I. Organism Information

A. Taxonomy Information

1. Species:
   1. Crimean-Congo hemorrhagic fever virus :
      1. Ontology: UMLS:C0009743
      2. GenBank Taxonomy No.: 11593
      3. Description: CCHFV is a member of the Nairovirus genus of the family Bunyaviridae. Other genera within the family include Orthobunyavirus, Hantavirus, Phlebovirus, and Tospovirus. According to the most recent report from the International Committee on the Taxonomy of Viruses, there are seven recognized species in the genus Nairovirus containing 34 viral strains. The most important serogroups are the CCHF group, which includes CCHFV, and Hazara virus, which has not been demonstrated to be pathogenic to humans, and the Nairobi sheep disease group, which includes Nairobi sheep disease (NSD) and Dugbe viruses. Only three members are known to be pathogens of humans, namely, CCHFV, Dugbe and Nairobi sheep disease viruses, although the latter is primarily a pathogen of sheep and goats (Whitehouse, 2004). CCHF was first recognized in the Crimean peninsula in the mid-1940s, when a large outbreak of severe hemorrhagic fever among agricultural workers was identified. However, the virus was first isolated from a patient with a 1-day fever in Kisangani, Democratic Republic of Congo, in 1956 (Nichol, 2001). CCHF is a public health problem in many regions of the world, including Africa, Middle East, southern and eastern Europe, and Western Asia (Papa et al., 2002A). Crimean-Congo hemorrhagic fever (CCHF) virus causes a hemorrhagic and toxic syndrome disease in humans and high mortality rates of up to 50% (Yashina et al., 2003). Tree topology supports previous evidence for the existence of three groups of genetically related isolates, A, B and C. Within group A there are two clades: an African clade and a predominantly Asian clade comprising isolates from Pakistan, China, Iran, Russia and Madagascar. Group B includes isolates from southern and West Africa and Iran, and group C includes a single isolate from Greece. Despite the potential which exists for dispersal of the virus between Africa and Eurasia, it appears that circulation of the virus is largely compartmentalized within the two land masses, and the inference is that the geographic distribution of phylogenetic groups is related to the distribution and dispersal of tick vectors of the virus (Burt and Swanepoel, 2005).
      4. Variant(s):
         • Crimean-Congo hemorrhagic fever virus (isolate C68031) :
           • GenBank Taxonomy No.: 11594
           • Parent: Crimean-Congo hemorrhagic fever virus
           • Description: Crimean-Congo hemorrhagic fever virus (isolate C68031) was isolated in China from an infected sheep (Papa et al., 2002B).
         • Crimean-Congo hemorrhagic fever virus strain BA88166 :
           • GenBank Taxonomy No.: 154120
           • Description: Crimean-Congo hemorrhagic fever virus Chinese isolate strain BA88166 was isolated in 1988 in Bachu, China from an infected patient (Morikawa et al., 2002).
         • Crimean-Congo Hemorrhagic Fever virus strain China :
           • GenBank Taxonomy No.: 170517
           • Description: In China, the first CCHF cases were observed in 1965, when CCHFV strain BA66019 was isolated from a patient who lived in Xinjiang Province, an autonomous region in northwestern China which is the most CCHF-endemic area in the country. Another strain, BA8402, was isolated in 1984 from Hyalomma asiaticum ticks from the same region (Papa et al., 2002A).
         • Hazara virus (isolate JC280) :
           • GenBank Taxonomy No.: 11597
           • Description: The Nairoviruses are organized into related antigenic serogroups: Crimean-Congo Hemorrhagic Fever Virus group (CCHF)-CCHF, Hazara, Khasan (Watts et al., 1988). Hazara (HAZ) virus was isolated from 1 of 2 pools of Ixodes (I) redikorzevi from a High Mountain Vole, Alticola roylei, trapped in alpine ("subartic") terrain at Gitidas, 3330 m altitude, Kaghan Valley, Hazara District, Pakistan. Notably, the HAZ isolate was from a rodent-infecting tick in an alpine zone (Hoogstraal, 1979).
         • Crimean-Congo hemorrhagic fever virus strain ROS/HUVLV-100 :
           • GenBank Taxonomy No.: 11593
           • Description: Laboratory-adapted Crimean Congo hemorrhagic fever virus (CCHFV) strain ROS/HUVLV-100, isolated in 2003 from the blood of a deceased female from the Rostov region of southern European Russia (Meissner et al., 2006A).
         • Crimean-Congo hemorrhagic fever virus strain Baghdad-12 :
           • GenBank Taxonomy No.: 11593
           • Description: A middle-Eastern Crimean Congo hemorrhagic fever virus (CCHFV) strain isolated in Iraq (Baghdad-12) (Chamberlain et al., 2005).
         • Crimean-Congo hemorrhagic fever virus strain Semunya :
           • GenBank Taxonomy No.: 11593
           • Description: An African Crimean Congo hemorrhagic fever virus (CCHFV) strain isolated in Uganda (Semunya) (Chamberlain et al., 2005).
         • Crimean-Congo hemorrhagic fever virus strain (SPU/81) :
           • GenBank Taxonomy No.: 11593
           • Description: A strain isolated from one of the earliest reported outbreaks of CCHF in South Africa (Chamberlain et al., 2005).

B. Lifecycle Information :

1. Virion :
   1. Size: Virions are spherical, approximately 100 nm in diameter, and have a host cell-derived lipid bilayered envelope approximately 5-7 nm thick, through which protrude glycoprotein spikes 8-10 nm in length (Whitehouse, 2004).
   2. Shape: When viewed by negative stain electron microscopy, CCHF virions appear to be distinct from other viruses within the Bunyaviridae family, as they possess very small morphologic surface units with no central holes arranged in no obvious order (Whitehouse, 2004).
   3. Picture(s):
      1. Schematic cross-section of a Bunyaviridae virion
         
         
         
         Description: Schematic cross-section of a Bunyaviridae virion. The three RNA genome segments (S, M, and L) are complexed with nucleocapsid protein to form ribonucleocapsid structures. The nucleocapsids and RNA-dependent RNA polymerase are packaged within a lipid envelope that contains the viral glycoproteins, G1 and G2 (also referred to as Gn and Gc, respectively) (Whitehouse, 2004).
         
   4. Description: The viral glycoproteins are responsible for the recognition of receptor sites on susceptible cells. Following attachment, viruses are internalised by endocytosis. Replication occurs in the cytoplasm, and the virions mature by budding through the endoplasmic reticulum into cytoplasmic vesicles in the Golgi region. Bunyaviruses are known to bud from Golgi membranes and the budding site seems to be defined by retention of the glycoproteins GN and GC at that particular site. GN is localised to the Golgi compartment, whereas GC is found in the endoplasmic reticulum. Recently, the expression strategy and biosynthesis of the CCHF viral glycoproteins have been studied in more detail, including the identification of precursor cleavage sites and the determination of the exact amino termini of the two major cleavage products, GN and GC. The subtilase SKI-1 has been identified as the cellular protease responsible for the processing step that generates the amino terminus of mature GN. Recent studies of the L RNA genome segment and predicted encoded L polymerase protein of CCHF virus demonstrate that they are approximately twice the size of those found in viruses of other bunyavirus genera. Regions containing ovarian tumour-like cysteine protease and helicase domains were identified in the L segments of CCHF and Dugbe viruses, suggesting an autoproteolytic cleavage process for nairovirus L proteins (Ergonul, 2006). The natural cycle of CCHFV includes transovarial (i.e., passed though the eggs) transstadial (i.e., passed directly from immature ticks to subsequent life stages) transmission among ticks in a tick-vertebrate-tick cycle involving a variety of wild and domestic animals. Hyalomma ticks normally feed on a variety of livestock (sheep, goats, and cattle), and wild herbivores, hares, and hedgehogs, which can become infected with CCHFV. Infection in these animals generally results in inapparent or subclinical disease but generates viremia levels capable of supporting virus transmission to uninfected ticks. The role of birds in the ecology and epidemiology remains unclear. For example, birds experimentally infected with CCHFV remained healthy, with no evidence of viremia or antibody response. This also seems to mimic the natural situation because work by the same group showed that even though CCHFV could be isolated from nymphal ticks collected from over 600 birds, the birds remained ser-negative and no virus could be isolated from their blood or organs. Thus, it appears that birds are refractory to CCHF infection, even though they can support large numbers of CCHF-infected ticks. One interesting exception is ostriches, which become infected with CCHFV and have been the source of several cases of CCHF associated with the slaughtering ostriches in South Africa. Transmission to humans can occur either through tick bites or possibly by crushing engorged infected ticks. Direct contact with virus-contaminated blood or tissues from infected animals or humans is another source of virus transmission and is generally characterized by more severe clinical symptoms and high mortality (Flick et al., 2005).
2. Replication cycle of viruses in the family Bunyaviridae
   
   
   
   Description: Replication cycle of viruses in the family Bunyaviridae. Steps in the replication cycle are numbered as follows: (1) attachment of virions to cell-surface receptors; (2) entry via endocytosis followed by membrane fusion, allowing viral ribonucleocapsids and RNA-dependent RNA polymerase access to the cytoplasm; (3) primary transcription; (4) translation of viral proteins; (5) replication of vRNA via a cRNA intermediate; (6) assembly of virions at the Golgi or plasma membrane; (7) egress by budding into the Golgi followed by exocytosis, or budding through the plasma membrane (Whitehouse, 2004).
   

