Brewer's blackbird). 18 tested for agglutinating antibodies against C. burnetii, 6 positive (33%) (Riemann et al., 1979).
         97. Eurasian tree sparrow :
             • Ontology: UMLS:C1692316
             • GenBank Taxonomy No.: 9160
             • Scientific Name: Passer montanus (NCBI Taxonomy)
             • Description: In central Asia, Zhmaeva and his colleagues isolated C. burnetii from both Passer montanus pallidus and from two of its ectoparasites (Babudieri, 1959).
         98. Fulica americana :
             • Ontology: UMLS:C1035079
             • GenBank Taxonomy No.: 81903
             • Scientific Name: Fulica americana (NCBI Taxonomy)
             • Description: Of the 583 birds from 33 species that were tested for antibodies against C. burnetii, 118 (20%) were seropositive. The highest rates of infection were among the"sparrows", i.e., gold crowned- (80%), white crowned- (57%), and English- (50%). These high prevalence levels were followed by those for coot (45%), Brewer's blackbird (33%), crow (29%), robin (16%), pigeon(10%), and mallard duck (7%) (Riemann et al., 1979). Fulica americana (American coot, mudhen). 33 tested for agglutinating antibodies against C. burnetii, 15 positive (45%) (Riemann et al., 1979).
         99. Hirundo daurica :
             • Scientific Name: Hirundo daurica (Yadav and Sethi, 1979)
             • Description: Swallow (Hirundo daurica). 6/200 tested were sero-positive for Q fever
         100. House sparrow :
              • Ontology: UMLS:C1014231
              • GenBank Taxonomy No.: 48849
              • Scientific Name: Passer domesticus (NCBI Taxonomy)
              • Description: Of the 583 birds from 33 species that were tested for antibodies against C. burnetii, 118 (20%) were seropositive. The highest rates of infection were among the"sparrows", i.e., gold crowned- (80%), white crowned- (57%), and English- (50%). These high prevalence levels were followed by those for coot (45%), Brewer's blackbird (33%), crow (29%), robin (16%), pigeon(10%), and mallard duck (7%) (Riemann et al., 1979). Passer domesticus (English sparrow). 14 tested for agglutinating antibodies against C. burnetii, 7 positive (50%) (Riemann et al., 1979).
         101. Jungle crow :
              • Ontology: UMLS:C1006157
              • GenBank Taxonomy No.: 36249
              • Scientific Name: Corvus macrorhynchos (NCBI Taxonomy)
              • Description: Of 1,951 domestic birds tested, 41(2%) had the antibodies to C. burnetii. Antibody positive birds included quail (1 to 4%), muscovy ducks (0 to 10%), domestic chickens (1 to 3%) and domestic mallards (2%) (To et al., 1998).
         102. Mallard :
              • Ontology: UMLS:C1260943
              • GenBank Taxonomy No.: 8839
              • Scientific Name: Anas platyrhynchos (NCBI Taxonomy)
              • Description: Of 1,951 domestic birds tested, 41(2%) had the antibodies to C. burnetii. Antibody positive birds included quail (1 to 4%), muscovy ducks (0 to 10%), domestic chickens (1 to 3%) and domestic mallards (2%) (To et al., 1998). Of the 583 birds from 33 species that were tested for antibodies against C. burnetii, 118 (20%) were seropositive. The highest rates of infection were among the"sparrows", i.e., gold crowned- (80%), white crowned- (57%), and English- (50%). These high prevalence levels were followed by those for coot (45%), Brewer's blackbird (33%), crow (29%), robin (16%), pigeon(10%), and mallard duck (7%) (Riemann et al., 1979). Anas platyrhynchos (mallard). 14 tested for agglutinating antibodies against C. burnetii, 1 positive (7%) (Riemann et al., 1979).
         103. Muscovy duck :
              • Ontology: UMLS:C0324623
              • GenBank Taxonomy No.: 8855
              • Scientific Name: Cairina moschata (NCBI Taxonomy)
              • Description: Of 1,951 domestic birds tested, 41(2%) had the antibodies to C. burnetii. Antibody positive birds included quail (1 to 4%), muscovy ducks (0 to 10%), domestic chickens (1 to 3%) and domestic mallards (2%) (To et al., 1998).
         104. Progne chalybea :
              • Ontology: UMLS:C1085371
              • GenBank Taxonomy No.: 72875
              • Scientific Name: Progne chalybea (NCBI Taxonomy)
              • Description: Of the 117 rodents, 42 marsupials, 86 bats, 69 birds, and 47 batrachians captured around Cayenne and tested, only 4 Proechimys species, 4 Philander opossum, 1 Didelphis marsupialis, and 1 Progne chalybea had antibodies to C. burnetii (Gardon et al., 2001).
         105. Ring-necked pheasant :
              • Ontology: UMLS:C0325667
              • GenBank Taxonomy No.: 9054
              • Scientific Name: Phasianus colchicus (NCBI Taxonomy)
              • Description: Of the 583 birds from 33 species that were tested for antibodies against C. burnetii, 118 (20%) were seropositive. The highest rates of infection were among the"sparrows", i.e., gold crowned- (80%), white crowned- (57%), and English- (50%). These high prevalence levels were followed by those for coot (45%), Brewer's blackbird (33%), crow (29%), robin (16%), pigeon(10%), and mallard duck (7%) (Riemann et al., 1979). Phasianus colchicus (ring-necked pheasant). 28 tested for agglutinating antibodies against C. burnetii, 1 positive (4%) (Riemann et al., 1979).
         106. Rose-ringed parakeet :
              • Ontology: UMLS:C0999383
              • GenBank Taxonomy No.: 9228
              • Scientific Name: Psittacula krameri (NCBI Taxonomy)
              • Description: Parrot (Psittacula krameri). 13/56 tested were sero-positive for Q fever
         107. Spotted owlet :
              • Ontology: UMLS:C1189273
              • GenBank Taxonomy No.: 126786
              • Scientific Name: Athene brama (NCBI Taxonomy)
              • Description: Owlet (Athene brama). 1/6 tested were sero-positive for Q fever
         108. Sturnus contra :
              • Scientific Name: Sturnus contra (Yadav and Sethi, 1979)
              • Description: Mynah (Aeridotheres tristis [sic], Sturnus contra). 19/69 tested were sero-positive for Q fever
         109. Turdus migratorius :
              • Ontology: UMLS:C0999362
              • GenBank Taxonomy No.: 9188
              • Scientific Name: Turdus migratorius (NCBI Taxonomy)
              • Description: Of the 583 birds from 33 species that were tested for antibodies against C. burnetii, 118 (20%) were seropositive. The highest rates of infection were among the"sparrows", i.e., gold crowned- (80%), white crowned- (57%), and English- (50%). These high prevalence levels were followed by those for coot (45%), Brewer's blackbird (33%), crow (29%), robin (16%), pigeon(10%), and mallard duck (7%) (Riemann et al., 1979). Turdus migratorius (robin). 19 tested for agglutinating antibodies against C. burnetii, 3 positive (16%) (Riemann et al., 1979).
         110. Wagtail :
              • Ontology: UMLS:C1012211
              • Scientific Name: Motacilla alba (Burgdorfer et al., 1963)
              • Description: The wagtail (Motacilla alba) was found naturally infected with C. burnetii in Czechoslovakia (Burgdorfer et al., 1963).
         111. Zonotrichia atricapilla :
              • Ontology: UMLS:C1011388
              • GenBank Taxonomy No.: 44392
              • Scientific Name: Zonotrichia atricapilla (NCBI Taxonomy)
              • Description: Of the 583 birds from 33 species that were tested for antibodies against C. burnetii, 118 (20%) were seropositive. The highest rates of infection were among the"sparrows", i.e., gold crowned- (80%), white crowned- (57%), and English- (50%). These high prevalence levels were followed by those for coot (45%), Brewer's blackbird (33%), crow (29%), robin (16%), pigeon(10%), and mallard duck (7%) (Riemann et al., 1979). Zonotrichia atricapilla (gold-crowned sparrow). 10 tested for agglutinating antibodies against C. burnetii, 3 positive (80%) (Riemann et al., 1979).
         112. Zonotrichia leucophrys :
              • Ontology: UMLS:C1011389
              • GenBank Taxonomy No.: 44393
              • Scientific Name: Zonotrichia leucophrys (NCBI Taxonomy)
              • Description: Of the 583 birds from 33 species that were tested for antibodies against C. burnetii, 118 (20%) were seropositive. The highest rates of infection were among the"sparrows", i.e., gold crowned- (80%), white crowned- (57%), and English- (50%). These high prevalence levels were followed by those for coot (45%), Brewer's blackbird (33%), crow (29%), robin (16%), pigeon(10%), and mallard duck (7%) (Riemann et al., 1979). Zonotrichia leucophrys (white-crowned sparrow). 48 tested for agglutinating antibodies against C. burnetii, 34 positive (57%) (Riemann et al., 1979).
         113. Kachuga :
              • Ontology: UMLS:C1465651
              • GenBank Taxonomy No.: 232865
              • Scientific Name: Kachuga (NCBI Taxonomy)
              • Description: Water snakes (Natrix natrix), rat snakes (Ptyas korros), cobras (Naja naja), pythons (Python molurus), tortoises (Kachuga sp.), plankton fish (Cirrhina mrigala), frogs (Rana tigrina), toads (Bufo sp.) and monitors (Varanus indicus) were screened for evidence of Q-fever infection by the capillary agglutination test on sera to detect antibodies and/or by attempts to demonstrate Coxiella burnetii in spleen and liver samples. Sero-reactors were observed among water and rat snakes, pythons and tortoises. The organism was isolated from the spleen and liver of the monitor, tortoise and python (Yadav and Sethi, 1979).
         114. Natrix natrix :
              • Ontology: UMLS:C1046444
              • GenBank Taxonomy No.: 100823
              • Scientific Name: Natrix natrix (NCBI Taxonomy)
              • Description: Water snakes (Natrix natrix), rat snakes (Ptyas korros), cobras (Naja naja), pythons (Python molurus), tortoises (Kachuga sp.), plankton fish (Cirrhina mrigala), frogs (Rana tigrina), toads (Bufo sp.) and monitors (Varanus indicus) were screened for evidence of Q-fever infection by the capillary agglutination test on sera to detect antibodies and/or by attempts to demonstrate Coxiella burnetii in spleen and liver samples. Sero-reactors were observed among water and rat snakes, pythons and tortoises. The organism was isolated from the spleen and liver of the monitor, tortoise and python (Yadav and Sethi, 1979).
         115. Ptyas korros :
              • Ontology: UMLS:C1030474
              • GenBank Taxonomy No.: 74367
              • Scientific Name: Ptyas korros (NCBI Taxonomy)
              • Description: Water snakes (Natrix natrix), rat snakes (Ptyas korros), cobras (Naja naja), pythons (Python molurus), tortoises (Kachuga sp.), plankton fish (Cirrhina mrigala), frogs (Rana tigrina), toads (Bufo sp.) and monitors (Varanus indicus) were screened for evidence of Q-fever infection by the capillary agglutination test on sera to detect antibodies and/or by attempts to demonstrate Coxiella burnetii in spleen and liver samples. Sero-reactors were observed among water and rat snakes, pythons and tortoises. The organism was isolated from the spleen and liver of the monitor, tortoise and python (Yadav and Sethi, 1979).
         116. Python molurus :
              • Ontology: UMLS:C0327302
              • GenBank Taxonomy No.: 51750
              • Scientific Name: Python molurus (NCBI Taxonomy)
              • Description: Water snakes (Natrix natrix), rat snakes (Ptyas korros), cobras (Naja naja), pythons (Python molurus), tortoises (Kachuga sp.), plankton fish (Cirrhina mrigala), frogs (Rana tigrina), toads (Bufo sp.) and monitors (Varanus indicus) were screened for evidence of Q-fever infection by the capillary agglutination test on sera to detect antibodies and/or by attempts to demonstrate Coxiella burnetii in spleen and liver samples. Sero-reactors were observed among water and rat snakes, pythons and tortoises. The organism was isolated from the spleen and liver of the monitor, tortoise and python (Yadav and Sethi, 1979).
      