C. Genome Summary:

1. Genome of Crimean-Congo hemorrhagic fever virus
1. Description: CCHF virus possesses a negative-sense RNA genome consisting of three RNA segments: the large (L), medium (M), and small (S) segments. The S segment encodes a nucleoprotein (NP), the M segment encodes a glycoprotein precursor, which is cleaved into mature glycoproteins, G1 and G2, and the L segment encodes RNA polymerase. In the case of the Hazara virus, another member of the CCHF serogroup of Nairoviruses, a third structural glycoprotein of approximately 45 kDa was identified apart from G1 and G2, but its coding strategy has not yet been analyzed (Morikawa et al., 2002). The first 8 to 13 nucleotide bases at the 3' ends of all three RNA segments have a sequence that is conserved in the viruses of this genus, with a complementary consensus sequence occurring at the 5' end; the ends of the segments are noncovalently linked so that the RNA occurs in a loosely bound circular configuration within the nucleocapsids. The M segment of nairoviruses is 30% to 50% larger than the M segments of members of other genera in the Bunyaviridae family (Papa et al., 2002A).
2. S segment:
   1. GenBank Accession Number: NC_005302
   2. Size: 1672 bp (Marriott and Nuttall, 1992)
   3. Gene Count: 1 (Papa et al., 2002A)
   4. Description: The S RNA segment codes for the nucleocapsid (N) protein (Papa et al., 2002A). The S RNA segments of the nairoviruses Crimean-Congo hemorrhagic fever (CCHF) virus (Chinese isolate) and Hazara (HAZ) virus were cloned and sequenced from PCR products. The RNAs comprise 1672 and 1677 nucleotides, respectively, and each encodes a protein in the viral complementary strand (54.0 and 54.2 kDa, respectively) (Marriott and Nuttall, 1992). S-segment nucleotide sequences for two Crimean-Congo hemorrhagic fever (CCHF) virus strains isolated in the Rostov Region of Russia and in Bulgaria have been determined. Analysis of complete S-segment nucleotide sequences in the viral strains from different regions of the world has established that the CCHF virus strains isolated from ticks and human beings in different southern Russian regions in 1967 and 2000 are very closely genetically and they form an individual subgroup in the basic European genetic group. By the S-segment structure, the CCHF virus strain isolated in Bulgaria in 1978 belongs to the same genetic group as a representative of its second subgroup. Analysis of the S-segment 3'-noncoding region suggests that the CCHF virus circulating in Europe, Central Asia, and China may have originated from one global focus of infection, including several CCHF virus genovariants. During evolution, fragmental exchange apparently occurred in the S-segment 3'-noncoding region as a result of homological recombination (Seregin et al., 2006).
3. L segment:
   1. GenBank Accession Number: NC_005301
   2. Size: 12,108 bp (NCBI Genome) 12112 bp (Meissner et al., 2006B)
   3. Gene Count: 1
   4. Description: The large (L) RNA segment of Crimean Congo hemorrhagic fever (CCHF) virus strain AST/TI30908, isolated from pooled Hyalomma marginatum ticks collected in 2002 from the Astrakhan region of European Russia, was amplified piecemeal using reverse-transcription/polymerase chain reaction, followed by direct sequencing of gel-purified amplicons. After removal of 5' and 3' primer-generated termini, the assembled AST/TI30908 L segment sequence is 12112 nucleotides long, with 41.3% G + C content, and is greater than 87% and 96% identical at the nucleotide and translated amino acid levels, respectively, to partial or full-length CCHF virus L segment sequences deposited in GenBank. A complete L segment coding-region sequence for CCHF virus strain TAJ/HU8966, isolated from a patient in Tajikistan in 1990, was determined in a similar fashion. This L segment (12133 nucleotides long, 41.1% G + C content) shares 88% nucleotide identity with the full-length strain Matin from Pakistan, and 97% nucleotide identity with a partial L segment sequence of strain Khodzha from Uzbekistan. Strain TAJ/HU8966 shares at least 96% identity at the translated amino acid level with all other CCHF virus L segment sequences. Although, for the most part, CCHF virus L polyprotein primary sequences are uniformly well conserved, a region of marked variability was identified in the N-terminal half of the RNA-dependent RNA polymerase. This region, approximately 50 amino acids in length, is flanked by previously-reported arenavirus and bunyavirus-conserved regions, and may prove useful in CCHF diagnosis and viral taxonomy (Meissner et al., 2006B).
4. M segment:
   1. GenBank Accession Number: NC_005300
   2. Size: 5,366 bp (NCBI Genome) 5,368 and 5,376 bp (Papa et al., 2002A)
   3. Gene Count: 2 genes (Papa et al., 2002A)
   4. Description: The M RNA segment codes for the glycoprotein precursor, resulting in the two envelope glycoproteins G1 and G2. Two CCHFV strains isolated in Xinjiang Province, a region endemic for CCHF in northwestern China, were studied. These strains, designated BA66019 and BA8402, were isolated in 1965 and 1984 from a CCHF patient and Hyalomma ticks, respectively. Viral RNA was extracted from suckling mouse brains infected with these two strains, amplified, and sequenced. The full-length M RNA, consisting of 5.3 kb, was determined for both strains. The coding nucleotide sequences of the two strains differed from each other by 17.5% and from the reference CCHFV strain IbAr10200 by a mean of 22%, suggesting that the genus Nairovirus comprises a group of genetically highly diverse strains (Papa et al., 2002A). The complete nucleotide sequences of the medium (M) segment of seven Chinese isolates of Crimean-Congo hemorrhagic fever (CCHF) virus were determined. The M-segment RNA of CCHF virus comprises 5356-5377 nucleotides depending on the isolate and encodes a protein comprising 1689-1697 amino acids in a viral complementary sense. Phylogenetic analysis of the M segment showed that the Chinese CCHF virus isolates were clustered into three groups, one of which was more closely related to a Nigerian isolate. Pairwise comparison of a precursor protein showed that amino-terminal regions comprising 250 amino acids were extraordinary heterogeneous, with a 22.4% identity in amino acids being observed between the most distantly related isolates. Since all the viruses were isolated from 1966 to 1988 within a restricted area in the Xinjiang Autonomous Region in western China, the results indicate that a multisource virus population is endemic in this region (Morikawa et al., 2002).

II. Epidemiology Information

The geographic range of CCHF virus is the most extensive among the tickborne viruses that affect human health, and the second most widespread of all medically important arboviruses, after dengue viruses (Ergonul, 2006). The disease was first discovered in the Crimean region of Russia in the 1940s and is now reported in many regions of the world: Africa, the Middle East, Europe and Asia. In the territory of the former Soviet Union, disease outbreaks or the presence of the virus were reported in the southern regions of European Russia, in Mouldova, Ukraine and Transcaucasus, and in Central Asian countries, in Tajikistan, Turkmenistan, Uzbekistan, Kyrgyzstan and Kazakhstan (Yashina et al., 2003). Published descriptions of major epidemics and outbreaks of CCHF have been reviewed extensively in the past. These reports illustrate the very wide distribution of CCHF virus. This distribution stretches over much of Asia, extending from the XinJiang region of China to the Middle East and southern Russia, and to focal endemic areas over much of Africa and parts of south-eastern Europe. Thus, CCHF virus is the most widely distributed agent of severe haemorrhagic fever known (Chamberlain et al., 2005). Before 1970, most cases were reported from the former Soviet Union (Crimea, Astrakhan, Rostov, Uzbekistan, Kazakhstan, Tajikistan) and Bulgaria, as well as virus circulation in parts of Africa such as the Democratic Republic of the Congo and Uganda. The initial recognition of haemorrhagic cases in Africa occurred in the 1960s, resulting in a series of in-depth studies in South Africa and reports of additional outbreaks from Congo, Mauritania, Burkina Faso, Tanzania, and Senegal. A substantial number of cases were also reported from middle eastern countries such as Iraq, the United Arab Emirates (UAE), Saudi Arabia and Oman, and from Pakistan and China. By 2000, new outbreaks had been reported from Pakistan, Iran, Senegal, Albania, Yugoslavia, Bulgaria, Turkey, Kenya, and Mauritania. Serological evidence for CCHF virus has been reported from Greece, India, Egypt, Portugal, Hungary, France, and Benin, although the virus was isolated only in Greece and the only reported human case was a Greek laboratory infection. CCHF virus is endemic in the Balkans, including Bulgaria, the former Yugoslavia, and Albania. It is of interest that the strain that caused the laboratory-related infection in Greece was exceedingly mild, possibly reflecting chance variation; however, the virus has the greatest phylogenetic difference from other CCHF viruses and Greece is separated from Bulgaria by mountains approximately 1500-2500 m high (Ergonul, 2006). The common vector for CCHF virus are ticks of the genus Hyalomma. The virus is transmitted to humans either directly by Hyalomma ticks or by contact with infected domestic animals. CCHF virus is primarily a zoonosis, which means that the transmission cycle mainly involves ticks and wild or domestic animals. Cattle, sheep and goats do not become ill after infection but are viremic for about 1 week. During this period of time the virus may be transmitted to humans which have close contact to these animals such as agricultural workers, slaughterhouse workers, and veterinarians. Furthermore, the virus may be spread into other geographical regions via infected livestock. The virus may also be transmitted from human to human which occurs primarily in the hospital setting. Health care workers are mainly at risk (Drosten et al., 2003).

A. Outbreak Locations:

1. South Africa: Outbreaks have recently been reported in South Africa when heavily tick-infested ostriches were slaughtered (Ergonul, 2006). In 1984, a case of CCHF occurred in a worker who became ill after slaughtering ostriches (Struthio camelus) on a farm in South Africa. Antibody to CCHFV was detected in 24% of ostriches from surrounding farms, including six of nine ostriches from the farm where the patient worked. Interestingly, none of 460 birds of 37 other species tested during that study had detectable antibodies to CCHFV. Also, in 1996, there was an outbreak of 17 cases of CCHF among workers at an ostrich abattoir. In both instances, it was suspected that infection was acquired either by contact with ostrich blood or by inadvertently crushing infected ticks while skinning the ostriches (Whitehouse, 2004). Crimean-Congo haemorrhagic fever (CCHF) was diagnosed in 8 patients; 7 were staff members at Tygerberg Hospital who had been infected by a patient in whom the disease had not initially been diagnosed. Two patients, the initial case and a staff member, died and 4 became seriously ill (Joubert et al., 1985). During the Crimean-Congo haemorrhagic fever (CCHF) outbreak at Tygerberg Hospital a particular problem existed: a simultaneous influenza epidemic complicated the screening of contacts because of its very similar clinical picture to that of early CCHF (van de Wal et al., 1985).
2. Quetta, Pakistan: In December 1994 in a private hospital in Quetta, Pakistan, 3 health- workers contracted Crimean-Congo haemorrhagic fever (CCHF) after surgery on a bleeding patient who later died. Two of four people exposed percutaneously and one of five with cutaneous exposure contracted CCHF. The person with cutaneous exposure was a surgeon. Three index case relatives reported that although 10 family members had cutaneous exposure, none developed CCHF (Altaf et al., 1998).
3. Kosovo: During the spring and summer of 2001, an outbreak of C-CHF occurred in Kosovo, with 69 suspected cases (18 of them laboratory or clinically confirmed), out of which 6 have died (Papa et al., 2002B).
4. Turkey: In 2002 and 2003, a total of 19 persons in Turkey had suspected cases of Crimean-Congo hemorrhagic fever (CCHF) or a similar viral infection. Six serum samples were tested; all six were found positive for immunoglobulin M antibodies against CCHF virus. Two of the samples yielded CCHF virus isolates. Genetic analysis of the virus isolates showed them to be closely related to isolates from former Yugoslavia and southwestern Russia. Eighteen patients handled livestock, and one was a nurse with probable nosocomial infection. The case-fatality rate was 20% among confirmed CCHF case-patients (1 of 5 patients), and the overall case-fatality rate was 11% (2 of 19 patients) (Karti et al., 2004). Between 1 January and 30 June 2006, 323 people in Turkey underwent investigation for Crimean-Congo haemorrhagic fever (CCHF) virus infection. Among these, 150 cases were laboratory confirmed using enzyme-linked immunosorbent assay (ELISA) and real-time PCR tests. These laboratory-confirmed cases, including 11 fatal cases, were reported from 22 Turkish provinces. Most of the people investigated reported having been bitten by ticks ([European Surveillance]).
5. Mauritania: An outbreak of CCHF was initially observed in a hospital emergency ward, where the index patient infected five hospital staff members and 10 patients and visitors (Nabeth et al., 2004). As of 21 March 2003 the Ministry of Health, Mauritania had reported a total of 35 cases (18 laboratory confirmed), including 6 deaths of Crimean-Congo haemorrhagic fever (CCHF) (WHO Report: Epidemic and Pandemic Alert and Response (EPR) March, 2003).
6. United Arab Emirates (UAE): In the UAE, infection with C-CHFV had been noted first in 1979 when a hospital outbreak occurred in Dubai. The source of infection was then considered to be cattle imported from Iraq, Kenya, or Pakistan. However, although investigations were carried out, the source remains obscure. No further cases of C-CHFV infection had been reported in the UAE until November 1993 (Schwarz et al., 1996). An outbreak of Crimean-Congo hemorrhagic fever (CCHF) was noted in November 1994 among abattoir workers in the United Arab Emirates. Thirty-five suspected cases of CCHF were identified (case fatality = 62%). Livestock market employees, abattoir workers, and animal skin processors accounted for 16 (57%) of 28 cases with known occupational status. Serologic evidence of past asymptomatic infection was noted in 12 (4%) of 291 livestock and abattoir workers but in none of the controls (Khan et al., 1997).
7. Dubai, Saudi Arabia: A hospital outbreak of haemorrhagic fever took place in Dubai in November, 1979. The index case died in the casualty department shortly after admission. There were five secondary cases among hospital staff, two of whom died (Suleiman et al., 1980).

B. Transmission Information:

1. Ontology: UMLS:C1444005 From: Human To: Human
   Mechanism: The virus is transmitted to humans by the bite of Ixodid tick (mostly of the Hyalomma genus) or by contact with blood or tissues from human patients or infected livestock (Papa et al., 2002A). Transmission to humans can occur either through tick bites or possibly by crushing engorged infected ticks. Direct contact with virus-contaminated blood or tissues from infected animals or humans is another source of virus transmission and is generally characterized by more severe clinical symptoms and high mortality (Flick et al., 2005). The virus may also be transmitted from human to human which occurs primarily in the hospital setting (Drosten et al., 2003). Hospital health-care workers are at serious risk of transmission of CCHF infection when caring for patients with haemorrhages from the nose, mouth, gums, vagina, and injection sites. The transmission of the CCHF infections and deaths among health-care workers has been reported in parallel with outbreaks in the general population. The most dangerous settings for acquiring CCHF virus are interventions to gastrointestinal bleedings, and emergency operations on patients that have yet to be diagnosed with CCHF. In general, these patients were diagnosed after the operation, and injuries to the operating team during the operation are usually under-reported. Airborne acquisition of the infection was suspected in several cases in Russia, but were not documented. Horizontal transmission from a mother to her child has also been reported (Ergonul, 2006).
   