      
   2. Infection Process:
      
      No infection process information is currently available here.
      
      
   3. Disease Information:
      
      No disease information is currently available here.
      
      
   4. Prevention:
      
      No prevention information is currently available here.
      
      
   5. Model System:
      
      No model system information is currently available here.
      
      
3. Arthropoda:
   1. Taxonomy Information:
      1. Species:
         1. Lone star tick :
            • Ontology: UMLS:C0323498
            • GenBank Taxonomy No.: 6943
            • Scientific Name: Amblyomma americanum (NCBI Taxonomy)
            • Description: C. burnetii has been isolated from nymphal and adult A. americanum collected in eastern Texas and Mississippi. However, the role of ticks in transmission of C. burnetii to humans is believed to be minimal and largely confined to maintenance of natural transmission cycles among wildlife (Childs and Paddock, 2003).
         2. Amblyomma paulopunctatum :
            • Ontology: UMLS:
            • GenBank Taxonomy No.:
            • Scientific Name: Amblyomma paulopunctatum (Waag et al., 1991)
            • Description: Tick found naturally infected with Coxiella burnetii: Amblyomma paulopunctatum. Found on a hippopotamus in Portugese Guinea in 1952 (Waag et al., 1991).
         3. Amblyomma nuttalli :
            • Ontology: UMLS:
            • GenBank Taxonomy No.:
            • Scientific Name: Amblyomma nuttalli (Waag et al., 1991)
            • Description: Tick found naturally infected with Coxiella burnetii: Amblyomma nuttalli. Found on a lizard in Portugese Guinea in 1952 (Waag et al., 1991).
         4. Amblyomma splendidum :
            • Scientific Name: Amblyomma splendidum (Waag et al., 1991)
            • Description: Tick found naturally infected with Coxiella burnetii: Amblyomma splendidum. Found on a buffalo in Portugese Guinea in 1952 (Waag et al., 1991).
         5. Amblyomma triguttatum triguttatum :
            • Ontology: UMLS:C1025496
            • GenBank Taxonomy No.: 65638
            • Scientific Name: Amblyomma triguttatum triguttatum (NCBI Taxonomy)
            • Description: The tick Amblyomma triguttatum triguttatum is a relatively common parasite of the larger macropod marsupials although it has also been recovered from cattle, horses, sheep, canines, pigs and humans (McDiarmid et al., 2000). The presence of A. t. triguttatum on Yorke Peninsula is of potential public and animal health significance as this species is a natural reservoir and vector of the rickettsia Coxiella burnetii, the causative agent of Q fever, to kangaroos and sheep (McDiarmid et al., 2000).
         6. Amblyomma variegatum :
            • Ontology: UMLS:C0323499
            • GenBank Taxonomy No.: 34610
            • Scientific Name: Amblyomma variegatum (NCBI Taxonomy)
            • Description: Tick found naturally infected with Coxiella burnetii: Amblyomma variegatum. Found on buffaloes in Belgian Congo in 1950 (Waag et al., 1991).
         7. Aponomma halli :
            • Scientific Name: Aponomma halli (Waag et al., 1991)
            • Description: Tick found naturally infected with Coxiella burnetii: Aponomma halli. Found on a lizard in Portugese Guinea in 1952 (Waag et al., 1991).
         8. Argas persicus :
            • Ontology: UMLS:C0323531
            • GenBank Taxonomy No.: 34603
            • Scientific Name: Argas persicus (NCBI Taxonomy)
            • Description: Tick found naturally infected with Coxiella burnetii: Argas persicus. Found on a domestic fowl in Portugese Guinea in 1952 (Waag et al., 1991).
         9. Argas reflexus :
            • Ontology: UMLS:C0323535
            • GenBank Taxonomy No.: 34604
            • Scientific Name: Argas reflexus (NCBI Taxonomy)
            • Description: Tick found naturally infected with Coxiella burnetii: Argas reflexus. Found on in the nest of a field sparrow in SW Uzbekistan in 1955 (Waag et al., 1991). The "soft ticks" were identified as Argas reflexus, and C. burnetii was identified by PCR in six of the 20 ticks studies (Stein and Raoult, 1999).
         10. Boophilus decoloratus :
             • Ontology: UMLS:C0323513
             • GenBank Taxonomy No.: 60189
             • Scientific Name: Boophilus decoloratus (NCBI Taxonomy)
             • Description: Tick found naturally infected with Coxiella burnetii: Boophilus decoloratus. Found on a cow in Portugese Guinea in 1952 (Waag et al., 1991).
         11. Dermacentor andersoni :
             • Ontology: UMLS:C0323431
             • GenBank Taxonomy No.: 34620
             • Scientific Name: Dermacentor andersoni (NCBI Taxonomy)
             • Description: Tick found naturally infected with Coxiella burnetii: Dermacentor andersoni. Found in Montana in 1938 (Waag et al., 1991).
         12. Dermacentor marginatus :
             • Ontology: UMLS:C0323437
             • GenBank Taxonomy No.: 49202
             • Scientific Name: Dermacentor marginatus (NCBI Taxonomy)
             • Description: 10 C. burnetii strains were isolated from Ixodes ricinus, Dermacentor reticulatus, D. marginatus, Haemaphysalis concinna, and H. inermis ticks species collected in different habitats (lowland and submontane) of Slovakia (Spitalska and Kocianova, 2003). C. burnetii was identified also by the immunofluorescence test in I. ricinus, D. marginatus and H. inermis ticks collected in Hungary (Spitalska and Kocianova, 2003).
         13. Dermacentor occidentalis :
             • Ontology: UMLS:C0323436
             • GenBank Taxonomy No.: 60254
             • Scientific Name: Dermacentor occidentalis (NCBI Taxonomy)
             • Description: Tick found naturally infected with Coxiella burnetii: Dermacentor occidentalis. Found in California in 1940 (Waag et al., 1991).
         14. Dermacentor parumapertus :
             • Ontology: UMLS:C0323433
             • GenBank Taxonomy No.: 60255
             • Scientific Name: Dermacentor parumapertus (NCBI Taxonomy)
             • Description: Tick found naturally infected with Coxiella burnetii: Dermacentor parumapertus. Found on rabbits in Utah in 1955 (Waag et al., 1991).
         15. Dermacentor reticulatus :
             • Ontology: UMLS:C0323438
             • GenBank Taxonomy No.: 57047
             • Scientific Name: Dermacentor reticulatus (NCBI Taxonomy)
             • Description: 10 C. burnetii strains were isolated from Ixodes ricinus, Dermacentor reticulatus, D. marginatus, Haemaphysalis concinna, and H. inermis ticks species collected in different habitats (lowland and submontane) of Slovakia (Spitalska and Kocianova, 2003).
         16. Haemaphysalis concinna :
             • Ontology: UMLS:C0323449
             • Scientific Name: Haemaphysalis concinna (Spitalska and Kocianova, 2003)
             • Description: 10 C. burnetii strains were isolated from Ixodes ricinus, Dermacentor reticulatus, D. marginatus, Haemaphysalis concinna, and H. inermis ticks species collected in different habitats (lowland and submontane) of Slovakia (Spitalska and Kocianova, 2003). Between 1987-1989 almost 7000 adult Ixodes ricinus, Dermacentor reticulatus, Dermacentor marginatus, Haemaphysalis concinna, Haemaphysalis punctata and Haemaphysalis inermis ticks collected in all 38 districts of Slovakia were screened for the presence of Coxiella burnetii . The proportion of ticks containing C. burnetii as indicated by the haemocyte test was less than 3%. Attempts to recover C. burnetii by inoculation of yolk sacs of embryonated hen eggs from pools of 1-6 specimens of haemocyte test positive ticks resulted in the isolation of 10 rickettsial strains. Six strains were recovered from I. ricinus, the remaining ones from single pools of D. reticulatus, D. marginatus. H. concinna and H. inermis ticks (Rehacek et al., 1991).
         17. Haemaphysalis inermis :
             • Ontology: UMLS:C0323458
             • GenBank Taxonomy No.: 48827
             • Scientific Name: Haemaphysalis inermis (NCBI Taxonomy)
             • Description: 10 C. burnetii strains were isolated from Ixodes ricinus, Dermacentor reticulatus, D. marginatus, Haemaphysalis concinna, and H. inermis ticks species collected in different habitats (lowland and submontane) of Slovakia (Spitalska and Kocianova, 2003). C. burnetii was identified also by the immunofluorescence test in I. ricinus, D. marginatus and H. inermis ticks collected in Hungary (Spitalska and Kocianova, 2003).
         18. Haemaphysalis intermedia :
             • Ontology: UMLS:
             • Scientific Name: Haemaphysalis intermedia (Padbidri et al., 1984)
             • Description: An extensive study on tick-borne rickettsioses in the Pune district of Maharashtra revealed that Indian tick typhus exists as a zoonosis, which only occasionally causes disease in man. By sero-conversion in guinea pigs, presumptive isolates of Rickettsia conorii and Coxiella burnetii were recovered from 4 of the 11 species of ticks examined. Boophilus microplus and Rhipicephalus haemaphysalis were found to be harbouring R. conorii whereas C. burnetii was isolated from Haemaphysalis intermedia and Hyalomma hussaini (Padbidri et al., 1984).
         19. Haemaphysalis humerosa :
             • Ontology: UMLS:C0323456
             • GenBank Taxonomy No.: 65643
             • Scientific Name: Haemaphysalis humerosa (NCBI Taxonomy)
             • Description: Tick found naturally infected with Coxiella burnetii: Haemaphysalis humerosa. Found on bandicoots in Australia in 1940 (Waag et al., 1991).
         20. Haemaphysalis leachi :
             • Ontology: UMLS:C0576447
             • GenBank Taxonomy No.: 44385
             • Scientific Name: Haemaphysalis leachi (NCBI Taxonomy)
             • Description: Tick found naturally infected with Coxiella burnetii: Haemaphysalis leachi. Found on a civet cat in Portugese Guinea in 1952 (Waag et al., 1991).
         21. Haemaphysalis leporispalustris :
             • Ontology: UMLS:C0323444
             • GenBank Taxonomy No.: 34624
             • Scientific Name: Haemaphysalis leporispalustris (NCBI Taxonomy)
             • Description: Tick found naturally infected with Coxiella burnetii: Haemaphysalis leporispalustris. Found on rabbits in Virginia in 1948 (Waag et al., 1991).
         22. Haemaphysalis punctata :
             • Ontology: UMLS:C0323445
             • GenBank Taxonomy No.: 49204
             • Scientific Name: Haemaphysalis punctata (NCBI Taxonomy)
             • Description: Between 1987-1989 almost 7000 adult Ixodes ricinus, Dermacentor reticulatus, Dermacentor marginatus, Haemaphysalis concinna, Haemaphysalis punctata and Haemaphysalis inermis ticks collected in all 38 districts of Slovakia were screened for the presence of Coxiella burnetii . The proportion of ticks containing C. burnetii as indicated by the haemocyte test was less than 3%. Attempts to recover C. burnetii by inoculation of yolk sacs of embryonated hen eggs from pools of 1-6 specimens of haemocyte test positive ticks resulted in the isolation of 10 rickettsial strains. Six strains were recovered from I. ricinus, the remaining ones from single pools of D. reticulatus, D. marginatus. H. concinna and H. inermis ticks. In addition to the previous recovery of C. burnetii from H. punctata ticks, the agent was thus isolated from all important ticks living in Slovakia. The agent was found in tick habitats regardless of the latitude and altitude in the entire country. These results are not consistent with the negligible number of Q fever cases occurring in past years in Slovakia (Rehacek et al., 1991).
         23. Hyalomma anatolicum :
             • Ontology: UMLS:C0323487
             • GenBank Taxonomy No.: 176092
             • Scientific Name: Hyalomma anatolicum (NCBI Taxonomy)
             • Description: Tick found naturally infected with Coxiella burnetii: Hyalomma anatolicum. Found on cows in the S. Kirhiz region of the USSR in 1956, and in Tadjikistan in 1955 (Waag et al., 1991).
         24. Hyalomma detritum :
             • Ontology: UMLS:C0323482, C0323491
             • Scientific Name: Hyalomma detritum (Waag et al., 1991)
             • Description: Tick found naturally infected with Coxiella burnetii: Hyalomma detritum. Found in the Soviet Central region of the USSR in 1955 (Waag et al., 1991).
         25. Hyalomma dromedarii :
             • Ontology: UMLS:C0323493
             • GenBank Taxonomy No.: 34626
             • Scientific Name: Hyalomma dromedarii (NCBI Taxonomy)
             • Description: Tick found naturally infected with Coxiella burnetii: Hyalomma dromedarii. Found on dromedaries in Morocco in 1947, and on dromedaries in Sudan in 1952 (Waag et al., 1991).
         26. Hyalomma excavatum :
             • Ontology: UMLS:C0323487
             • Scientific Name: Hyalomma excavatum (Waag et al., 1991)
             • Description: Tick found naturally infected with Coxiella burnetii: Hyalomma excavatum. Found in Morocco in 1947, on bulls in Sudan in 1952, and on cattle in Spain in 1950 (Waag et al., 1991).
         27. Hyalomma excavatum lusitanicum :
             • Scientific Name: Hyalomma excavatum lusitanicum (Waag et al., 1991)
             • Description: Tick found naturally infected with Coxiella burnetii: Hyalomma excavatum lusitanicum. Found on a gerbil in Morocco in 1948 (Waag et al., 1991).
         28. Hyalomma hussaini :
             • Ontology: UMLS:C1190401
             • GenBank Taxonomy No.: 139400
             • Scientific Name: Hyalomma hussaini (NCBI Taxonomy)
             • Description: An extensive study on tick-borne rickettsioses in the Pune district of Maharashtra revealed that Indian tick typhus exists as a zoonosis, which only occasionally causes disease in man. By sero-conversion in guinea pigs, presumptive isolates of Rickettsia conorii and Coxiella burnetii were recovered from 4 of the 11 species of ticks examined. Boophilus microplus and Rhipicephalus haemaphysalis were found to be harbouring R. conorii whereas C. burnetii was isolated from Haemaphysalis intermedia and Hyalomma hussaini (Padbidri et al., 1984).
         29. Hyalomma mauritanicum :
             • Ontology: UMLS:C0323482
             • Scientific Name: Hyalomma mauritanicum (Waag et al., 1991)
             • Description: Tick found naturally infected with Coxiella burnetii: Hyalomma mauritanicum. Found on cattle in Algeria and Morocco in 1948, and on claves in Spain in 1949 (Waag et al., 1991).
         30. Hyalomma plumbeum :
             • Scientific Name: Hyalomma plumbeum (Waag et al., 1991)
             • Description: Tick found naturally infected with Coxiella burnetii: Hyalomma plumbeum. Found on domestic and wild animals in the Crimea region of the USSR in 1954 (Waag et al., 1991).
         31. Hyalomma plumbeum plumbeum :
             • Ontology: UMLS:C0323483
             • Scientific Name: Hyalomma plumbeum plumbeum (Waag et al., 1991)
             • Description: Tick found naturally infected with Coxiella burnetii: Hyalomma plumbeum plumbeum. Found in Azerbaijan in the USSR in 1954 (Waag et al., 1991).
         32. Hyalomma savignyi :
             • Ontology: UMLS:C0323492
             • Scientific Name: Hyalomma savignyi (Waag et al., 1991)
             • Description: Tick found naturally infected with Coxiella burnetii: Hyalomma savignyi. Found on sheep and goats in Spain in 1951 (Waag et al., 1991).
         33. Ixodes crenulatus :
             • Scientific Name: Ixodes crenulatus (Waag et al., 1991)
             • Description: Tick found naturally infected with Coxiella burnetii: Ixodes crenulatus. Found on polecats in N. Kazakhstan in the USSR in 1954 (Waag et al., 1991).
         34. Ixodes dentatus :
             • Scientific Name: Ixodes dentatus (Waag et al., 1991)
             • Description: Tick found naturally infected with Coxiella burnetii: Ixodes dentatus. Found on rabbits in New York and Virginia in 1948 (Waag et al., 1991).
         35. Paralysis tick :
             • Ontology: UMLS:C0323405
             • GenBank Taxonomy No.: 65647
             • Scientific Name: Ixodes holocyclus (NCBI Taxonomy)
             • Description: Tick found naturally infected with Coxiella burnetii: Ixodes holocyclus. Found on cattle in Australia in 1953 (Waag et al., 1991).
         36. Castor bean tick :
             • Ontology: UMLS:C0282509
             • GenBank Taxonomy No.: 34613
             • Scientific Name: Ixodes ricinus (NCBI Taxonomy)
             • Description: 10 C. burnetii strains were isolated from Ixodes ricinus, Dermacentor reticulatus, D. marginatus, Haemaphysalis concinna, and H. inermis ticks species collected in different habitats (lowland and submontane) of Slovakia (Spitalska and Kocianova, 2003). C. burnetii was identified also by the immunofluorescence test in I. ricinus, D. marginatus and H. inermis ticks collected in Hungary (Spitalska and Kocianova, 2003). Tick found naturally infected with Coxiella burnetii: Ixodes ricinus. Found in SE Bohemia in Czechoslovakia in 1957, and on dogs in Germany in 1950 (Waag et al., 1991).
         37. Otobius megnini :
             • Ontology: UMLS:C0323544
             • GenBank Taxonomy No.: 34606
             • Scientific Name: Otobius megnini (NCBI Taxonomy)
             • Description: Tick found naturally infected with Coxiella burnetii: Otobius megnini. Found on cattle in California in 1948 (Waag et al., 1991).
         38. Ornithodoros coriaceus :
             • Ontology: UMLS:C0323569
             • GenBank Taxonomy No.: 92741
             • Scientific Name: Ornithodoros coriaceus (NCBI Taxonomy)
             • Description: TC. burnetii has been found in a variety of ticks in the United States, including D. andersoni in Montana and Wyoming, Amblyomma americanum in Mississippi, and Dermacentor occidentalis and Ornithodoros coriaceus in California (McQuiston and Childs, 2002).
         39. Ornithodoros lahorensis :
             • Ontology: UMLS:C0323562
             • Scientific Name: Ornithodoros lahorensis (Waag et al., 1991)
             • Description: Tick found naturally infected with Coxiella burnetii: Ornithodoros lahorensis. Found in Turkey in 1952 (Waag et al., 1991).
         40. Soft tick :
             • Ontology: UMLS:C0323547
             • GenBank Taxonomy No.: 6938
             • Scientific Name: Ornithodoros moubata (NCBI Taxonomy)
             • Description: Tick found naturally infected with Coxiella burnetii: Ornithodoros moubata. Found in Belgian Congo in Africa in 1951 (Waag et al., 1991).
         41. Rhipicephalus bursa :
             • Ontology: UMLS:C0323470
             • GenBank Taxonomy No.: 67831
             • Scientific Name: Rhipicephalus bursa (NCBI Taxonomy)
             • Description: Tick found naturally infected with Coxiella burnetii: Rhipicephalus bursa. Found on calves in Spain in 1950 and in Crimea in the USSR in 1955 (Waag et al., 1991).
         42. Rhipicephalus cuspidatus :
             • Scientific Name: Rhipicephalus cuspidatus (Waag et al., 1991)
             • Description: Tick found naturally infected with Coxiella burnetii: Rhipicephalus cuspidatus. Found on an anteater in Portugese Guinea in Africa in 1952 (Waag et al., 1991).
         43. Rhipicephalus haemaphysalis :
             • Scientific Name: Rhipicephalus haemaphysalis (Padbidri et al., 1984)
             • Description: An extensive study on tick-borne rickettsioses in the Pune district of Maharashtra revealed that Indian tick typhus exists as a zoonosis, which only occasionally causes disease in man. By sero-conversion in guinea pigs, presumptive isolates of Rickettsia conorii and Coxiella burnetii were recovered from 4 of the 11 species of ticks examined. Boophilus microplus and Rhipicephalus haemaphysalis were found to be harbouring R. conorii whereas C. burnetii was isolated from Haemaphysalis intermedia and Hyalomma hussaini in addition to the above mentioned 2 tick species (Padbidri et al., 1984).
         44. Brown dog tick :
             • Ontology: UMLS:C0323465
             • GenBank Taxonomy No.: 34632
             • Scientific Name: Rhipicephalus sanguineus (NCBI Taxonomy)
             • Description: Query (Q) fever is an ubiquitous zoonotic disease caused by Coxiella burnetii. This micro-organism has been found in several tick species including R. sanguineus (Bernasconi et al., 2002). Tick found naturally infected with Coxiella burnetii: Rhipicephalus sanguineus. Found on in Belgian Congo in Africa in 1951, on a dog in Portugese Guinea in 1952, on dormice in Spain in 1950, and in Takjikistan in 1955 (Waag et al., 1991).
         45. Rhipicephalus senegalensis :
             • Scientific Name: Rhipicephalus senegalensis (Waag et al., 1991)
             • Description: Tick found naturally infected with Coxiella burnetii: Rhipicephalus senegalensis. Found in Portugese Guinea in Africa in 1952 (Waag et al., 1991).
         46. Rhipicephalus simus :
             • Ontology: UMLS:C1029605
             • GenBank Taxonomy No.: 72861
             • Scientific Name: Rhipicephalus simus (NCBI Taxonomy)
             • Description: Tick found naturally infected with Coxiella burnetii: Rhipicephalus simus simus. Found on a cow in Portugese Guinea in Africa in 1952 (Waag et al., 1991).
         47. Haematopinus eurysternus :
             • Ontology: UMLS:C0322625
             • Scientific Name: Haematopinus eurysternus (Reeves et al., 2006)
             • Description: We collected 1,023 lice, representing 5 species, from rats and domestic cattle throughout 13 governorates in Egypt and tested these lice for Anaplasma marginale, Bartonella spp., Brucella spp., Borrelia recurrentis, Coxiella burnetii, Francisella tularensis, and Rickettsia spp. by PCR amplification and sequencing. Five different louse-borne bacterial agents were detected in lice from rodents or cattle, including "Bartonella rattimassiliensis", "B. phoceensis", and Bartonella sp. near Bartonella tribocorum, Coxiella burnetii, and Rickettsia typhi (Reeves et al., 2006). Species of louse: Haematopinus eurysternus. Collection site: El Warsha. Date: 27 August 2002. Host: Bos taurus. Bacterial agents detected: Coxiella burnetii (Reeves et al., 2006). Coxiella burnetii, the agent of Q fever, was detected in a pool of 5 nymphs of H. eurysternus from a cow in El Warsha, Ismailia Governorate (Reeves et al., 2006).
      