   
2. From: Tick To: Human
   Mechanism: CCHF virus is transmitted to humans by bites from Ixodid ticks, especially the genus of Hyalomma. The virus is also transmitted to humans either by direct contact with blood or tissues from infected animals, mainly sheep, or by patient's blood, vomit containing blood, or respiratory secretions. The latter human-to-human infection sometimes causes nosocomial outbreaks of CCHF (Morikawa et al., 2002). The virus is transmitted to humans by the bite of infected ticks, direct contact with blood or infected tissues from viremic animals, and direct contact with the blood or secretions of an infected person (Nabeth et al., 2004). Transmission also may occur from aerosol contact of blood from patients with advanced stages of the disease (Williams et al., 2000).
   
   
3. Ontology: UMLS:C1444006 From: Animal To: Human
   Mechanism: The virus is also transmitted to humans either by direct contact with blood or tissues from infected animals, mainly sheep (Morikawa et al., 2002). Cattle, sheep and goats do not become ill after infection but are viremic for about 1 week. During this period of time the virus may be transmitted to humans which have close contact to these animals such as agricultural workers, slaughterhouse workers, and veterinarians (Drosten et al., 2003). Asymptomatically viremic sheep and cattle have been implicated in the transmission to abattoir workers, even outside of known endemic area, and crushing infected ticks may also be hazardous (Ozkurt et al., 2006).
   
   
4. From: Animal To: Tick
   Mechanism: Immature ticks acquire the virus by feeding on infected small vertebrates. Once infected, they remain infected throughout their development and, when they are mature, transmit the infection to large animals, such as livestock (Nabeth et al., 2004).
   
   
5. From: Tick To: Tick
   Mechanism: Among invertebrates, CCHF viral infection has been demonstrated only in ticks, including viral isolations from numerous species/subspecies of seven genera of the family Ixodidae, and two species of the family Argasidae. An especially important biological feature of ticks in general as potential vector/reservoirs of arboviruses is their ability to transmit arboviruses transovarially. Evidence of this phenomenon for CCHF virus in nature is based mainly on limited isolations from eggs of H. marginatum and Dermacentor marginatus (Watts et al., 1988).
   
   

C. Environmental Reservoir:

1. Ticks :
   1. Description: While only a few species of ticks have been incriminated as vectors of CCHF virus, an enormous number of species/subspecies have been implicated primarily by viral isolations. In 1973, only 6 years after the first isolations of CCHF virus, a total of 10 species/subspecies had yielded isolates of this virus. A remarkable and especially important epidemiological feature that emerged was not only the large number of implicated vector tick species, but the association of CCHF virus with ticks in a variety of different ecological biotypes in the Palearctic, Oriental, and Ethiopian faunal regions. Among the total 29 species/subspecies of ticks associated with CCHF virus, most are either two- or three-host ticks of the family Ixodidae. An especially important biological feature of ticks in general as potential vector/reservoirs of arboviruses is their ability to transmit arboviruses transovarially. Evidence of this phenomenon for CCHF virus in nature is based mainly on limited isolations from eggs of H. marginatum and Dermacentor marginatus (Watts et al., 1988). Most of the ticks collected (618 of 912) from all species of sampled livestock were Hyalomma anatolicum anatolicum, a competent vector and reservoir of CCHF virus (Williams et al., 2000).
   2. Survival Information: Only a few controlled experimental studies have been conducted in an attempt to demonstrate the vector and reservoir potential of selected tick species for CCHF virus. However, none has been designed to address the possibility that CCHF viral infection may have a detrimental effect on this arthropod's potential role in the ecology and epidemiology of CCHF virus (Watts et al., 1988).

D. Intentional Releases:

1. Intentional Release information :
   1. Description:
   2. Emergency contact: If clinicians feel that VHF is a likely diagnosis, they should take two immediate steps: 1) isolate the patient, and 2) notify local and state health departments and CDC (MMWR 1998). Report incidents to state health departments and the CDC (telephone {404} 639-1511; from 4:30 p.m. to 8 a.m., telephone {404} 639-2888). Information on investigating and managing patients with suspected viral hemorrhagic fever, collecting and shipping diagnostic specimens, and instituting control measures is available on request from the following persons at Centers for Disease Control (CDC) in Atlanta, Georgia; for all telephone numbers, dial 404-639 + extension: Epidemic Intelligence Service (EIS) Officer, Special Pathogens Branch, Division of Viral Diseases, Center for Infectious Diseases (ext. 1344); Chief, Special Pathogens Branch, Division of Viral Diseases, Center for Infectious Diseases: Joseph B. McCormick, M.D. (ext. 3308); Senior Medical Officer, Special Pathogens Branch, Division of Viral Diseases, Center for Infectious Diseases: Susan P. Fisher-Hoch, M.D. (ext. 3308); Director, Division of Viral Diseases, Center for Infectious Diseases (ext. 3574). After regular office hours and on weekends, the persons named above may be contacted through the CDC duty officer (ext. 2888) (MMWR, 1988).
   3. Delivery mechanism: The VHF agents are all highly infectious via the aerosol route, and most are quite stable as respirable aerosols. This means that they satisfy at least one criterion for being weaponized, and some clearly have the potential to be biological warfare threats. Most of these agents replicate in cell culture to concentrations sufficiently high to produce a small terrorist weapon, one suitable for introducing lethal doses of virus into the air intake of an airplane or office building. Some replicate to even higher concentrations, with obvious potential ramifications. Since the VHF agents cause serious diseases with high morbidity and mortality, their existence as endemic disease threats and as potential biological warfare weapons suggests a formidable potential impact on unit readiness (Jahrling, 1997). The highly pathogenic nature of the CCHFV has led to the fear that it might be used as an agent of bioterrorism and/or biowarfare and has resulted in its inclusion as a CDC/NIAID Category C Priority Pathogen. CCHFV can be transmitted from person to person, has a high case-fatality rate, and may be transmissible by small-particle aerosol; but, its inability to replicate to high concentrations in cell culture is cited as a major impediment to its development as a mass casualty weapon, and thus precludes its classification as a Category A or B pathogen (Whitehouse, 2004).
   4. Containment: Patients with VHF syndrome generally have significant quantities of virus in their blood, and perhaps in other secretions as well (with the exceptions of dengue and classic hantaviral disease). Well-documented secondary infections among contacts and medical personnel not parenterally exposed have occurred. Thus, caution should be exercised in evaluating and treating patients with suspected VHF syndrome. Over-reaction on the part of medical personnel is inappropriate and detrimental to both patient and staff, but it is prudent to provide isolation measures as rigorous as feasible. At a minimum, these should include the following: stringent barrier nursing; mask, gown, glove, and needle precautions; hazard-labeling of specimens submitted to the clinical laboratory; restricted access to the patient; and autoclaving or liberal disinfection of contaminated materials, using hypochlorite or phenolic disinfectants. For more intensive care, however, increased precautions are advisable. Members of the patient care team should be limited to a small number of selected, trained individuals, and special care should be directed toward eliminating all parenteral exposures. Use of endoscopy, respirators, arterial catheters, routine blood sampling, and extensive laboratory analysis increase opportunities for aerosol dissemination of infectious blood and body fluids. For medical personnel, the wearing of flexible plastic hoods equipped with battery-powered blowers provides excellent protection of the mucous membranes and airways (Jahrling, 1997).

III. Infected Hosts

1. Humans:
   1. Taxonomy Information:
      1. Species:
         1. Human; man :
            • Ontology: UMLS:C0086418
            • GenBank Taxonomy No.: 9606
            • Scientific Name: Homo sapiens (NCBI Taxonomy)
            • Description: Humans appear to be the only host of CCHFV in which disease is manifested (except for newborn mice). In contrast to the inapparent infection in most other vertebrate hosts, human infection with CCHFV often results in severe hemorrhagic disease (Whitehouse, 2004). The virus is transmitted to humans by the bite of Ixodid ticks (mostly of the Hyalomma genus) or by contact with blood or tissues from human patients or infected livestock (Papa et al., 2002A).
      
      
   2. Infection Process:
      1. Infectious Dose: 1 -10 organisms (Franz et al., 1997)
      2. Description: Humans become infected by being bitten by ticks or by crushing ticks, often while working with domestic animals or livestock. Contact with blood, secretions, or excretions of infected animals or humans may also transmit infection. In areas with endemic CCHF, the disease may occur most often in the spring or summer (MMWR, 1988). Infections by VHF viruses are associated with a wide spectrum of clinical manifestations such as diarrhea, myalgia, cough, headache, pneumonia, encephalopathy, and hepatitis. Hemorrhage is the characteristic manifestation, although nonhemorrhagic infections are also common. VHF is often fatal in spite of modern intensive care. Filoviruses, arenaviruses, and CCHFV are of particular relevance because they can be transmitted from human to human, thus causing epidemics with high mortality rates (Drosten et al., 2002). While C-CHFV infections are rare in humans, the virus is notorious for nosocomial outbreaks of VHF, typically following admission of an index case to a health-care facility where VHF was not suspected, with mortality rates up to 40% (Dunster et al., 2002).
      3. • Ixodid (hard) tick
           
           
           
           Description: Ixodid (hard) ticks, especially those of the genus, Hyalomma, are both a reservoir and a vector for the CCHF virus. Numerous wild and domestic animals, such as cattle, goats, sheep and hares, serve as amplifying hosts for the virus. Transmission to humans occurs through contact with infected animal blood or ticks. CCHF can be transmitted from one infected human to another by contact with infectious blood or body fluids. Documented spread of CCHF has also occurred in hospitals due to improper sterilization of medical equipment, reuse of injection needles, and contamination of medical supplies (Copyright: CDC)
           
         • Bone marrow aspiration smear
           
           
           
           Description: Bone marrow aspiration smear, stained with Wright, showing hemophagocytosis. A) phagocytosis of an erythrocyte and nuclear remnants by a microphage. B) phagocytosis of platelets by a macrophage (Copyright: CDC)
           
      
      
   3. Disease Information:
      1. CCHF (i.e., Crimean Congo Hemorrhagic Fever) :
         1. Pathogenesis Mechanism: [A]: The pathogenesis of CCHF is poorly understood. Because CCHF occurs sporadically, and in areas where clinical pathology facilities are limited, complete autopsies are seldom performed on patients who die from the disease. Additional factors that hamper studies on CCHF include the need for specialized laboratories (i.e., biosafety level-4 (BSL-4) containment) and lack of available animal models of disease. Therefore, limited knowledge of pathogenesis is often obtained from blood changes and liver biopsies of CCHF patients. The most comprehensive study of the clinical pathology of CCHF was that of Swanepoel et al., in which observations were made on 50 CCHF patients from South Africa diagnosed from 1981 to 1987. Of the 50 patients studied, 15 died (30% mortality), although one of those patients acquired bacterial meningitis as a complication to surgery for cerebral hemorrhage. Factors contributing to a fatal outcome included cerebral hemorrhage, severe anemia, severe dehydration, and shock associated with prolonged diarrhea, myocardial infarction, lung edema, and pleural effusion. Patients who died developed terminal multiple organ failure, including cerebral, liver, and kidney failure and cardiac and pulmonary insufficiency. Liver lesions vary from disseminated necrotic foci to massive necrosis. Necrotic hepatocytes appear as amorphous masses and there is little or no inflammatory response. In fact, in patients who died, there was also little evidence of an antibody response (Whitehouse, 2004). Capillary fragility is a common feature of CCHF, suggesting infection of the endothelium. This is surely where the alternative term "capillary toxicosis", given to CCHF by the early Soviet workers, was derived. Endothelial damage would account for the characteristic rash and contribute to hemostatic failure by stimulating platelet aggregation and degranulation, with consequent activation of the intrinsic coagulation cascade. Thrombocytopenia appears to be a consistent feature of CCHF infection and platelet counts can often be extremely low from an early stage of illness in fatal cases. Indeed, of the fatal CCHF cases in the South African study, all had grossly abnormal indicators of coagulation system function from an early stage of illness. The major beneficial outcome of that study was the realization that disseminated intravascular coagulopathy (DIC) was noted as an early and prominent feature of the disease process in CCHF. The characteristic endothelial damage seen in CCHF is not necessarily the result of direct infection of the endothelial cells by CCHFV. At least in the case of Ebola hemorrhagic fever, evidence is mounting that much of the cellular damage and resulting coagulopathy actually results from multiple host-induced mechanisms. These include massive apoptosis of lymphocytes both intravascularly and in lymphoid organs; induction of proinflammatory cytokines, including tumor necrosis factor (TNF)-alpha; and the dysregulation of the coagulation cascade leading to DIC. Recently, Geisbert et al. identified a molecular trigger for DIC through the expression of tissue factor (TF) on the surface of Ebola virus-infected monocytes and macrophages. Interestingly, some authors are now recognizing the similarities between various viral hemorrhagic fevers (i.e., dengue and Ebola hemorrhagic fevers) and septic shock caused by severe bacterial infections. Indeed, many of these same features are seen in CCHF, including DIC, vascular dysfunction, and shock (Whitehouse, 2004). The specific mechanisms underlying the pathogenesis of the VHF viruses have not been clearly explained, although recent progress has been made on Ebola virus. A central theme common to all VHFs, with the possible exception of yellow fever, is that lesions are not severe enough to account for terminal shock and death of the host. Yet a fulminant shock-like syndrome characterizes VHFs in fatal cases, suggesting that inflammatory mediators may have an important role in disease pathogenesis. Fatal VHF infections are generally characterized by high viremia and immunosuppression. VHF in humans and nonhuman primates is characterized by deleterious changes in lymphoid tissues and defects in the coagulation system. Another common thread among these viruses is the observation that all of the hemorrhagic fever viruses seem to target and impair the cells that initiate the antiviral immune response, probably leading to the overwhelming viral burdens that are commonly seen (Geisbert and Jahrling, 2004).
            