      
   2. Infection Process:
      
      No infection process information is currently available here.
      
      
   3. Disease Information:
      
      No disease information is currently available here.
      
      
   4. Prevention:
      
      No prevention information is currently available here.
      
      
   5. Model System:
      
      No model system information is currently available here.
      
      

IV. Labwork Information

A. Biosafety Information:

1. General biosafety information :
   • Biosafety Level: Biosafety Level 3 (CDC. Biosafety).
   • Precautions:
     • C. burnetii is a highly infectious agent, and many laboratory-acquired cases of Q fever have been described. Thus, clinical materials from patients supposedly infected with C. burnetii should be handled with care by experienced personnel wearing gloves and masks and only in biosafety level 3 laboratories. The same measures should be applied when manipulating C. burnetii-infected cell cultures or C. burnetii-infected animals (Maurin and Raoult, 1999).

B. Culturing Information:

1. C. burnetii in Yolk Sacs :
   1. Description: Only biosafety level 3 laboratories should be allowed to work with coxiella cultures (Madariaga et al., 2003). C. burnetii can be cultivated in research laboratories. Yolk sacs of embryonated hens' eggs at age 5-7 days are an excellent culture medium. After 10-12 days of incubation at 35 C, a large number of organisms can be seen. Purification of Coxiella from yolk sacs is laborious and requires differential centrifugation. 1-2 g purified C. burnetii can be obtained from 72 eggs (Madariaga et al., 2003). In culture, Coxiella has a phase I and a phase II. The virulent phase I is isolated from natural infections, and in the laboratory, the avirulent phase II is obtained only after several passages in egg or tissue culture. The phase-variation phenomenon is similar to the smooth to rough lipopolysaccharide transition of Enterobacteriaceae. The lipopolysaccharide of C. burnetii is a determinant of the virulence of the organism and dependent on the structure of the lipopolysaccharide some strains might be able to produce a more severe or chronic disease (Madariaga et al., 2003).
      
      
   2. Medium:
      1. Yolk sacs (Madariaga et al., 2003).
   3. Optimal Temperature: 37 C (Madariaga et al., 2003).
2. Coxiella burnetii culturing in the Baby hamster kidney BHK-21 cells :
   1. Description: Coxiella burnetii, a slow-growing, gram-negative, obligate intracellular bacterium, is the causative agent of Q fever in humans. The avirulent Phase II C. burnetii Nine Mile strain can invade and establish persistent infections in a wide variety of laboratory cell lines, and is generally considered to be easier to grow in culture than the wild-type Phase I organism. Efforts to improve Phase I organism yield in the BHK-21 cell line demonstrated that high CO2 conditions and the use of Dulbecco's modified Eagle's medium (DMEM) with 4.5 g/l glucose supplementation resulted in higher organism yields. Phase II organisms grown in the same cell line and conditions showed lower growth rates. Analysis revealed that increased average numbers of C. burnetii Phase I organisms within fibroblasts was due to higher growth rates within the hosts rather than to increased uptake or to increased cell-to-cell spreading. Addition of the nucleoside cytidine to the growth medium stimulated growth of Phase II but not Phase I organisms (Miller et al., 2004). Only biosafety level 3 laboratories should be allowed to work with coxiella cultures (Madariaga et al., 2003).
      
      
   2. Medium:
      1. Dulbecco's modified Eagle's medium (DMEM) with 4.5 g/l glucose supplementation (Miller et al., 2004).
   3. Optimal Temperature: 37 C (Miller et al., 2004).
3. Coxiella burnetii culturing in the Buffalo green monkey (BGM) cell line :
   1. Description: The C. burnetii Nine Mile RSA 493 phase I strain (American isolate, kindly provided by L. Mallavia, Washington State University, Pullman, Wash.) was used in the study. The bacteria were grown in the BGM cell line (Flow Laboratories). The cell growth medium was Eagle's minimal essential medium (MEM) supplemented with Earle's salts, 2 mM L-glutamine, 0.2% NaHCO3 (Nordcell, Bromma, Sweden), 5% calf serum, and 1% nonessential amino acids (Sigma). Confluent cell layers were infected with the bacteria and incubated at 37 C. Fresh medium was added after 20 to 24 h. C. burnetii was collected from the media of actively growing cultures after 7 or 8 days by a differential centrifugation method. An initial centrifugation at 4,000 x g for 8 min at 4 C removed cell debris, and a second centrifugation at 25,000 x g for 20 min at 4 C collected the bacteria (Macellaro et al., 1998). Only biosafety level 3 laboratories should be allowed to work with coxiella cultures (Madariaga et al., 2003).
      
      
   2. Medium:
      1. Eagle's minimal essential medium (MEM) supplemented with Earle's salts, 2 mM L-glutamine, 0.2% NaHCO3 (Nordcell, Bromma, Sweden), 5% calf serum, and 1% nonessential amino acids (Macellaro et al., 1998).
   3. Optimal Temperature: 37 C (Macellaro et al., 1998).
4. Coxiella burnetii culturing in the Human embryonic lung fibroblasts (HEL) cells :
   1. Description: Human embryonic lung fibroblasts (HEL cells) grown in shell vials are used routinely in laboratory because of their high susceptibility to C. burnetii infection and easy maintenance. Several human specimens, including blood, cerebrospinal fluid, bone marrow, cardiac valve, vascular aneurysm or graft, bone biopsy, liver biopsy, milk, placenta, and fetal specimens after abortion, are suitable for C. burnetii culture. Cell monolayers in shell vials are inoculated with 1 ml of clinical specimen and centrifuged (700 x g at 20 C) for 1 h to enhance attachment and penetration of C. burnetii into cells. Inoculated monolayers are incubated at 37 C in 5% CO2 for 5 to 7 days. C. burnetii is usually observed by microscopic examination of cell monolayers after Gimenez or immunofluorescence staining (Maurin and Raoult, 1999).
      
      
   2. Optimal Temperature: 37 C (Maurin and Raoult, 1999).

C. Diagnostic Tests :

1. Organism Detection Tests:
   1. Gimenez staining and light microscopy:
      1. Ontology: UMLS:C0523206
      2. Description: After an incubation period of 6 days, detection of C. burnetii within the cells is achieved by microscopic examination after staining. The organism appears as a short rod which is not stained by Gram staining but which is visible after Giemsa or Gimenez staining (Fournier et al., 1998).
   2. Immunofluorescence microscopy:
      1. Ontology: UMLS:C0079604
      2. Description: The identification of C. burnetii within the cells is performed by a direct immunofluorescence assay with polyclonal or monoclonal anti-C. burnetii antibodies conjugated to fluorescein isothiocyanate (Fournier et al., 1998).
   
   
2. Immunoassay Tests:
   1. Immunofluorescence assay:
      1. Ontology: UMLS:C0079603
      2. Description: Currently, the immunofluorescence assay is the reference method for the serodiagnosis of Q fever. It is the simplest and one of the most accurate serologic techniques. To prepare antigens for this test, phase II C. burnetii Nine Mile reference strain is grown in confluent layers of L929 mouse fibroblasts, and phase I antigens are obtained from the mice spleens inoculated with phase II organisms. This method of preparation has been demonstrated to yield antigens with the highest sensitivity for C. burnetii antibody detection (Scola, 2002).
   2. Micro-immunofluorescence technique:
      1. Description: Sera are diluted in phosphate buffered saline with 3 percent nonfat powdered milk to avoid nonspecific fixation of antibodies. This method can be used to determine antibodies to phases I and II in the IgG, IgM, and IgA fractions. However, test results can be confounded by the presence of a rheumatoid factor. Thus, a rheumatoid factor absorbant is used to remove IgG before the determination of IgM and IgA. The choice of a negative cutoff titer depends upon the source and purity of the antigen and the amount of background antigen stimulation in the population to be studied. Authors use a 1:50 dilution as a first positive dilution. Screening is performed with anti-phase II anti-immunoglobulins with a 1:50 dilution for the tested sera. Positive sera then are diluted serially and tested for the presence of anti-phase I and II IgG, IgM, and IgA. Seroconversion usually is detected 7 to 15 days after the onset of clinical symptoms. Approximately 90 percent of patients have detectable antibodies by the third week (Scola, 2002).
   3. Complement fixation:
      1. Ontology: UMLS:C0301911
      2. Description: Complement fixation is very specific, although it is less specific than the immunofluorescence assay, but it lacks sensitivity. Sera are heat inactivated before testing against phase II antigens. This method detects both anti-phase I and II antibodies. However, a prozone phenomenon may be present with serum specimens from patients with chronic Q fever, and this phenomenon could result in a false-negative test. It is also more time-consuming than the immunofluorescence assay. Moreover, cross-reaction with hen egg antigens may result in false-positive results. The interpretation of results requires acute- and convalescent-phase serum samples. Seroconversion is detected later by the complement fixation test than by the immunofluorescence assay or ELISA (between 10 and 20 days after the onset of symptoms) (Fournier et al., 1998).
   4. ELISA:
      1. Ontology: UMLS:C0014441
      2. Description: ELISA might be the preferred method of diagnosis in a mass casualty event (Madariaga et al., 2003). First described by Field et al., ELISA was described as more specific and sensitive than complement fixation for the diagnosis of Q fever. It was then proposed as a good method for seroepidemiological surveys. Peter et al. and Cowley et al. have demonstrated that this technique was even more sensitive than the immunofluorescence assay and could serve for the serodiagnosis of Q fever. However, it is a more laborious technique than the immunofluorescence assay and it requires a considerable experience in interpreting the results. Therefore, its application to Q fever diagnosis is still limited. Technically, microtiter plates are coated with purified C. burnetii antigens. Serially diluted sera in phosphate-buffered saline containing 0.1% Tween 20 are then incubated with the antigens, and antibodies are detected with alkaline phosphatase-conjugated rabbit anti-human IgG, IgM, and IgA. Both anti-phase I and II antibodies are detected (Fournier et al., 1998).
   
   
3. Nucleic Acid Detection Tests: :
   1. PCR detection of Coxiella burnetii from different clinical specimens based on a repetitive, transposonlike element (Trans-PCR):
      1. Description: For PCR detection of Coxiella burnetii in various clinical specimens authors developed a sample preparation method in which silica binding of DNA was used. This method was found to be fast, easily performed with large numbers of samples, and equally sensitive for all of the specimens tested (livers, spleens, placentas, heart valves, milk, blood) (Lorenz et al., 1998). To verify the identity of the PCR amplicon, it was sequenced completely by using PCR primers Trans1 and Trans2, as well as two internal primers (Trans3 and Trans4). In all cases the sequence of the amplicon was identical to the sequence in the EMBL/GenBank database (Lorenz et al., 1998).
      2. Primers:
         • Pair of primers
           • Forward: Trans1: TATGTATCCACCGTAGCCAGT (Lorenz et al., 1998)
           • Reverse: Trans2: CCCAACAACACCTCCTTATTC (Lorenz et al., 1998)
         • Pair of primers
           • Forward: Trans3: GTAACGATGCGCAGGCGA (Lorenz et al., 1998)
           • Reverse: Trans4: CCACCGCTTCGCTCGCTA (Lorenz et al., 1998)
           • Product
             • Size: 687 bp.
             • Product GenBank Accession Number: M80806
   2. PCR detection of Coxiella burnetii long-term persistence in the host based on an insertion sequence IS1111a:
      1. Description: The numbers of organisms, their viability and cellular form, and the underlying organ sites of latent infection for the coxiella are obscure. During investigations of 29 patients with a chronic sequel to acute Q fever, the post-Q fever fatigue syndrome (QFS), sensitive conventional and TaqMan-based PCR revealed low levels of C. burnetii DNA in blood mononuclear cells (5/29; 17%), thin needle liver biopsies (2/14; 14%) and, notably, in bone marrow aspirates (13/20; 65%). Irrespective of the ultimate significance of coxiella persistence for QFS, the detection of C. burnetii genomic DNA in bone marrow several years after a primary infection unveils a new pathological dimension for Q fever (Harris et al., 2000).
      2. Primers:
         • Conventional PCR
           • Forward: P1717f: TCATCGTTCCCGGCAGTT (Harris et al., 2000)
           • Reverse: P2789r: CACCTCCTTATTCCCACTCGAA (Harris et al., 2000)
           • Product
             • Size: 73 bp.
         • TaqMan-based PCR
           • Forward: P1671f: TAACGGCGCTCTCGGTTT (Harris et al., 2000)
           • Reverse: P2731r: TGCCGGGAACGATGAAA (Harris et al., 2000)
           • Real-time-probe: Probe 713-690: FAM-TGATGAATGTCACCCACGCTCGCA-TAMRA (Harris et al., 2000)
           • Product
             • Size: 61 bp.
   3. Nested PCR assay for the detection of Coxiella burnetii in human serum samples based on the com1 gene encoding a 27-kDa outer membrane protein:
      1. Description: A nested PCR method was developed for the detection of Coxiella burnetii in human serum samples. Two pairs of oligonucleotide primers were designed to amplify a 438-bp fragment of the com1 gene encoding a 27-kDa outer membrane protein of C. burnetii. The primers amplified the predicted fragments of 21 various strains of C. burnetii but did not react with DNA samples from other microorganisms. The 438-bp amplification products could be digested with restriction enzymes SspI and SalI. The utility of the nested PCR was evaluated by testing human serum samples. The com1 gene fragment was amplified from 135 (87%) of 155 indirect immunofluorescence test (IF)-positive serum samples and from 11 (11%) of 100 IF-negative serum samples. The nested PCR with primers targeted to the com1 gene appeared to be a sensitive, specific, and useful method for the detection of C. burnetii in serum samples (Zhang et al., 1998 (b)).
      2. Primers:
         • First amplification
           • Forward: OMP1: AGTAGAAGCATCCCAAGCATTG (Zhang et al., 1998 (b))
           • Reverse: OMP2: TGCCTGCTAGCTGTAACGATTG (Zhang et al., 1998 (b))
           • Product
             • Size: 501 bp.
         • Second amplification
           • Forward: OMP3: GAAGCGCAACAAGAAGAACAC (Zhang et al., 1998 (b))
           • Reverse: OMP4: TTGGAAGTTATCACGCAGTTG (Zhang et al., 1998 (b))
           • Product
             • Size: 438 bp.
   4. Nested PCR detection of Coxiella burnetii plasmids in human sera:
      1. Description: Nested PCR assays were used for the direct identification of Coxiella burnetii plasmids in human sera. A total of 81 serum samples from 81 patients with Q fever were tested by nested PCR with four sets of primers. The first set of primers was used to detect the genomic sequences. The second set of primers was used to detect the conserved sequences of the plasmids. Another two sets of primers were used to identify the QpH1 and QpRS plasmids. QpH1 and QpRS plasmid-specific sequences were identified in 40 (49.4%) and 24 (29.6%) of the serum samples, respectively. Both of the QpH1 and QpRS plasmid-specific sequences were detected in 5 (8.6%) of the serum samples but were not found in 12 (20.7%) of the serum samples. Furthermore, all of the 23 acute-phase serum samples were positive for the QpH1 plasmid and negative for the QpRS plasmid (Zhang et al., 1998 (a)).
      2. Primers:
         • First round of nested PCR for detection of conserved plasmid sequences
           • Forward: Hfrag1: ATTGCTATCACTGAGGGTGACG (Zhang et al., 1998 (a))
           • Reverse: Hfrag2: CTGACGAAGAAGCAGCATAGC (Zhang et al., 1998 (a))
           • Product
             • Size: 508 bp.
         • Second round for detection of conserved plasmid sequences
           • Forward: HF1: TCCTAAACAAGTGATGGTCTCC (Zhang et al., 1998 (a))
           • Reverse: HF2: TTCGCAGAAGTCAGCTATGC (Zhang et al., 1998 (a))
           • Product
             • Size: 183 bp.
         • First round of nested PCR for detection of QpH1 plasmid
           • Forward: CB5: ATAATGAGATTAGAACAACCAAGA (Zhang et al., 1998 (a))
           • Reverse: CB6: TCTTTCTTGTTCATTTTCTGAGTC (Zhang et al., 1998 (a))
           • Product
             • Size: 977 bp.
         • Second round for detection of QpH1 plasmid
           • Forward: CB3: TAATAGAACGTGTTAATCG (Zhang et al., 1998 (a))
           • Reverse: CB4: GCTGGCAATCTGCTCGGC (Zhang et al., 1998 (a))
           • Product
             • Size: 266 bp.
         • First round of nested PCR for detection of QpRS plasmid
           • Forward: QpRS1: CTCGTACCCAAAGACTATGAATATATCC (Zhang et al., 1998 (a))
           • Reverse: QpRS2: AACACCGATCAATGCGACTAGCCC (Zhang et al., 1998 (a))
           • Product
             • Size: 693 bp.
         • Second round for detection of QpRS plasmid
           • Forward: QpRS3: ACTTTACGTCGTTTAATTCGC (Zhang et al., 1998 (a))
           • Reverse: QpRS4: CACATTGGGTATCGTACTGTCCCT (Zhang et al., 1998 (a))
           • Product
             • Size: 309 bp.
   5. Detection, isolation, and molecular identification of eight strains of Coxiella burnetii from clinical samples:
      1. Description: In order to avoid time-consuming cultures, to achieve direct detection of Coxiella burnetii in clinical samples (blood, buffy coat, etc.), and to increase the specificity and sensitivity of the detection, nested PCR was performed. The first step of DNA extraction was performed with the QIAamp blood kit 250. For the second step of the PCR assays, the conditions of temperature and times of recycling were properly modified, and the microorganism was detected within 4 h. Spyridaki et al. study demonstrates that Q fever is an endemic disease in Crete and that the diagnosis of Coxiella burnetii infection can be rapidly achieved by the detection of the microorganism in buffy coat samples by nested PCR (Spyridaki et al., 1998).
      2. Primers:
         • Detection of superoxide dismutase gene
           • Forward: C.B.1: ACTCAACGCACTGGAACCGC (Spyridaki et al., 1998)
           • Reverse: C.B.2: TAGCTGAAGCCAATTCGCC (Spyridaki et al., 1998)
           • Product
             • Size: 257 bp.
         • Detection of superoxide dismutase gene (shotgun HindIII)
           • Forward: G4131: CTGATGTGTCAAGTAATGTCGG (Spyridaki et al., 1998)
           • Reverse: G4132: GTTCATGGTTATGATTCTGCG (Spyridaki et al., 1998)
           • Product
             • Size: 183 bp.
         • Detection of 16S rRNA
           • Forward: 16S1: CTCCTGGCGGCGAGAGTGGC (Spyridaki et al., 1998)
           • Reverse: 16S2N: GTTAGCTTCGCTACTAAGAAGGGAACTTCC C (Spyridaki et al., 1998)
           • Product
             • Size: 779 bp.
         • Detection of QpRS plasmid
           • Forward: QpRS01: CTCGTACCCAAAGACTATGAATATATCC (Spyridaki et al., 1998)
           • Reverse: QpRS02: CACATTGGGTATCGTACTGTCCCT (Spyridaki et al., 1998)
           • Product
             • Size: 363 bp.
         • Detection of QpH1 plasmid
           • Forward: QpH11: TGACAAATAGAATTTCTTCATTTTGATG (Spyridaki et al., 1998)
           • Reverse: QpH12: GCTTATTTTCTTCCTCGAATCTATGAAT (Spyridaki et al., 1998)
           • Product
             • Size: 1,042 bp.
         • Nested PCR
           • Forward: Hfrag1: ATTGCTATCACTGAGGGTGACG (Spyridaki et al., 1998)
           • Reverse: Hfrag2: CTGACGAAGAAGCAGCATTAGC (Spyridaki et al., 1998)
           • Product
             • Size: 508 bp.
         • Nested PCR
           • Forward: HF1: TCCTAAACAAGTGATGGTCTCC (Spyridaki et al., 1998)
           • Reverse: HF2: TTCGCAGAAGTCAGCTATGC (Spyridaki et al., 1998)
           • Product
             • Size: 183 bp.
   
   
4. Other Types of Diagnostic Tests:
   
   No other tests available here.
   
   

V. References

A. Journal References:

Arricau-Bouvery and Rodolakis, 2005: Arricau-Bouvery N, Rodolakis A. Is Q fever an emerging or re-emerging zoonosis?. Vet Res. 2005; 36(3): 327 - 349. [PubMed: 15845229].

Babudieri, 1959: Babudieri B. Q fever: a zoonosis. Advances in Veterinary Science. 1959; 5(): 81 - 182. [PubMed: ].