            
            • Model of current understanding of VHF pathogenesis in primates (Geisbert and Jahrling, 2004):
              
              
              
              Description: (a): Virus spreads from the initial infection site to regional lymph nodes, liver and spleen. At these sites, the virus infects tissue macrophages (including Kupffer cells) and dendritic cells. Soluble factors released from virus-infected monocytes and macrophages act locally and systemically. Release of chemokines from these virus-infected cells recruits additional macrophages to sites of infection, making more target cells available for viral exploitation and further amplifying the dysregulated host response. Although none of these viruses infects lymphocytes, their rapid loss by apoptosis is a prominent feature of disease. The direct interaction of lymphocytes with viral proteins cannot be discounted as having a role in their destruction, but the marked loss of lymphocytes is likely to result from a combination of factors including virus infection of dendritic cells and release of soluble factors from virus-infected monocytes and macrophages. For example, virus infection of dendritic cells impairs their function by interfering with the upregulation of costimulatory molecules, which are important in providing rescue signals to T lymphocytes. Additionally, release of soluble factors from infected monocytes and macrophages results in deletion of lymphocytes, both directly by release of mediators such as nitric oxide and indirectly by contributing to upregulation of proapoptotic proteins such as Fas and TRAIL. The coagulation abnormalities vary in nature and magnitude among the VHFs. For example, Ebola virus induces the overexpression of tissue factor, which results in activation of the clotting pathway and the formation of fibrin in the vasculature. In contrast, coagulation disorders are less marked in Lassa fever, and impairment of endothelial function contributes to edema, which seems to be a more prominent finding in Lassa fever than in other VHFs (Geisbert and Jahrling, 2004). (b): The hemodynamic and coagulation disorders common among all of the VHFs are exacerbated by infection of hepatocytes and adrenal cortical cells. Infection of hepatocytes impairs synthesis of important clotting factors. At the same time, reduced synthesis of albumin by hepatocytes results in a reduced plasma osmotic pressure and contributes to edema. Impaired secretion of steroid-synthesizing enzymes by hemorrhagic fever virus-infected adrenal cortical cells leads to hypotension and sodium loss with hypovolemia. Macular rashes are often seen in VHFs (Geisbert and Jahrling, 2004).
              
            • Worldwide Distribution of CCHFV
              
              
              
              Description: The worldwide geographic distribution of CCHF viral isolates and human disease (Whitehouse, 2004).
              
            • Worldwide Distribution of CCHFV
              
              
              
              Description: Geographic distribution of Crimean-Congo haemorrhagic fever (Copyright: World Health Organization (WHO)) (WHO).
              
         
         
         
         2. Incubation Period: The incubation period for CCHF is about 2-9 days (MMWR, 1988). If the virus is transmitted via tick bite, the incubation period appears to be shorter (1-9 days) than after transmission via infected animals (5-13 days) (Drosten et al., 2003). The incubation period is usually 5-6 days after contact with blood (Nabeth et al., 2004). In general, the incubation period after a tick bite can be as short as 1-3 days, but can much longer, depending on several factors including route of exposure. For example, in South Africa, among 21 patients for which reliable data were obtained, the time to onset of disease after exposure by tick bite was 3.2 days, to blood or tissue of livestock was 5.0 days, and to blood of human cases was 5.6 days. It has been hypothesized that different hosts can induce phenotypic changes in CCHFV strains that modulate viral virulence. It is unclear whether the variation observed in incubation times, and ultimately disease outcome, may be due to this phenomenon or other factors, such as viral dose (Whitehouse, 2004). During this period of time and whilst first non-specific symptoms are present, the infection may be unperceivedly imported into non-endemic regions (Drosten et al., 2003).
         
         
         
         3. Prognosis: Deaths occurred on days 5-14 of illness. Patients with fatal infections had thrombocytopenia and markedly elevated levels of serum aspartate and alanine aminotransaminases, gamma-glutamyltransferase, lactic dehydrogenase, creatine kinase, bilirubin, creatinine, and urea. Total protein, albumin, fibrinogen, and hemoglobin levels were depressed. Values for prothrombin ratio, activated partial thromboplastin time, thrombin time, and fibrin degradation products were grossly elevated, findings that indicate the occurrence of disseminated intravascular coagulopathy. Many of the clinical pathologic changes were evident at an early stage of the disease and had a highly predictive value for fatal outcome of infection. Changes were present but less marked in nonfatal infections (Swanepoel et al., 1989). CCHF has an infection rate of 20-100% and a 15-30% fatality rate. Individuals who survive and do not experience specific sequelae typically return to their premorbid state
         
         
         
         4. Diagnosis Overview: Early diagnosis is essential, both for the outcome of the patient and, because of the potential for nosocomial infections, to prevent further transmission of disease. Clinical symptoms and patient history, especially travel to endemic areas and history of tick bite or exposure to blood or tissues of livestock or human patients, are the first indicators of CCHF. The differential diagnosis should include rickettsiosis (tick-borne typhus and African tick bite fever), leptospirosis, and borreliosis (relapsing fever). Additionally, other infections, which present as hemorrhagic disease such as meningococcal infections, hantavirus hemorrhagic fever, malaria, yellow fever, dengue, Omsk hemorrhagic fever, and Kyasanur Forest disease should be considered. In Africa, Lassa fever and infection with the filoviruses, Ebola and Marburg, must also be included in the differential diagnosis (Whitehouse, 2004). The traditional method for CCHFV isolation has been by intracranial (i.c.) or intraperitoneal (i.p.) inoculation of a sample (e.g., blood from an acute-phase patient or ground tick pools) into newborn mice. Isolation in cell culture is far simpler and provides a more rapid result, but is generally considered less sensitive and can generally only detect high concentrations of virus. Nevertheless, virus can be isolated from blood and organ suspensions in a wide variety of susceptible cell lines including LLC-MK2, Vero, BHK-21, and SW-13 cells with maximal virus yields (10(7)-10(8) plaque-forming units/ml) after 4-7 days of incubation. Depending on the cell line and strain, the virus may produce little or no cytopathic effect (CPE) and develop into a noncytopathic persistent infection of the cells; however, virus can be identified by performing immunofluorescence assay (IFA) with specific monoclonal antibodies. Additionally, CPE and the visualization of plaques may occur only after serial passage of virus (Whitehouse, 2004). IgM and IgG antibodies are detectable by ELISA and immunofluorescence assays from about 7 days after the onset of disease. Specific IgM declines to undetectable levels by 4 months post-infection, but IgG remains detectable for at least 5 years. Recent or current infection is confirmed by demonstrating seroconversion, or a fourfold or greater increase in antibody titre in paired serum samples, or IgM antibodies with IgM antibody capture (MAC)-ELISA in a single sample (Ergonul, 2006). An antibody response is rarely detectable in fatal cases and diagnosis is usually confirmed by isolation of the virus from the serum or liver biopsy specimens (Whitehouse, 2004). ELISA methods are quite specific and much more sensitive than immunofluorescence assays and neutralisation tests. Recently, a recombinant nucleoprotein-based IgG ELISA for serological diagnosis of CCHF virus infections was developed (Ergonul, 2006). Molecular-based diagnostic assays, such as the reverse transcription-polymerase chain reaction (RT-PCR), provide a useful complement to serodiagnosis and now often serve as the front-line tool in the diagnosis of CCHF, as well as other viral hemorrhagic fevers. The benefits of using such assays are many. Because RT-PCR detects the genetic material of the virus, and can be designed to be highly specific, it is possible to make a presumptive diagnosis of CCHF without the need to culture the virus, which would require the use of specialized biocontainment laboratory facilities. Indeed, due to the high sensitivity of RT-PCR, positive results can often be obtained from samples which are culture negative. In addition, the assay can be applied retrospectively to stored serum samples. Another benefit to molecular diagnostic assays is their rapidity compared to virus culture, often allowing a presumptive diagnosis to be reported within 8 h of receiving the first specimen. A further improvement on the conventional RT-PCR assay has been the development of automated real-time assays. The real-time PCR assay has many advantages over conventional RT-PCR methods, including lower contamination rate, higher sensitivity and specificity, and they are rapid, providing results in minutes instead of hours. Drosten et al. developed a one-step real-time RT-PCR assay for detecting CCHFV using primers to the nucleoprotein gene; however, they used the DNA-intercalating dye, SybrGreen I, for detecting the PCR product because no conserved binding site for a 5'-nuclease probe could be found. This problem has been partially solved by Garrison et al., who developed a real-time RT-PCR assay using TaqMan-minor groove binding protein (MGB) probe, allowing for greater specificity with a shorter probe length (Whitehouse, 2004).
         
         
         
         5. Symptom Information :
            • Syndrome -- Viral Hemorrhagic Fever:
              • Description: The term viral hemorrhagic fever (VHF) refers to the illness associated with a number of geographically restricted viruses. This illness is characterized by fever and, in the most severe cases, shock and hemorrhage. Although a number of other febrile viral infections may produce hemorrhage, only the agents of Lassa, Marburg, Ebola, and Crimean-Congo hemorrhagic fevers are known to have caused significant outbreaks of disease with person-to-person transmission (MMWR, 1988).
            • Syndrome -- Crimean Congo Hemorrhagic Fever (CCHF):
              • Description: For CCHF, initial symptoms are nonspecific and sometimes occur suddenly. They include fever, headache, myalgia, arthralgia, abdominal pain, and vomiting. Sore throat, conjunctivitis, jaundice, photophobia, and various sensory and mood alterations may develop. A petechial rash is common and may precede a gross and obvious hemorrhagic diathesis, manifested by large ecchymoses, bleeding from needle-puncture sites, and hemorrhage from multiple other sources. The case-fatality rate has been estimated to range from 15% to 70%, but mild or inapparent infections occur (MMWR, 1988). Crimean-Congo hemorrhagic fever infection is usually associated with profound disseminated intravascular coagulation (DIC). Patients with Crimean-Congo hemorrhagic fever may bleed profusely; and since this occurs during the acute, viremic phase, contact with the blood of an infected patient is a special concern (Jahrling, 1997).
              • Observed: CCHF has an infection rate of 20-100%. Human infection is relatively rare, and most humans are seronegative, even in endemic areas (Gonzalez-Scarano et al., 1996).
              