Baca and Paretsky, 1983: Baca OG, Paretsky D. Q fever and Coxiella burnetii: a model for host-parasite interactions. Microbiol Rev. 1983; 47(2): 127 - 149. [PubMed: 6348504].

Beare et al., 2006: Beare PA, Samuel JE, Howe D, Virtaneva K, Porcella SF, Heinzen RA. Genetic diversity of the Q fever agent, Coxiella burnetii, assessed by microarray-based whole-genome comparisons. J Bacteriol. 2006; 188(7): 2309 - 2324. [PubMed: 16547017].

Bernasconi et al., 2002: Bernasconi MV, Casati S, Peter O, Piffaretti JC. Rhipicephalus ticks infected with Rickettsia and Coxiella in Southern Switzerland (Canton Ticino). Infect Genet Evol. 2002; 2(2): 111 - 120. [PubMed: 12797987].

Berri et al., 2005: Berri M, Crochet D, Santiago S, Rodolakis A. Spread of Coxiella burnetii infection in a flock of sheep after an episode of Q fever. Vet Rec. 2005; 157(23): 737 - 740. [PubMed: 16326967].

Bossi et al., 2004: Bossi P, Tegnell A, Baka A, Van Loock F, Hendriks J, Werner A, Maidhof H, Gouvras G. Bichat guidelines for the clinical management of Q fever and bioterrorism-related Q fever . Euro Surveill. 2004; 9(12):E19-20 (12): E19 - E20. [PubMed: 15677840].

Brouqui and Raoult, 2001: Brouqui P, Raoult D. Endocarditis due to rare and fastidious bacteria. Clin Microbiol Rev. 2001; 14(1): 177 - 207. [PubMed: 11148009].

Burgdorfer et al., 1963: Burgdorfer W, Pickens EG, Newhouse VF, Lackman DB. Isolation of Coxiella burnetii from rodents in western Montana. J Infect Dis. 1963; 112(): 181 - 186. [PubMed: 14016948].

Centers for Disease Control, 2002: Centers for Disease Control From the Centers for Disease Control and Prevention. Q fever--California, Georgia, Pennsylvania, and Tennessee, 2000-2001. JAMA. 2002; 288(19): 2398 - 2400. [PubMed: 12442754].

Childs and Paddock, 2003: Childs JE, Childs JE, Paddock CD. The ascendancy of Amblyomma americanum as a vector of pathogens affecting humans in the United States. Annu Rev Entomol. 2003; 48(): 307 - 337. [PubMed: 12414740].

Clark et al., 1983: Clark RK, Jessup DA, Hird DW, Ruppanner R, Meyer ME. Serologic survey of California wild hogs for antibodies against selected zoonotic disease agents. J Am Vet Med Assoc. 1983; 183(11): 1248 - 1251. [PubMed: 6315659].

Comer et al., 2001: Comer JA, Paddock CD, Childs JE. Urban zoonoses caused by Bartonella, Coxiella, Ehrlichia, and Rickettsia species. Vector Borne Zoonotic Dis. 2001; 1(2): 91 - 118. [PubMed: 12653141].

Daiter, 1977: Daiter AB. Transovarial and transspermal transmission of Coxiella burneti by the tick Hyalomma asiaticum and its role in the ecology of Q-rickettsiosis. Parazitologiia. 1977; 11(5): 403 - 411. [PubMed: 909725].

DeForge and Cone, 2006: DeForge JR, Cone LA. The serologic prevalence of Q fever (Coxiella burnetii) complement-fixing antibodies in the Peninsular bighorn sheep of Southern California. Am J Trop Med Hyg. 2006; 75(2): 315 - 317. [PubMed: 16896140].

Dunbar et al., 1998: Dunbar MR, Cunningham MW, Roof JC. Seroprevalence of selected disease agents from free-ranging black bears in Florida. J Wildl Dis. 1998; 34(3): 612 - 619. [PubMed: 9706572].

Ejercito et al., 1993: Ejercito CL, Cai L, Htwe KK, Taki M, Inoshima Y, Kondo T, Kano C, Abe S, Shirota K, Sugimoto T. Serological evidence of Coxiella burnetii infection in wild animals in Japan. J Wildl Dis. 1993; 29(3): 481 - 484. [PubMed: 8355353].

Fournier et al., 1998: Fournier PE, Marrie TJ, Raoult D. Diagnosis of Q fever. J Clin Microbiol. 1998; 36(7): 1823 - 1834. [PubMed: 9650920].

Gardon et al., 2001: Gardon J, Heraud JM, Laventure S, Ladam A, Capot P, Fouquet E, Favre J, Weber S, Hommel D, Hulin A, Couratte Y, Talarmin A. Suburban transmission of Q fever in French Guiana: evidence of a wild reservoir. J Infect Dis. 2001; 184(3): 278 - 284. [PubMed: 11443552].

Harris et al., 2000: Harris RL, Storm PA, Lloyd A, Arens M, Marmion BP. Long-term persistence of Coxiella burnetii in the host after primary Q fever. Epidemiol Infect. 2000; 124(3): 543 - 549. [PubMed: 10982079].

Heinzen et al., 1999: Heinzen RA, Hackstadt T, Samuel JE. Developmental biology of Coxiella burnetii. Trends Microbiol. 1999; 7(4): 149 - 154. [PubMed: 10217829].

Hubalek et al., 1993: Hubalek Z, Juricova Z, Svobodova S, Halouzka J. A serologic survey for some bacterial and viral zoonoses in game animals in the Czech Republic. J Wildl Dis. 1993; 29(4): 604 - 607. [PubMed: 8258864].

Jager et al., 2002: Jager C, Lautenschlager S, Willems H, Baljer G. Coxiella burnetii plasmid types QpDG and QpH1 are closely related and likely identical. Vet Microbiol. 2002; 89(2-3): 161 - 166. [PubMed: 12243893].

Karakousis et al., 2006: Karakousis PC, Trucksis M, Dumler JS. Chronic Q fever in the United States. J Clin Microbiol. 2006; 44(6): 2283 - 2287. [PubMed: 16757641].

Kazar, 2005: Kazar J. Coxiella burnetii Infection. Ann N Y Acad Sci. 2005; 1063: 105 - 114. [PubMed: 16481501].

Komiya et al., 2003: Komiya T, Sadamasu K, Kang MI, Tsuboshima S, Fukushi H, Hirai K. Seroprevalence of Coxiella burnetii infections among cats in different living environments. J Vet Med Sci. 2003; 65(9): 1047 - 1048. [PubMed: 14532705].

Komiya et al., 2003: Komiya T, Sadamasu K, Toriniwa H, Kato K, Arashima Y, Fukushi H, Hirai K, Arakawa Y. Epidemiological survey on the route of Coxiella burnetii infection in an animal hospital. J Infect Chemother. 2003; 9(2): 151 - 155. [PubMed: 12825114].

La Scola et al., 1998: La Scola B, Lepidi H, Maurin M, Raoult D. A guinea pig model for Q fever endocarditis. J Infect Dis. 1998; 178(1): 278 - 281. [PubMed: 9652455].

Lautenschlager et al., 2000: Lautenschlager S, Willems H, Jager C, Baljer G. Sequencing and characterization of the cryptic plasmid QpRS from Coxiella burnetii. Plasmid. 2000; 44(1): 85 - 88. [PubMed: 10873529].

Lorenz et al., 1998: Lorenz H, Jager C, Willems H, Baljer G. PCR detection of Coxiella burnetii from different clinical specimens, especially bovine milk, on the basis of DNA preparation with a silica matrix. Appl Environ Microbiol. 1998; 64(11): 4234 - 4237. [PubMed: 9797270].

Luksi et al., 2006: Luksi B, Punda-Polic V, Ivic I, Bradaric I, Bradaric N. Clinical and epidemiological features of hospitalized acute Q fever cases from Split-Dalmatia County (Croatia), 1985-2002. Med Sci Monit. 2006; 12(3): CR126 - CR131. [PubMed: 16501424].

Macellaro et al., 1998: Macellaro A, Tujulin E, Hjalmarsson K, Norlander L. Identification of a 71-kilodalton surface-associated Hsp70 homologue in Coxiella burnetii. Infect Immun. 1998; 66(12): 5882 - 5888. [PubMed: 9826369].

Madariaga et al., 2003: Madariaga MG, Rezai K, Trenholme GM, Weinstein RA. Q fever: a biological weapon in your backyard. Lancet Infect Dis. 2003; 3(11): 709 - 721. [PubMed: 14592601].

Madic et al., 1993: Madic J, Huber D, Lugovic B. Serologic survey for selected viral and rickettsial agents of brown bears (Ursus arctos) in Croatia. J Wildl Dis. 1993; 29(4): 572 - 576. [PubMed: 8258856 ].

Marrie, 2004: Marrie TJ. Q fever pneumonia. Curr Opin Infect Dis. 2004; 17(2): 137 - 142. [PubMed: 15021054].

Marrie et al., 1993: Marrie TJ, Embil J, Yates L. Seroepidemiology of Coxiella burnetii among wildlife in Nova Scotia. Am J Trop Med Hyg. 1993; 49(5): 613 - 615. [PubMed: 8250101].

Maurin and Raoult, 1999: Maurin M, Raoult D. Q fever. Clin Microbiol Rev. 1999; 12(4): 518 - 553. [PubMed: 10515901].

McDiarmid et al., 2000: McDiarmid L, Petney T, Dixon B, Andrews R. Range expansion of the tick Amblyomma triguttatum triguttatum, an australian vector of Q fever. Int J Parasitol. 2000; 30(7): 791 - 793. [PubMed: 10899523].

McQuiston and Childs, 2002: McQuiston JH, Childs JE. Q fever in humans and animals in the United States. Vector Borne Zoonotic Dis. 2002; 2(3): 179 - 191. [PubMed: 12737547].

Miller et al., 2004: Miller JD, Curns AT, Thompson HA. A growth study of Coxiella burnetii Nine Mile Phase I and Phase II in fibroblasts. FEMS Immunol Med Microbiol. 2004; 42(3): 291 - 297. [PubMed: 15477042].

Padbidri et al., 1984: Padbirdri VS, Rodrigues JJ, Shetty PS, Joshi MV, Rao BL, Shukla RN. Tick-borne rickettsioses in Pune district, Maharashtra, India. Int J Zoonoses.. 1984; 11(1): 45 - 52. [PubMed: 6500861].

Parker et al., 2006: Parker NR, Barralet JH, Bell AM. Q fever. Lancet. 2006; 367(9511): 679 - 688. [PubMed: 16503466].

Porten et al., 2006: Porten K, Rissland J, Tigges A, Broll S, Hopp W, Lunemann M, van Treeck U, Kimmig P, Brockmann SO, Wagner-Wiening C, Hellenbrand W, Buchholz U. A super-spreading ewe infects hundreds with Q fever at a farmers market in Germany. BMC Infect Dis. 2006; 6(1): Epub ahead of print - . [PubMed: 17026751].

Psaroulaki et al., 2006: Psaroulaki A, Hadjichristodoulou C, Loukaides F, Soteriades E, Konstantinidis A, Papastergiou P, Ioannidou MC, Tselentis Y. Epidemiological study of Q fever in humans, ruminant animals, and ticks in Cyprus using a geographical information system. Eur J Clin Microbiol Infect Dis. 2006; Epub ahead of print(): - . [PubMed: 16915398].

Raoult et al., 1999: Raoult D, Houpikian P, Tissot Dupont H, Riss JM, Arditi-Djiane J, Brouqui P. Treatment of Q fever endocarditis: comparison of 2 regimens containing doxycycline and ofloxacin or hydroxychloroquine. Arch Intern Med. 1999; 159(2): 167 - 173. [PubMed: 9927100].

Raoult et al., 2005: Raoult D, Marrie T, Mege J. Natural history and pathophysiology of Q fever. Lancet Infect Dis. 2005; 5(4): 219 - 226. [PubMed: 15792739].

Reeves et al., 2006: Reeves WK, Szumlas DE, Moriarity JR, Loftis AD, Abbassy MM, Helmy IM, Dasch GA. Louse-borne bacterial pathogens in lice (Phthiraptera) of rodents and cattle from Egypt. J Parasitol. 2006; 92(2): 313 - 318. [PubMed: 16729688].

Rehacek et al., 1991: Rehacek J, Urvolgyi J, Kocianova E, Sekeyova Z, Vavrekova M, Kovacova E. Extensive examination of different tick species for infestation with Coxiella burnetii in Slovakia. Eur J Epidemiol. 1991; 7(3): 299 - 303. [PubMed: 1884784].

Rehn amd Radvan, 1959: Rehn F, Radvan R. Isolation of Coxiella burnetii from the common shrew (Sorex araneus) caught in a focus of Q-rickettsiosis in Northeastern Bohemia. Cesk Epidemiol Mikrobiol Imunol. 1959; 8(1): 49 - 51. [PubMed: 13639071].

Reimer, 1993: Reimer LG. Q fever. Clin Microbiol Rev. 1993; 6(3): 193 - 198. [PubMed: 8358703].

Riemann et al., 1979: Riemann HP, Behymer DE, Franti CE, Crabb C, Schwab RG. Survey of Q-fever agglutinins in birds and small rodents in Northern California, 1975-76. J Wildl Dis. 1979; 15(4): 515 - 523. [PubMed: 522220].

Samuel et al., 1985: Samuel JE, Frazier ME, Mallavia LP. Correlation of plasmid type and disease caused by Coxiella burnetii. Infect Immun. 1985; 49(3): 775 - 779. [PubMed: 4030104].

Samuel et al., 2003: Samuel JE, Kiss K, Varghees S. Molecular pathogenesis of Coxiella burnetii in a genomics era. Ann N Y Acad Sci. 2003; 990: 653 - 663. [PubMed: 12860703].

Schelling et al., 2003: Schelling E, Diguimbaye C, Daoud S, Nicolet J, Boerlin P, Tanner M, Zinsstag J. Brucellosis and Q-fever seroprevalences of nomadic pastoralists and their livestock in Chad. Prev Vet Med. 2003; 61(4): 279 - 293. [PubMed: 14623412].

Schroder, 1998: Schroder HD The problem of Q fever in zoo ungulates. Berl Munch Tierarztl Wochenschr. 1998; 111(5): 173 - 174. [PubMed: 9639953].

Scola, 2002: Scola BL. Current laboratory diagnosis of Q fever. Semin Pediatr Infect Dis. 2002; 13(4): 257 - 262. [PubMed: 12491231].

Serbezovet al., 1999: Serbezov VS, Kazar J, Novkirishki V, Gatcheva N, Kovacova E, Voynova V. Q fever in Bulgaria and Slovakia. Emerg Infect Dis. 1999; 5(3): 388 - 394. [PubMed: 10341175].

Seshadri and Samuel, 2005: Seshadri R, Samuel J. Genome Analysis of Coxiella burnetii Species: Insights into Pathogenesis and Evolution and Implications for Biodefense. Ann N Y Acad Sci. 2005; 1063: 442 - 450. [PubMed: 16481558].

Seshadri et al., 2003: Seshadri R, Paulsen IT, Eisen JA, Read TD, Nelson KE, Nelson WC, Ward NL, Tettelin H, Davidsen TM, Beanan MJ, Deboy RT, Daugherty SC, Brinkac LM, Madupu R, Dodson RJ, Khouri HM, Lee KH, Carty HA, Scanlan D, Heinzen RA, Thompson HA, Samuel JE, Fraser CM, Heidelberg JF. Complete genome sequence of the Q-fever pathogen Coxiella burnetii. Proc Natl Acad Sci U S A. 2003; 100(9): 5455 - 5460. [PubMed: 12704232].

Spitalska and Kocianova, 2003: Spitalska E, Kocianova E. Detection of Coxiella burnetii in ticks collected in Slovakia and Hungary. Eur J Epidemiol. 2003; 18(3): 263 - 266. [PubMed: 12800953].

Spyridaki et al., 1998: Spyridaki I, Gikas A, Kofteridis D, Psaroulaki A, Tselentis Y. Q fever in the Greek island of Crete: detection, isolation, and molecular identification of eight strains of Coxiella burnetii from clinical samples. J Clin Microbiol. 1998; 36(7): 2063 - 2067. [PubMed: 9650963].

Stein and Raoult, 1999: Stein A, Raoult D. Pigeon pneumonia in provence: a bird-borne Q fever outbreak. Clin Infect Dis. 1999; 29(3): 617 - 620. [PubMed: 10530457].

Stein et al., 2005: Stein A, Louveau C, Lepidi H, Ricci F, Baylac P, Davoust B, Raoult D. Q fever pneumonia: virulence of Coxiella burnetii pathovars in a murine model of aerosol infection. Infect Immun. 2005; 73(4): 2469 - 2477. [PubMed: 15784593].

Syrucek et al., 1957: Syrucek L, Sobeslavsky O, Havlik O. Isolation of Coxiella burnetii in shrew mouse Sorex minutus in the focus of Q fever in northwestern Czechoslovakia. Cesk Epidemiol Mikrobiol Imunol. 1957; 6(6): 392 - 395. [PubMed: 13511442 ].

Szarek et al., 1994: Szarek J, Rotkiewicz T, Anusz Z, Khan MZ, Chishti MA. Pathomorphological studies in European bison (Bison bonasus Linnaeus, 1758) with seropositive reaction to Coxiella burnetii. Zentralbl Veterinarmed B. 1994; 41(9): 618 - 624. [PubMed: 7740862].

To et al., 1998: To H, Sakai R, Shirota K, Kano C, Abe S, Sugimoto T, Takehara K, Morita C, Takashima I, Maruyama T, Yamaguchi T, Fukushi H, Hirai K. Coxiellosis in domestic and wild birds from Japan. J Wildl Dis. 1998; 34(2): 310 - 316. [PubMed: 9577778].

Valkova and Kazar, 1995: Valkova D, Kazar J. A new plasmid (QpDV) common to Coxiella burnetii isolates associated with acute and chronic Q fever. FEMS Microbiol Lett. 1995; 125(2-3): 275 - 280. [PubMed: 7875575].

Waag et al., 1999: Waag DM, Byrne WR, Estep J, Gibbs P, Pitt ML, Banfield CM. Evaluation of cynomolgus (Macaca fascicularis) and rhesus (Macaca mulatta) monkeys as experimental models of acute Q fever after aerosol exposure to phase-I Coxiella burnetii. Lab Anim Sci. 1999; 49(6): 634 - 638. [PubMed: 10638499].

Woldehiwet, 2004: Woldehiwet Z. Q fever (coxiellosis): epidemiology and pathogenesis. Res Vet Sci. 2004; 77(2): 93 - 100. [PubMed: 15196898].

Yadav and Sethi, 1979: Yadav MP, Sethi MS. Poikilotherms as reservoirs of Q-fever (Coxiella burnetii) in Uttar Pradesh. J Wildl Dis. 1979; 15(1): 15 - 17. [PubMed: 459042].

Zarnke et al., 1983: Zarnke RL. Serologic survey for selected microbial pathogens in Alaskan wildlife. J Wildl Dis. 1983; 19(4): 324 - 329. [PubMed: 6139490].

Zhang et al., 1998 (a): Zhang GQ, Hotta A, Mizutani M, Ho T, Yamaguchi T, Fukushi H, Hirai K. Direct identification of Coxiella burnetii plasmids in human sera by nested PCR. J Clin Microbiol. 1998; 36(8): 2210 - 2213. [PubMed: 9665993].

Zhang et al., 1998 (b): Zhang GQ, Nguyen SV, To H, Ogawa M, Hotta A, Yamaguchi T, Kim HJ, Fukushi H, Hirai K. Clinical evaluation of a new PCR assay for detection of Coxiella burnetii in human serum samples. J Clin Microbiol. 1998; 36(1): 77 - 80. [PubMed: 9431924].

B. Book References:

AHFS, 2006: Dewey DR, Bollinger LA, Melton GS, Morawiec K. In: McEvoy GK, Snow EK, Kester L, Litvak K, Miller J, Welsh OH. AHFS Drug Information.2006. American Society of Health-System Pharmacists Inc., Bethesda, MD.

Ormsbee, 1965: Ormsbee RA. Q fever rickettsia. 1144 - 1160. In: Horsfall FL, Tamm I. Viral and Rickettsial Infections of Man1965. J. B. Lippincott Company, Philadelphia, PA.

Waag et al., 1991: Waag DM, Williams JC, Peacock MG, Raoult D. Methods of isolation, amplification, and purification of Coxiella burnetii. 73 - 116. In: Williams JC, Thompson HA. Q Fever, Volume II: The Biology of Coxiella burnetii.1991. CRC-Press, Boca Raton, Florida.

C. Website References:

CDC Emergency contact: CDC. Emergency contact [ http://www.bt.cdc.gov/contactus.asp ].

CDC. Q Fever: CDC. Q Fever [ http://www.cdc.gov/ncidod/dvrd/qfever/ ].

CDC. Biosafety: CDC. Biosafety [ http://www.cdc.gov/od/ohs/biosfty/bmbl4/bmbl4s7a.htm ].

NCBI Taxonomy: NCBI Taxonomy. Coxiella burnetii [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=777&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: NCBI taxonomy. Coxiella burnetii RSA 493 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=227377 ].

NCBI Taxonomy: NCBI taxonomy. Coxiella burnetii RSA 331 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=360115 ].

NCBI Taxonomy: NCBI taxonomy. Coxiella burnetii Dugway 7E9-12 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=382253 ].

NCBI Genome Sequence: Coxiella burnetii RSA 493, complete genome [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genome&cmd=Retrieve&dopt=Overview&list_uids=293 ].

NCBI Genome Sequence: Coxiella burnetii RSA 493 plasmid pQpH1, complete sequence [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genome&cmd=Retrieve&dopt=Overview&list_uids=17002 ].

NCBI Genome Sequence: Coxiella burnetii plasmid QpDV, complete sequence [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genome&cmd=Retrieve&dopt=Overview&list_uids=15234 ].