              
              Symptoms Shown in the Syndrome:
              
              
              • Fever:
                • Ontology: UMLS:C0015967
                • Description: Fever is often very high (39 - 41 C) and can be constantly elevated for 5-12 days or may be biphasic (Whitehouse, 2004).
                • Observed: 81.8% of patients had high fever (Schwarz et al., 1997).
              • Diarrhea:
                • Ontology: UMLS:C0011991
                • Observed: 63.6% had diarrhea (Schwarz et al., 1997).
              • Hemorrhagic signs:
                • Description: In severe cases, 3-6 days after onset of disease, hemorrhagic manifestations develop. These can range from petechiae to large areas of ecchymosis and often appear on the mucous membranes and skin, especially on the upper body and/or extremities. Bleeding in the form of melena, hematemesis, and epistaxis is also commonly seen by day 4 or 5 and can often be characterized by dark "coffee grounds" vomitus and tar-like stools resulting from intestinal hemorrhages. Bleeding from other sites including the vagina, gingival bleeding and, in the most severe cases, cerebral hemorrhage have been reported (Whitehouse, 2004).
                
                
                
                • Massive cutaneous ecchymosis
                  
                  
                  
                  Description: Massive cutaneous ecchymosis on the arm of a CCHF patient, 7-10 days after clinical onset. Photograph courtesy of Dr. Robert Swanepoel, National Institute of Virology, South Africa (Whitehouse, 2004).
                  
                • Observed: 45.5% had hemorrhagic signs (Schwarz et al., 1997).
              • Dizziness:
                • Ontology: UMLS:C0012833
                • Description: Onset of symptoms is abrupt with fever, myalgia, dizziness, neck pain and stiffness, backache, headache, sore eyes and photophobia, nausea, vomiting, diarrhoea and abdominal pain (Bossi et al., 2004).
              • Throat pain:
                • Ontology: UMLS:C0242429
                • Observed: 18.2% had throat pain (Schwarz et al., 1997).
              • Vomiting:
                • Ontology: UMLS:C0042963
                • Observed: 45.5% were vomiting (Schwarz et al., 1997).
              • Nausea:
                • Ontology: UMLS:C0027497
                • Description: Symptoms can include gastrointestinal disorders, such as nausea, vomiting, and diarrhea (Flick et al., 2005).
              • Severe Headache:
                • Ontology: UMLS:C0239889
                • Description: Crimean-Congo hemorrhagic fever (CCHF) is characterized by a sudden onset of high fever, chills, and severe headache (Flick et al., 2005).
              • Myalgia:
                • Ontology: UMLS:C0231528
                • Description: Like other hemorrhagic fevers, the symptoms of the initial phase are rather unspecific: fever, myalgia, headache, nausea, vomiting, and diarrhea (Drosten et al., 2003).
              • Encephalopathy:
                • Ontology: UMLS:C0085584
                • Description: During the further course of the disease encephalopathy, bleeding, and organ failure may develop, which are associated with high mortality (Drosten et al., 2003).
         
         
         6. Treatment Information:
            • Supportive care: Treatment is supportive and may require intensive care (MMWR, 1988). Early diagnosis and supportive care can be lifesaving for most patients with VHF. The cornerstone of therapy for all these infections is judicious fluid and electrolyte management
              • Blood, platelet, and plasma replacement: Blood, platelet, and plasma replacement may be useful for CCHF
                • Success Rate: Although immune plasma has been used its effectiveness has not been evaluated (MMWR, 1988).
              • Ribavirin - Intravenous treatment: The intravenous preparation of ribavirin is recommended for treatment of viral hemorrhagic fevers, and the oral form for postexposure prophylaxis (Mardani et al., 2003). Intravenous ribavirin should be administered within 6 days of illness onset as follows: 30 mg/kg loading dose, followed by 16 mg/kg 4 times a day for 4 days, then 8 mg/kg 3 times a day for 6 days (Bossi et al., 2004). A parenteral preparation of ribavirin currently is not commercially available in the US, but is available for compassionate use protocols for the treatment of Lassa fever, Hantavirus infections, Crimean-Congo hemorrhagic fever, and other viral hemorrhagic fevers. Clinicians should contact the Special Pathogen branch at CDC (404-639-1115) for information on the management of CCHF and the use of ribavirin in this infection (AHFS Drug Information, 2006).
                • Applicable: There is currently no specific antiviral therapy for CCHF approved for use in humans by the FDA. However, the antiviral drug, ribavirin, has shown the most promise over the years (Whitehouse, 2004). Ribavirin, a broad-spectrum antiviral agent, is supposed to be a potential therapeutic for CCHF, based on some experimental studies, anecdotal case reports, and an open study in which the controls were historical. However, the literature reveals no blinded and randomized clinical trials of ribavirin against CCHF (Bakir et al., 2005). To date, no randomized, controlled studies have been performed to rigorously confirm the efficacy of ribavirin for treating CCHF (Whitehouse, 2004).
                • Contraindicator: It should be noted that men and women who take ribavirin for prophylaxis should avoid conception for six months after taking it because of ribavirin's teratogenic effects. Ribavirin is teratogenic in experimental animals. Its use may be contraindicated in pregnant women; however, given the seriousness of the disease, ribavirin must be considered (Bossi et al., 2004). Although ribavirin should not be used when renal impairment is present, it may be necessary for severe disease in which the potential benefit may outweigh the risks
                • Complication: With IV administration, reversible suppression of erythropoiesis, mild hemolysis, and mild direct hyperbilirubinemia are expected and generally manageable
                • Success Rate: Several case reports have been published that suggest oral or intravenous ribavirin is effective for treating CCHFV infections. For example, in Pakistan, three nosocomial cases of CCHF were treated with oral ribavirin for 10 days, and they made a complete recovery. More recently, in a large cohort study in Iran, the efficacy of oral ribavirin was 80% among patients with confirmed CCHF (Whitehouse, 2004).
                • Drug Resistance:
              • Ribavirin - Oral treatment: Ribavirin therapy was started early (within 4 days after the onset of the disease) for 7 patients, and none died. Ribavirin therapy was initiated late (at least 5 days after the onset of the disease) for 5 patients, and 3 died. In another report, oral ribavirin was used in the treatment of 3 patients in Pakistan with nosocomial CCHF, administered at a dosage of 4 g daily for 4 days and then 2.4 g daily for the following 6 days. The 3 patients were not expected to respond to therapy, but this treatment saved their lives (Mardani et al., 2003).
                • Applicable: Oral ribavirin has been used for postexposure prophylaxis for patients with CCHF, but its efficacy has not been formally assessed (Mardani et al., 2003). Ribavirin has been used orally or IV with some success in a limited number of patients for the treatment of Crimean-Congo hemorrhagic fever (CCHF). Although experience with ribavirin in the treatment and prevention of CCHF is substantially more limited than with Lassa fever, the CDC states that use of ribavirin to treat the disease and to prevent infection in high-risk contacts seems reasonable based on in-vitro susceptibility data for this and other Bunyaviridae. The CDC recommends that similar procedures for care, including isolation and body fluid precautions and therapy, recommended for Lassa fever be followed for patients with Crimean-Congo hemorrhagic fever and their contacts; however, additional study and experience is necessary (AHFS Drug Information, 2006).
                • Contraindicator: Oral ribavirin is contraindicated in women who are or may become pregnant and also is contraindicated in male partners of such women, in patients with hemoglobinopathies, and in patients with creatinine clearances less than 50 mL/min (AHFS Drug Information, 2006).
                • Complication: Anemia (most commonly), insomnia, depression, irritability, and suicidal behavior have been reported with PO administration; with IV administration, reversible suppression of erythropoiesis, mild hemolysis, and mild direct hyperbilirubinemia are expected and generally manageable Safety of ribavirin in infants and children has not been established (Jahrling, 1997).
                • Success Rate: The efficacy or oral ribavirin was determined to be 34% among patients suspected of having CCHF and 80% among patients with confirmed cases of CCHF (Mardani et al., 2003). Three health workers infected with CCHF virus in Pakistan were treated with oral ribavirin for 10 days. All three patients were severely ill with low platelet and white-cell counts, raised aspartate transaminase and evidence of impaired haemostasis. The patients became afebrile, and their haematological and biochemical abnormalities returned to normal within 48 h of ribavirin treatment; all made a complete recovery, and developed IgG and IgM antibody to CCHF virus (Fisher-Hoch et al., 1995). The efficacy of ribavirin treatment for patients in Eastern Turkey was evaluated with respect to various parameters between patients treated with ribavirin (22 cases) and historical controls (38 cases who had not received ribavirin). The mean admission times of the patients were similar in both groups, i.e. 6 vs. 6.5 days (P=0.57). Some parameters such as WBC, PLT, ALT and AST returned to normal levels in a shorter period relative to the values of the control group. The drug was well tolerated. Mild hemolytic anemia occurred only in one case and recovered spontaneously after 2 days without withdrawing the drug. No other severe adverse effect was observed. The need for blood and blood product was not decreased in the ribavirin group when compared to the control group. The mean hospitalization time was 7.7 days in the ribavirin group and 10.3 days in the control groups (P=0.06). Of 60 patients, six died (10.0%), two in the ribavirin and four in the control groups. Deaths occurred in the 2nd week of the disease (on days 9, 8, 8, 11, 10, 12). Fatality rate was 9.0% in the ribavirin group vs. 10.5% in the control group (P=0.85). The expenditure did not decrease in ribavirin group (Ozkurt et al., 2006). In the People's Republic of China, ribavirin significantly reduced mortality in patients with hemorrhagic fever with renal syndrome (Huggins, 1989).
              • Immunotherapy: A new specific immunoglobulin CCHF-Venin has been prepared the plasma pool of boosted donors, by a combined ethanolpolyethyleneglycol fractionation method with an ion-exchange purification step. The final product is free from immunoglobulin aggregates, vasoactive substances, and polyethyleneglycol, and meets national and international requirements for intravenous immunoglobulin. It contains antibodies to CCHF virus of a titre of 8 (Vassilenko et al., 1990).
                • Applicable: There was an early recognition of the possible benefits of treatments using serum prepared from the blood of recovered CCHF patients or gammaglobulin obtained from immunization of horses. In more recent times, immunotherapy was attempted via passive transfer of CCHF survivor convalescent plasma (Whitehouse, 2004). These limited studies suggest that CCHF immune serum is beneficial when administered intravenously in a dose of 250 ml over 1 to 2 hours on successive days, and when given early in infection (Flick et al., 2005).
                • Success Rate: In the summer of 1989 seven patients with severe CCHF received, besides conventional treatment, immune plasma. The patients recovered quickly, their leucocyte and platelet counts returned to normal, and coagulation abnormalities were corrected. Their bleeding tendency ceased. No side-effects were observed and the patients were discharged in good health (Vassilenko et al., 1990). Although seven patients with severe CCHF who received immune plasma recovered, this was an uncontrolled experiment, and firm evidence of its value is lacking (Whitehouse, 2004).
              • Vaccination: A vaccine for CCHF derived from inactivated mouse brain is used in Bulgaria, but is not available outside of that country. Furthermore, the efficacy of this vaccine is not well quantified (Flick et al., 2005).
      