NCBI Taxonomy: NCBI taxonomy. Homo sapiens [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9606 ].

NCBI Taxonomy: NCBI taxonomy. Vertebrata [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=7742 ].

NCBI Taxonomy: NCBI taxonomy. Arthropoda [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=6656 ].

NCBI Coxiella burnetii RSA 331 Sequencing Project: Coxiella burnetii RSA 331 project at TIGR [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=5485 ].

NCBI Coxiella burnetii Dugway 7E9-12 Sequencing Project: Coxiella burnetii Dugway 7E9-12 project at TIGR [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=5479 ].

NCBI Taxonomy: Ursus arctos [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9644 ].

NCBI Taxonomy: Ursus americanus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9643 ].

NCBI Taxonomy: Isoodon [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=37888 ].

NCBI Taxonomy: Meriones shawi [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=37435 ].

NCBI Taxonomy: Peromyscus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=10040 ].

NCBI Taxonomy: Rattus norvegicus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=10116 ].

NCBI Taxonomy: Neotome fuscipes [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=105199 ].

NCBI Taxonomy: Ondatra zibethicus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=10060 ].

NCBI Taxonomy: Spermophilus beecheyi [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=34862 ].

NCBI Taxonomy: Tamias [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=13712 ].

NCBI Taxonomy: Philander opossum [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9272 ].

NCBI Taxonomy: Didelphis marsupialis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9268 ].

NCBI Taxonomy: Proechimys [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=10162 ].

NCBI Taxonomy: Oryctolagus cuniculus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9986 ].

NCBI Taxonomy: Apodemus sylvaticus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=10129 ].

NCBI Taxonomy: Rattus tunneyi culmorum [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=95534 ].

NCBI Taxonomy: Hydromys chrysogaster [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=160448 ].

NCBI Taxonomy: Erethizon [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=34843 ].

NCBI Taxonomy: Bos taurus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9913 ].

NCBI Taxonomy: Ovis aries [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9940 ].

NCBI Taxonomy: Capra hircus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9925 ].

NCBI Taxonomy: Canis familiaris [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9615 ].

NCBI Taxonomy: Felis catus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9685 ].

NCBI Taxonomy: Sus scrofa [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9823 ].

NCBI Taxonomy: Camelus dromedarius [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9838 ].

NCBI Taxonomy: Bison bonasus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9902 ].

NCBI Taxonomy: Passer montanus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9160 ].

NCBI Taxonomy: Progne chalybea [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=72875 ].

NCBI Taxonomy: Coturnix coturnix [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9091 ].

NCBI Taxonomy: Anas platyrhynchos [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=8839 ].

NCBI Taxonomy: Cairina moschata [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id= 8855 ].

NCBI Taxonomy: Corvus macrorhynchos [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=36249 ].

NCBI Taxonomy: Columba livia [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=8932 ].

NCBI Taxonomy: Columba fasciata [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=177142 ].

NCBI Taxonomy: Phasianus colchicus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9054 ].

NCBI Taxonomy: Fulica americana [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=81903 ].

NCBI Taxonomy: Corvus brachyrhynchos [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=85066 ].

NCBI Taxonomy: Euphagus cyanocephalus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=84817 ].

NCBI Taxonomy: Zonotrichia atricapilla [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=44392 ].

NCBI Taxonomy: Zonotrichia leucophrys [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=44393 ].

NCBI Taxonomy: Passer domesticus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=48849 ].

NCBI Taxonomy: Turdus migratorius [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9188 ].

NCBI Taxonomy: Sturnus vulgaris [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9172 ].

NCBI Taxonomy: Amblyomma americanum [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=6943 ].

NCBI Taxonomy: Amblyomma variegatum [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=34610 ].

NCBI Taxonomy: Argas persicus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=34603 ].

NCBI Taxonomy: Argas reflexus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=34604 ].

NCBI Taxonomy: Boophilus decoloratus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=60189 ].

NCBI Taxonomy: Dermacentor andersoni [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=34620 ].

NCBI Taxonomy: Dermacentor marginatus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=49202 ].

NCBI Taxonomy: Dermacentor occidentalis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=60254 ].

NCBI Taxonomy: Dermacentor parumapertus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=60255 ].

NCBI Taxonomy: Haemaphysalis humerosa [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=65643 ].

NCBI Taxonomy: Haemaphysalis leachi [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=44385 ].

NCBI Taxonomy: Haemaphysalis leporispalustris [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=34624 ].

NCBI Taxonomy: Haemaphysalis punctata [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=49204 ].

NCBI Taxonomy: Hyalomma anatolicum [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=176092 ].

NCBI Taxonomy: Hyalomma dromedarii [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=34626 ].

NCBI Taxonomy: Ixodes holocyclus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=65647 ].

NCBI Taxonomy: Ixodes ricinus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=34613 ].

NCBI Taxonomy: Otobius megnini [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=34606 ].

NCBI Taxonomy: Ornithodoros moubata [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=6938 ].

NCBI Taxonomy: Rhipicephalus bursa [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=67831 ].

NCBI Taxonomy: Rhipicephalus sanguineus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=34632 ].

NCBI Taxonomy: Rhipicephalus simus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=72861 ].

NCBI Taxonomy: Amblyomma triguttatum triguttatum [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=65638 ].

NCBI Taxonomy: Hyalomma hussaini [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=139400 ].

NCBI Taxonomy: Dermacentor reticulatus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=57047 ].

NCBI Taxonomy: Haemaphysalis inermis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=48827 ].

NCBI Taxonomy: Lepus americanus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=48086 ].

NCBI Taxonomy: Sorex araneus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=42254 ].

NCBI Taxonomy: Sorex minutus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=62280 ].

NCBI Taxonomy: Ovis dalli [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9943 ].

NCBI Taxonomy: Lepus californicus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=48087 ].

NCBI Taxonomy: Lemniscomys barbarus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=54111 ].

NIAID Biodefense Image Library: NIAID Biodefense Image Library [ http://www3.niaid.nih.gov/biodefense/Public/Images.htm ].

NCBI Taxonomy: Bos taurus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9913 ].

NCBI Taxonomy: Procyon lotor [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9654 ].

NCBI Taxonomy: Odocoileus virginianus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9874 ].

NCBI Taxonomy: Gallus gallus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9031 ].

NCBI Taxonomy: Natrix natrix [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=100823 ].

NCBI Taxonomy: Ptyas korros [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=74367 ].

NCBI Taxonomy: Python molurus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=51750 ].

NCBI Taxonomy: Kachuga [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=232865 ].

NCBI Taxonomy: Corvus corone [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=30422 ].

NCBI Taxonomy: Eliomys quercinus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=53277 ].

NCBI Taxonomy: Phoenicurus phoenicurus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=121423 ].

NCBI Taxonomy: Rhombomys opimus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=186474 ].

NCBI Taxonomy: Spermophilopsis leptodactylus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=54111 ].

NCBI Taxonomy: Mus musculus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=10090 ].

NCBI Taxonomy: Clethrionomys glareolus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=51090 ].

NCBI Taxonomy: Mustela nivalis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=36239 ].

NCBI Taxonomy: Spermophilus citellus relictus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=100387 ].

NCBI Taxonomy: Peromyscus maniculatus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=10042 ].

NCBI Taxonomy: Dipodomys ordii [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=10020 ].

NCBI Taxonomy: Dipodomys microps [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=94248 ].

NCBI Taxonomy: Cricetulus migratorius [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=10032 ].

NCBI Taxonomy: Allactaga elater [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=73861 ].

NCBI Taxonomy: Hemiechinus auritus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=217708 ].

NCBI Taxonomy: Neotoma cinerea [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=105147 ].

NCBI Taxonomy: Spermophilus lateralis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=76772 ].

NCBI Taxonomy: Tamias amoenus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=64679 ].

NCBI Taxonomy: Elephas maximus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9783 ].

NCBI Taxonomy: Diceros bicornis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9805 ].

NCBI Taxonomy: Tapirus terrestris [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9801 ].

NCBI Taxonomy: Equus hemionus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9794 ].

NCBI Taxonomy: Equus hemionus kulan [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=73334 ].

NCBI Taxonomy: Equus zebra hartmannae [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=73335 ].

NCBI Taxonomy: Equus burchellii antiquorum [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=200155 ].

NCBI Taxonomy: Equus przewalskii [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9798 ].

NCBI Taxonomy: Camelus bactrianus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9837 ].

NCBI Taxonomy: Lama glama [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9844 ].

NCBI Taxonomy: Lama pacos [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=30538 ].

NCBI Taxonomy: Bubalus bubalis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=89462 ].

NCBI Taxonomy: Syncerus caffer [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9970 ].

NCBI Taxonomy: Bos primigenius [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9909 ].

NCBI Taxonomy: Boselaphus tragocamelus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9917 ].

NCBI Taxonomy: Kobus ellipsiprymnus ellipsiprymnus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=91878 ].

NCBI Taxonomy: Gazella subgutturosa [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=59529 ].

NCBI Taxonomy: Saiga tatarica [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=34875 ].

NCBI Taxonomy: Ovibos moschatus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=37176 ].

NCBI Taxonomy: Ovis aries musimon [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9938 ].

NCBI Taxonomy: Cervus elaphus bactrianus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=164931 ].

NCBI Taxonomy: Cervus nippon pseudaxis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=92868 ].

NCBI Taxonomy: Cervus elaphus canadensis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9861 ].

NCBI Taxonomy: Cervus elaphus hippelaphus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=46360 ].

NCBI Taxonomy: Dama dama [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=30532 ].

NCBI Taxonomy: Alces alces americana [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9854 ].

NCBI Taxonomy: Ursus thibetanus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9642 ].

NCBI Taxonomy: Cervus nippon yesoensis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=223998 ].

NCBI Taxonomy: Lepus brachyurus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=156448 ].

NCBI Taxonomy: Cervus nippon centralis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=151525 ].

NCBI Taxonomy: Macaca fuscata [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9542 ].

NCBI Taxonomy: Myocastor coypus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=10157 ].

NCBI Taxonomy: Ovis canadensis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=37174 ].

NCBI Taxonomy: Athene brama [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=126786 ].

NCBI Taxonomy: Psittacula krameri [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9228 ].

NCBI Taxonomy: Rattus rattus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=10117 ].

NCBI Taxonomy: Suncus murinus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9378 ].

NCBI Taxonomy: Acridotheres tristis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=279927 ].

NCBI Taxonomy: Ornithodoros coriaceus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=92741 ].

NCBI Taxonomy: Capreolus capreolus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=9858 ].

Website 1: Centers for Disease Control: Public Health Image Library (PHIL) [ http://phil.cdc.gov/Phil/details.asp ].

D. Thesis References:

No thesis or dissertation references used.

VI. Curation Information

• Curators: Randy Vines; Krista Morris
• Date: 10/16/03
• Version: 1.5
• Revision:
  • Curators: George Abramochkin (pathinfo@vbi.vt.edu); Rebecca Wattam (pathinfo@vbi.vt.edu);
  • Date: 14 July 2006
  • Version: 0.83
• Contact information:
  • Email: pathinfo@vbi.vt.edu