      
   4. Prevention:
      1. Avoid or minimize virus exposure:
         • Description: The best means of preventing disease is to avoid or minimize exposure to the virus. This can be accomplished in a number of ways. Persons in high-risk occupations (i.e., slaughterhouse workers, veterinarians, sheep herders, etc.) should take every precaution to avoid exposure to virus infected ticks or virus-contaminated animal blood or other tissues. For example, wearing gloves and limiting exposure of naked skin to fresh blood and other tissues of animals are effective practical control measures (Whitehouse, 2004). Tick-avoidance measures are important in the prevention of C-CHF, especially for backpackers and hikers, and include the use of protective clothing, with trousers tucked into socks and boots. Frequent body searches should be made to find and remove ticks (Issacson, 2001).
      2. Tick control:
         • Ontology: UMLS:C0040195
         • Description: Vector control on domestic animals can best be accomplished by direct chemical use. Acaricide treatment of cattle with Sevin during the period of adult attachment was found to be the most efficient control measure for H. m. marginatum in Astrakhan Oblast. Application of acaricides only to specific body regions where adults are known to attach can increase treatment efficiency (Watts et al., 1988). Applying commercially available insect repellents (i.e., diethyl toluamide [DEET]) to exposed skin and the use of clothing impregnated with permethrin can give some protection against tick bites (Whitehouse, 2004).
         • Efficacy:
           • Rate: Acaricide treatment of livestock in CCHFV endemic areas is effective in reducing the population of infected ticks (Whitehouse, 2004).
      3. Vertebrate control:
         • Ontology: UMLS:C1511501
         • Description: The density of tick vectors of CCHF may be reduced by controlling the primary vertebrate hosts of the immature ticks. Suppression of rodent populations apparently reduced the numbers of D. marginatus in Europe and H. a. asiaticum in the Asian deserts and semideserts. Hyalomma ticks were reduced in Europe by controlling hares and hedgehogs. Control of birds could also limit the dispersion of tick vectors (Watts et al., 1988).
      4. Environmental control:
         • Ontology: UMLS:C1504113
         • Description: Environmental modification has been shown to be effective in controlling vector population density and CCHF viral activity. Clearing areas around resorts, woodlots, and path sides of shelters where ticks may survive has been stressed as a useful measure to reduce H. m. marginatum population density and the chances of human contact with the ticks. The recommended strategy for controlling H. a. anatolicum was the removal of vegetation on hill slopes, floodplain meadows, and abandoned alfalfa fields in Kazakhstan. Environmental modification which increases larval tick exposure to sunlight and to winter temperature causes mortality. Irrigation and plowing were also considered effective in reducing the density of H. a. anatolicum (Watts et al., 1988).
      5. Barrier nursing:
         • Ontology: UMLS:C1283821
         • Description: Strict barrier-nursing techniques should be enforced: all persons entering the patient's room should wear disposable gloves, gowns, masks, and shoe covers. Protective eye wear should be worn by persons dealing with disoriented or uncooperative patients or performing procedures that might involve the patient's vomiting or bleeding (for example, inserting a nasogastric tube or an intravenous or arterial line). Protective clothing should be donned and removed in the anteroom. Only essential medical and nursing personnel should enter the patient's room and anteroom. Isolation signs listing necessary precautions should be posted outside the anteroom (MMWR, 1988).
      6. Vaccination:
         • Ontology: UMLS:C0042196
         • Description: A suckling mouse brain, formalin-inactivated vaccine has been used in Bulgaria and other parts of Eastern Europe and the former Soviet Union. However, with the relatively small target population of persons at-risk for contracting CCHFV, the large-scale development and production of a CCHF vaccine by modern standards seems unlikely (Whitehouse, 2004).
         • Efficacy:
           • Rate: In the Rostov region of the former Soviet Union, 1500 persons received the vaccine and showed a high frequency of detectable antibody by the N test. Likewise, vaccine was given to several hundred human volunteers in Bulgaria, with resulting high antibody induction (Whitehouse, 2004).
      
      
   5. Model System:
      1. Ostriches:
         1. Ontology: UMLS:C0325336
         2. Model Host: Struthio camelus
         3. Description: 9 susceptible young ostriches were infected subcutaneously with the virus in order to study the nature of the infection which they undergo. The ostriches developed viraemia which was demonstrable on days 1-4 following infection, with a maximum intensity of 4.0 log(10) mouse intracerebral LD50/ml being recorded on day 2 in 1 of the birds. Virus was detectable in visceral organs such as spleen, liver and kidney up to day 5 post-inoculation, 1 day after it could no longer be found in blood. No infective virus was detected in samples of muscle, but viral nucleic acid was detected by reverse transcription-polymerase chain reaction in muscle from a bird sacrificed on day 3 following infection (Swanepoel et al., 1998).
      2. Mouse:
         1. Ontology: UMLS:C0025929
         2. Model Host: Mus musculus
         3. Description: After intraperitoneal (i.p.) infection of infant mice with CCHF virus, virus titers in liver remained significantly higher than in other organs except blood (serum). Within the liver, virus antigen was first found by immunofluorescence (IFA) in Kupffer cells followed by more extensive hepatic spread. Later, virus was found in other organs including brain and heart. Ribavirin treatment significantly reduced infant mouse mortality and extended the geometric mean time to death. Ribavirin treatment reduced CCHF virus growth in liver and significantly decreased, but did not prevent, viremia. Despite a substantial viremia, infection of other organs including brain and heart was not detected in ribavirin-treated mice. A hepatotropic virus subpopulation with less neurovirulence than the parent was isolated from liver of ribavirin-treated mice (single dose, 100 mg/kg). After serial passage in placebo-treated mice, the exclusive hepatotropism was lost (Tignor and Hanham, 1993).
      3. Bird:
         1. Ontology: UMLS:C0005595
         2. Model Host: Bird
         3. Description: An experimental model for investigating the role of birds in the CCHF virus transmission cycle was developed. Following CCHF virus inoculation, antibodies were detected by enzyme-linked immunosorbent assay in one red-beaked hornbill and one glossy starling, but not in two laughing doves and six domestic chickens. None of the birds showed a detectable viremia. Hyalomma marginatum rufipes larvae were placed on three red-beaked hornbills and one glossy starling. These birds were then inoculated with CCHF virus (10(1.5) 50% mouse intracerebral lethal doses). Virus transmission to larvae or nymphs was obtained and seroconversions in birds were recorded. Virus was also detected in 90% of the individually tested nymphs, as well as in adults. The virus was then successfully transmitted by adult ticks to rabbits and the engorged females were allowed to oviposit. Progeny larvae were placed on another group of birds and one of three birds showed seroconversion. The cycle of transmission of virus between ticks and aviremic ground-feeding birds represent a potential reservoir and amplification mechanism of CCHF virus in west Africa (Zeller et al., 1994A).
2. Vertebrates:
   1. Taxonomy Information:
      1. Species:
         1. Ass; domestic ass; donkey; African wild ass; Somali wild ass; African ass :
            • Ontology: UMLS:C0324145
            • GenBank Taxonomy No.: 9793
            • Scientific Name: Equus asinus; Equus africanus (NCBI Taxonomy)
            • Description: Antibodies against CCHF virus have been detected in the sera of horses, donkeys, goats, cattle, sheep, and pigs in various regions of Europe, Asia, and Africa (Ergonul, 2006). Once infected, the tick remains infected through its developmental stages, and the mature tick may transmit the infection to large vertebrates, such as livestock. Domestic ruminant animals, such as cattle, sheep and goats, are viraemic (virus circulating in the bloodstream) for around one week after becoming infected (Sandia Report: SAND2003-3080, 2003).
         2. Bovine, domestic cow, domestic cattle, cattle :
            • Ontology: UMLS:C0007452
            • GenBank Taxonomy No.: 9913
            • Scientific Name: Bos taurus (NCBI Taxonomy)
            • Description: Calves can probably contribute to the quantity of CCHF virus flowing in a focus when previously uninfected ticks parasitize them during the viremic period. However, the nature of this contribution remains to be better qualified and quantified. Pak considered cattle to have an important role as CCHF virus reservoirs in Tadzhikistan foci, where the numbers of infected Hyalomma a. anatolicum from cattle were much greater than from clay fences (duvals). Support is given to this thesis by the Chumakov et al. report of 3 humans who became infected and died of CCHF after butchering a sick cow in Uzbekistan (Hoogstraal, 1979).
         3. Brown hare; Cape hare :
            • Ontology: UMLS:C0999630
            • GenBank Taxonomy No.: 9981
            • Scientific Name: Lepus capensis (NCBI Taxonomy)
            • Description: A report on the number and variety of ticks infesting Lepus capensis in Kenya provides an example of how important these animals can be as hosts of immature stages of tick species known to participate in CCHF virus circulation in Africa (Hoogstraal, 1979).
         4. Buffalo (Bubalus) :
            • Ontology: UMLS:C0006352
            • GenBank Taxonomy No.: 9918
            • Scientific Name: Bubalus (NCBI Taxonomy)
            • Description: Competitive ELISA (CELISA) was applied to the sera of 960 wild vertebrates from a nature reserve in South Africa, and the prevalence of antibody was found to be greatest in large mammals such as rhinoceros, giraffe and buffalo, which are known to be the preferred hosts of the adult tick (Hyalomma) vectors of the virus (Burt et al., 1993).
         5. Camel :
            • Ontology: UMLS:C1081195
            • GenBank Taxonomy No.: 9836
            • Scientific Name: Camelus (NCBI Taxonomy)
            • Description: In Senegal, H. m. rufipes appeared to be the most commonly CCHF-infected tick species as demonstrated by screening ticks collected in the northern Senegal and the Bandia area from small ruminants, camels and cattle (Zeller et al., 1994B). A serosurvey was conducted during 1986-87 to determine evidence of prior Crimean-Congo haemorrhagic fever (CCHF) viral infection among camels imported into Egypt from Sudan and Kenya. Sera obtained from camels arriving at the Aswan quarantine station, southern Egypt, were tested for CCHF antibody. CCHF viral antibody was demonstrated in 14% (600/4301) of the camels. CCHF viral antibody prevalence among camels imported from Sudan was lower (12%) than among camels imported from Kenya (26%). CCHF viral antibody was not demonstrated in 400 sheep and 200 cows of native animals. These data indicate that camels imported from Sudan and Kenya had previous CCHF viral infection, but evidence of transmission to animals of Egypt was not obtained (Morrill et al., 1990).
         6. European hare :
            • Ontology: UMLS:C0242372
            • GenBank Taxonomy No.: 9983
            • Scientific Name: Lepus europaeus (NCBI Taxonomy)
            • Description: Hares are important hosts of ticks in many CCHF foci and probably serve as amplifying hosts of the virus. The isolation of CCHF virus from the blood and livers of 3 tick-infected L. europaeus taken from the Crimea was hailed as the "first direct evidence of the important role of hares in the ecology of the causative agent of CCHF" (Hoogstraal, 1979).
         7. Genet :
            • Ontology: UMLS:C0325074
            • GenBank Taxonomy No.: 94190
            • Scientific Name: Genetta g. senegalensis (NCBI Taxonomy)
            • Description: Medium-sized and small carnivores are mentioned en passant in several faunal descriptions of CCHF foci. During seasons of local tick activity in Eurasia and Africa, these mammals are frequently infested, sometimes by a surprising number of ticks. CCHF virus antibodies were detected in sera of the Common Red Fox, (Vulpes vulpes), and the Pallas' (or Steppe) Cat, (Felis manul), from the Ashkhabad area of Turkmenia, and the Genet, (Genetta g. senegalensis), from Senegal (Hoogstraal, 1979).
         8. Giraffe :
            • Ontology: UMLS:C0325230
            • GenBank Taxonomy No.: 9894
            • Scientific Name: Giraffa camelopardalis (NCBI Taxonomy)
            • Description: Competitive ELISA (CELISA) was applied to the sera of 960 wild vertebrates from a nature reserve in South Africa, and the prevalence of antibody was found to be greatest in large mammals such as rhinoceros, giraffe and buffalo, which are known to be the preferred hosts of the adult tick (Hyalomma) vectors of the virus (Burt et al., 1993).
         9. Goat :
            • Ontology: UMLS:C1510458
            • GenBank Taxonomy No.: 9925
            • Scientific Name: Capra hircus (NCBI Taxonomy)
            • Description: CCHF virus is primarily a zoonosis, which means that the transmission cycle mainly involves ticks and wild or domestic animals. Cattle, sheep and goats do not become ill after infection but are viremic for about 1 week. During this period of time the virus may be transmitted to humans which have close contact to these animals such as agricultural workers, slaughterhouse workers, and veterinarians. Furthermore, the virus may be spread into other geographical regions via infected livestock (Drosten et al., 2003). Antibodies against CCHF virus have been detected in the sera of horses, donkeys, goats, cattle, sheep, and pigs in various regions of Europe, Asia, and Africa (Ergonul, 2006).
         10. Horse; domestic horse; equine :
             • Ontology: UMLS:C0019944
             • GenBank Taxonomy No.: 9796
             • Scientific Name: Equus caballus (NCBI Taxonomy)
             • Description: A seroepidemiological survey to determine the prevalence of Crimean-Congo haemorrhagic fever (CCHF) virus and its circulation among animals in Iraq was carried out in 1980. Sera were collected from 2205 animals of different species in three different faunal areas of the country. Sera were tested by complement fixation test for quantitative determination of antibodies to CCHF virus. Among 769 sheep tested 443 (57.6%) were positive; 279 of 562 (49.64%) goat sera; 122 of 411 (29.28%) cattle sera; 148 of 252 (58.73%) horse sera; 23 of 99 (23.23%) camel sera and 5 of 35 (14.28%) sera collected from unclassified small mammals in Iraq have had antibodies to CCHF virus (Tantawi et al., 1981).
         11. Middle-African hedgehog; four-toed hedgehog :
             • Ontology: UMLS:C0018866
             • GenBank Taxonomy No.: 9368
             • Scientific Name: Atelerix albiventris (NCBI Taxonomy)
             • Description: Ixodes ticks of the species Hyalomma marginatum are widely spread in the semidesert and steppe landscape zones of the Stavropol Territory. The circle of the main hosts for the larvae and nymphs of these ticks includes many species of wild and domestic birds, European brown hare, four-toed and eared hedgehogs (Kotti et al., 2001). The first CCHF isolate from hedgehogs were in Nigeria from the Four-toed Hedgehog, Erinaceus (Atelerix) albiventris, taken in the savanna and from the Jos plateau (Hoogstraal, 1979).
         12. Multimammate rats :
             • Ontology: UMLS:C0024905
             • GenBank Taxonomy No.: 30639
             • Scientific Name: Mastomys (NCBI Taxonomy)
             • Description: CCHF virus has been isolated from domestic and wild vertebrates, including man, cattle, goats, sheep, hares (Lepus europaeus), hedgehogs (Erinaceus (Atelerix) albiventris), and a multimammate mouse (Mastomys spp.) (Watts et al., 1988).
         13. Pallas's Cat :
             • Ontology: UMLS:C0524517
             • GenBank Taxonomy No.: 61408
             • Scientific Name: Otocolobus manul (NCBI Taxonomy)
             • Description: Medium-sized and small carnivores are mentioned en passant in several faunal descriptions of CCHF foci. During seasons of local tick activity in Eurasia and Africa, these mammals are frequently infested, sometimes by a surprising number of ticks. CCHF virus antibodies were detected in sera of the Common Red Fox, (Vulpes vulpes), and the Pallas' (or Steppe) Cat, (Felis manul), from the Ashkhabad area of Turkmenia, and the Genet, (Genetta g. senegalensis), from Senegal (Hoogstraal, 1979).
         14. Pig; wild boar; swine; pigs :
             • Ontology: UMLS:C1135183
             • GenBank Taxonomy No.: 9823
             • Scientific Name: Sus scrofa (NCBI Taxonomy)
             • Description: CCHF virus infected adult Hyalomma asiaticum ticks have been isolated from pigs (Watts et al., 1988). Antibodies against CCHF virus have been detected in the sera of horses, donkeys, goats, cattle, sheep, and pigs in various regions of Europe, Asia, and Africa (Ergonul, 2006).
         15. Red fox; silver fox :
             • Ontology: UMLS:C0325013
             • GenBank Taxonomy No.: 9627
             • Scientific Name: Vulpes vulpes; Vulpes vulpes var (NCBI Taxonomy).
             • Description: Medium-sized and small carnivores are mentioned en passant in several faunal descriptions of CCHF foci. During seasons of local tick activity in Eurasia and Africa, these mammals are frequently infested, sometimes by a surprising number of ticks. CCHF virus antibodies were detected in sera of the Common Red Fox, (Vulpes vulpes), and the Pallas' (or Steppe) Cat, (Felis manul), from the Ashkhabad area of Turkmenia, and the Genet, (Genetta g. senegalensis), from Senegal (Hoogstraal, 1979).
         16. Rhinoceros :
             • Ontology: UMLS:C1265532
             • GenBank Taxonomy No.: 9808
             • Scientific Name: Rhinoceros (NCBI Taxonomy)
             • Description: Competitive ELISA (CELISA) was applied to the sera of 960 wild vertebrates from a nature reserve in South Africa, and the prevalence of antibody was found to be greatest in large mammals such as rhinoceros, giraffe and buffalo, which are known to be the preferred hosts of the adult tick (Hyalomma) vectors of the virus (Burt et al., 1993).
         17. Sheep, domestic sheep, wild sheep, lambs :
             • Ontology: UMLS:C0036945
             • GenBank Taxonomy No.: 9940
             • Scientific Name: Ovis aries (NCBI Taxonomy)
             • Description: Wilson and Gonzalez demonstrated that West African sheep play a central role in the maintenance cycle of CCHF virus in disease-endemic areas because they serve as host for both the virus and the tick vector. These researchers also showed that even sheep that were infected previously and had anti-CCHF virus IgG can be reinfected and transmit the virus (Nabeth et al., 2004). The first indication of CCHF virus in Iran was the finding that 45 of 100 sheep sera that were sent to Moscow from the Teheran abattoir reacted positively for CCHF virus infection. The subsequent seroepidemiological surveys showed the presence of antibodies to the virus in several areas of northern and central Iran (Hoogstraal, 1979).
         18. Bucerotidae :
             • Ontology: UMLS:C1020098
             • GenBank Taxonomy No.: 57380
             • Scientific Name: Bucerotidae (NCBI Taxonomy)
             • Description: The recognition of a bird species, common and widely distributed in Senegal (Tockus erythrorhynchus, Coraciiformes, Bucerotidae), that replicates the virus and infects the immature stages of its current parasite Hyalomma marginatum rufipes in more than 90% of the cases, explains why the minimum infection rate of the adults of this species of tick is always very high (Camicas et al., 1994).
         19. Coraciiformes :
             • Ontology: UMLS:C0326154
             • GenBank Taxonomy No.: 8936
             • Scientific Name: Coraciiformes (NCBI Taxonomy)
             • Description: The recognition of a bird species, common and widely distributed in Senegal (Tockus erythrorhynchus, Coraciiformes, Bucerotidae), that replicates the virus and infects the immature stages of its current parasite Hyalomma marginatum rufipes in more than 90% of the cases, explains why the minimum infection rate of the adults of this species of tick is always very high (Camicas et al., 1994).
         20. Helmeted guineafowl Grey-breasted helmet guinea fowl; common guineafowl :
             • Ontology: UMLS:C0325611
             • GenBank Taxonomy No.: 8996
             • Scientific Name: Numida meleagris (NCBI Taxonomy)
             • Description: Numida meleagris (Grey-breasted helmet guinea fowl) is frequently infested ticks, which are potential vectors of CCHF virus. In Senegal, H. m. rufipes appeared to be the most commonly CCHF-infected tick species. In South Africa, the immature stages were abundant in winter (June/July) and summer (Novemver/December) on guinea fowls (Zeller et al., 1994B).
         21. Ostrich :
             • Ontology: UMLS:C0325336
             • GenBank Taxonomy No.: 8801
             • Scientific Name: Struthio camelus (NCBI Taxonomy)
             • Description: In South Africa, a worker contracted CCHF after slaughtering ostriches on a farm near Oudtshoorn in the Cape province of South Africa. Ostriches from the farm were infected with H. m. rufipes adult ticks (Zeller et al., 1994B). Antibody to CCHF virus was detected in the sera of 22/92 ostriches from farms in Oudtshoorn district, including 6/9 from the farm where the patient worked.` (Shepherd et al., 1987)
         22. Red-billed hornbill; Red-beaked hornbills; Red-billed dwarf hornbill Red-beaked hornbills; Red-billed dwarf hornbill :
             • Ontology: UMLS:C0326200
             • GenBank Taxonomy No.: 81911
             • Scientific Name: Tockus erythrorhynchus (NCBI Taxonomy)
             • Description: The recognition of a bird species, common and widely distributed in Senegal (Tockus erythrorhynchus, Coraciiformes, Bucerotidae), that replicates the virus and infects the immature stages of its current parasite Hyalomma marginatum rufipes in more than 90% of the cases, explains why the minimum infection rate of the adults of this species of tick is always very high (Camicas et al., 1994). CCHF was isolated from H. m. rufipes nymphs collected in Bandia, Senegal in May 1992 on a bird Tockus erythrorhynchus. This bird species was able to replicate CCHF virus without detectable viremia and yet sufficient viremia to infect H. m. rufipes immature ticks (Zeller et al., 1997).
      
      
   2. Infection Process:
      
      No infection process information is currently available here.
      
      
   3. Disease Information:
      
      No disease information is currently available here.
      
      
   4. Prevention:
      
      No prevention information is currently available here.
      
      
   5. Model System:
      
      No model system information is currently available here.
      
      
3. Ticks:
   1. Taxonomy Information:
      1. Species:
         1. Hardbacked ticks, hard ticks, scale ticks :
            • Ontology: UMLS:C0598741
            • GenBank Taxonomy No.: 6939
            • Scientific Name: Ixodidae (NCBI Taxonomy)
            • Description: Among invertebrates, CCHF viral infection has been demonstrated only in ticks, including viral isolations from numerous species/subspecies of seven genera of the family Ixodidae, and two species of the family Argasidae (Watts et al., 1988).
         2. Amblyomma variegatum :
            • Ontology: UMLS:C0323499
            • GenBank Taxonomy No.: 34610
            • Scientific Name: Amblyomma variegatum (NCBI Taxonomy)
            • Description: Amblyomma variegatum and H. m. rufipes ticks were involved in the persistence of the CCHF virus in the Bandia area in Senegal. Infected A. variegatum larvae probably infected goats; the virus also was detected in other abundant tick species present on the animals at the same time (Zeller et al., 1997). Hy. truncatum, the adults of which can readily bite man, ensures the vectorial transmission of CCHF virus to him. In the sudanian zone, Amblyomma variegatum must play the same part as the Hyalomma and Rh. e. evertsi (if vector), and is surely the main vector to man, giving perhaps rise to less virulent strains (non hemorrhagic ones) (Camicas et al., 1994).
         3. Dermacentor marginatus :
            • Ontology: UMLS:C0323437
            • GenBank Taxonomy No.: 49202
            • Scientific Name: Dermacentor marginatus (NCBI Taxonomy)
            • Description: The parasitological data and the results of the virological and serological investigations of materials, collected in nature and in the course of study of the immune structure of the population, are indicative of the circulation of CHF virus in the Crimea and the possibility of human infection. Data on spontaneous infection of four species of Ixodes ticks with CHF virus have been confirmed, including the data, obtained for the first time for this region, on the participation of Dermacentor marginatus in this process (Markeshin et al., 1992).
         4. Dermacentor niveus :
            • Scientific Name: Dermacentor niveus (Onishchenko et al., 2005A)
            • Description: The main vector of CCHF virus in Central Asia were ticks of the genus Hyalomma, and in Kazakhstan the vectors of this virus also included ticks Dermatocentor niveus (Onishchenko et al., 2005A). Dermacentor niveus ticks are infection carriers in Kazakhstan (Onishchenko et al., 2005B).
         5. Hyalomma anatolicum :
            • Ontology: UMLS:C0323487
            • GenBank Taxonomy No.: 176092
            • Scientific Name: Hyalomma anatolicum (NCBI Taxonomy)
            • Description: Different tick species were found to be involved in the epidemic process: Hyalomma asiaticum, Dermatocentor niveus (Kazakhstan) and Hyalomma anatolicum (Tajikistan). The main vector of CCHF virus in Central Asia were ticks of the genus Hyalomma, and in Kazakhstan the vectors of this virus also included ticks Dermatocentor niveus (Onishchenko et al., 2005A).
         6. Hyalomma asiaticum :
            • Ontology: UMLS:C0323484
            • GenBank Taxonomy No.: 266040
            • Scientific Name: Hyalomma asiaticum (NCBI Taxonomy)
            • Description: Different species of ticks were found, in the territories of Kazakhstan and Tajikistan, to be infected with the virus of Crimean-Congo hemorrhagic fever (CCHF). The tick species below were found to be involved in the epidemic process: Hyalomma asiaticum, Dermacentor niveus (Kazakhastan) and Hyalomma anatolicum (Tajikistan) (Onishchenko et al., 2005B).
         7. Hyalomma marginatum :
            • Ontology: UMLS:C0323483
            • GenBank Taxonomy No.: 34627
            • Scientific Name: Hyalomma marginatum (NCBI Taxonomy)
            • Description: Hyalomma ticks are the main carrier of the CCHF virus in the Middle Asia (Onishchenko et al., 2005B). From studies in Russia, in the Middle East, and in Africa, it appears that Hyalomma marginatum is the most important transmitter of the infection to man. Isolations of the virus have been made from unfed H. marginatum taken in the spring in the Crimea and in other parts of Russia, indicating there is a biological relationship between tick and the virus which allows it to survive from one season to the next indefinitely (Gear, 1988).
         8. Hyalomma marginatum rufipes :
            • Ontology: UMLS:C0323486
            • GenBank Taxonomy No.: 72862
            • Scientific Name: Hyalomma marginatum rufipes (NCBI Taxonomy)
            • Description: The ticks taken from northward-migratory birds in Egypt were almost all Hyalomma marginatum rufipes, the form from which strains of Congo virus infection have been isolated in Senegal and Nigeria and which are suspected to be the main transmitters of the infection in South Africa. Wherever and whenever Congo virus infection has become epidemic, Hyalomma species have been the ticks chiefly involved (Gear, 1988). The implication of Rhipicephalus evertsi evertsi in the viral ecology and/or a high efficiency of the transovarial transmission of the virus in Hy. m. rufipes would help to explain the maintenance of the endemy in the sahelian area (Camicas et al., 1994).
         9. Hyalomma truncatum :
            • Ontology: UMLS:C0323480
            • GenBank Taxonomy No.: 72855
            • Scientific Name: Hyalomma truncatum (NCBI Taxonomy)
            • Description: Hy. truncatum appeared to be the primary mode of human infection by CCHF virus (Zeller et al., 1997). Several specific, non-identified factors seem to favour CCHFV replication in H. truncatum. Long-term virus persistence seems to occur in CCHFV-infected adult ticks (Gonzalez et al., 1991). Hy. truncatum, the adults of which can readily bite man, ensures the vectorial transmission to him (Camicas et al., 1994).
         10. Rhipicephalus guilhoni :
             • Scientific Name: Rhipicephalus guilhoni (Watts et al., 1988)
             • Description: The red-beaked hornbill, glossy starlings, and the grey-breasted helmet guinea fowl are frequently infested by ticks: H. m. rufipes (larvae and nymphs), A. variegatum) and occasionally H. truncatum or Rhipicephalus guilhoni, all of which are potential vectors of CCHF virus (Zeller et al., 1994B).
         11. Rhipicephalus evertsi :
             • Ontology: UMLS:C0323468
             • GenBank Taxonomy No.: 60190
             • Scientific Name: Rhipicephalus evertsi (NCBI Taxonomy)
             • Description: Hy. truncatum, the adults of which can readily bite man, ensures the vectorial transmission to him. In the sudanian zone, Amblyomma variegatum must play the same part as the Hyalomma and Rh. e. evertsi (if vector), and is surely the main vector to man, giving perhaps rise to less virulent strains (non hemorrhagic ones). In the sahelian zone, Hy. marginatum rufipes must play the leading part, together with Rh. e. evertsi if vector, for the maintenance of the endemy. ) (Camicas et al., 1994).
         12. Softbacked ticks, soft ticks :
             • Ontology: UMLS:C0323528
             • GenBank Taxonomy No.: 6936
             • Scientific Name: Argasidae (NCBI Taxonomy)
             • Description: CCHF viral infection has been demonstrated only in ticks, including viral isolations from two species of the family Argasidae (Watts et al., 1988).
      
      
   2. Infection Process:
      
      No infection process information is currently available here.
      
      
   3. Disease Information:
      
      No disease information is currently available here.
      
      
   4. Prevention:
      
      No prevention information is currently available here.
      
      
   5. Model System:
      
      No model system information is currently available here.
      
      

IV. Labwork Information

A. Biosafety Information:

1. General biosafety information :
   • Biosafety Level: Virus isolation must only be attempted in Biosafety Level 4 facilities, such as are available at CDC (MMWR, 1988).
   • Applicable: The highly lethal nature of the virus has restricted research to BSL-4 laboratories and has consequently had limited research investigations (Whitehouse, 2004).
   • Precautions:
     • The patient should be isolated in a single room with an adjoining anteroom serving as its only entrance. The anteroom should contain supplies for routine patient care, as well as gloves, gowns, and masks for the staff. The Appendix lists suggested supplies for the anteroom. Hand-washing facilities should be available in the anteroom, as well as containers of decontaminating solutions. If possible, the patient's room should be at negative air pressure compared with the anteroom and the outside hall, and the air should not be recirculated. However, this is not absolutely required, and does not constitute a reason to transfer the patient. If a room such as described is not available, use adjacent rooms to provide safe and adequate space. Strict barrier-nursing techniques should be enforced: all persons entering the patient's room should wear disposable gloves, gowns, masks, and shoe covers. Protective eye wear should be worn by persons dealing with disoriented or uncooperative patients or performing procedures that might involve the patient's vomiting or bleeding (for example, inserting a nasogastric tube or an intravenous or arterial line). Protective clothing should be donned and removed in the anteroom. Only essential medical and nursing personnel should enter the patient's room and anteroom. Isolation signs listing necessary precautions should be posted outside the anteroom. Lipid-containing viruses, including the enveloped viruses, are among the most readily inactivated of all viral agents. Suitable disinfectant solutions include 0.5% sodium hypochlorite (10% aqueous solution of household bleach), as well as fresh, correctly prepared solutions of glutaraldehyde (2% or as recommended by the manufacturer) and phenolic disinfectants (0.5%-3%). Soaps and detergents can also inactivate these viruses and should be used liberally. Laboratory personnel accidentally exposed to potentially-infected material (for example, through injections or cuts or abrasions on the hands) should immediately wash the infected part, apply a disinfectant solution such as hypochlorite solution, and notify the patient's physician. The person should then be considered as a high-risk contact and placed under surveillance. Accidental spills of potentially contaminated material should be liberally covered with disinfectant solution, left to soak for 30 minutes, and wiped up with absorbent material soaked in disinfectant (MMWR, 1988).
   • Disposal:
     • The patient should use a chemical toilet. All secretions, excretions, and other body fluids (other than laboratory specimens) should be treated with disinfectant solution. All material used for patients, such as disposable linen and pajamas, should be double-bagged in airtight bags. The outside bags should be sponged with disinfectant solution and later incinerated or autoclaved. Disposable items worn by staff, such as gowns, gloves, etc., should be similarly treated. Disposable items used in patient care (suction catheters, dressings, etc.) should be placed in a rigid plastic container of disinfectant solution. The outside of the container should be sponged with disinfectant, and the container should be autoclaved, incinerated, or otherwise safely discarded. All unnecessary handling of the body, including embalming, should be avoided. Persons who dispose of the corpse must take the same precautions outlined for medical and laboratory staff. The corpse should be placed in an airtight bag and cremated or buried immediately. Disposable items, such as pipette tips, specimen containers, swabs, etc., should be placed in a container filled with disinfectant solution and incinerated. Clothes and blankets that were used by the patient should be washed in a disinfectant, such as hypochlorite solution. Nondisposable items such as endoscopes used in patient care must be cleaned with decontaminating fluids (for example, gluteraldehyde or hypochlorite). Laboratory equipment must be treated similarly. All non- disposable materials that withstand autoclaving should be autoclaved, after they have been soaked in disinfectant solution. The patient's bed and other exposed surfaces in the hospital room, or in vehicles used to transport the patient, should be decontaminated with disinfectant solution (MMWR, 1988).

B. Culturing Information:

1. Cell culture :
   1. Description: Virus was grown in Vero E6 cells in BSL-3 laboratory. On the 5th day after cell inoculation, CCHFV was detected in cells by immunofluorescence assay with hyperimmune mouse ascitic fluid against CCHFV (Duh et al., 2006). Although cell cultures were less sensitive for the isolation of virus from clinical specimens, they produced diagnostic results much more rapidly than mouse inoculation test (Shepherd et al., 1986).
      
      
   2. Medium:
      1. Eagle minimum essential amino acid medium with Hank's sal solutions (HMEM) supplemented with 10% fetal bovine serum and antibiotics (Shepherd et al., 1986).
   3. Note: Plaques were formed in CER cells by all four of the CCHF virus strains used. The plaques were usually visible by microscopy after 3 days of incubation and could be read and enumerated by the naked eye 24 h later, after application of the staining overlay. We failed to obtain reproducible results with E6 cells. When present, plaques in these cells were small and indistinct, requiring incubation periods of 6 to 7 days. However, E6 cells were of approximately equal sensitivity to CER cells when virus was titrated in fluorescence focus assays. For specimens from 26 Crimean-Congo hemorrhagic fever patients in South Africa, virus was isolated from 20 by mouse inoculation and from only 11 by cell culturing. Although cell cultures were less sensitive for the isolation of virus from clinical specimens, they produced diagnostic results much more rapidly (Shepherd et al., 1986). Diagnosis by viral cultivation and identification for the VHF-causing agents requires 3 to 10 days for most (longer for the hantaviruses); and, with the exception of dengue, specialized microbiologic containment is required for safe handling of these viruses (Jahrling, 1997).
2. Continuous cell culture :
   1. Description: Adaptation of the Crimean-Congo hemorrhagic fever (CCHF) virus to continuous culturing in Vero-E6 cells was studied by coculturing of infected and intact cells. Adapted strain Hoja-A exerted a complete cytocidal effect and was characterized by a high level of virus accumulation in the early period of the infection. The resultant strain survived through more than 80 passages and retained the newly acquired properties; lyophilized, it can be stored for a long time. Availability of such a strain opens new vistas in studies of the CCHF agent (Smirnova et al., 1997).
      
      
   2. Note: Diagnosis by viral cultivation and identification for the VHF-causing agents requires 3 to 10 days for most (longer for the hantaviruses); and, with the exception of dengue, specialized microbiologic containment is required for safe handling of these viruses (Jahrling, 1997).

C. Diagnostic Tests :

1. Organism Detection Tests:
   1. Microscopy:
      1. Ontology: UMLS:C0026019
      2. Time to Perform: unknown
      3. Description: When the identity of a VHF agent is totally unknown, isolation in cell culture and direct visualization by electron microscopy, followed by immunological identification by immunohistochemical techniques is often successful (Jahrling, 1997).
   
   
2. Immunoassay Tests:
   1. Enzyme-Linked Immunosorbent Assay (ELISA) (Qing et al., 2003):
      1. Ontology: UMLS:C0014441
      2. Time to Perform: 1-hour-to-1-day
      3. Description: The recombinant nucleoprotein-based Crimean-Congo hemorrhagic fever virus antibody detection systems for sheep sera were developed by enzyme-linked immunosorbent assay (ELISA) and an indirect immunofluorescence assay techniques. The samples used for evaluation were 80 sera collected from sheep in a Crimean-Congo hemorrhagic fever-endemic area (western part of the Xinjiang Uygur Autonomous Region) and 39 sera collected from sheep in a disease-free region (Shandong province, eastern China). The ELISA and indirect immunofluorescence assay using recombinant nucleoprotein of the virus proved to have high sensitivity and specificity for detecting the immunoglobulin G antibodies to the virus in sheep sera. The sensitivity and specificity of the recombinant nucleoprotein-based indirect immunofluorescence assay were calculated as 94 and 97%, respectively (Qing et al., 2003). Utilization of direct and indirect enzyme-linked immunosorbent assay (ELISA) and solid-phase radioimmunoassay (SPRIA) for the diagnosis of Crimean-Congo hemorrhagic fever (CCHF) allows the detection of low amounts of infectious virus (2 log LD50) or inactivated antigen and antibody to CCHF within 5-6 hours. These methods were shown to be more sensitive, specific, rapid, and reproducible than the complement-fixation test, immunofluorescence, hemagglutination, or radial diffusion in gel. The experimental design of ELISA and SPRIA developed for CCHF may be used successfully for the detection of the other members of the Bunyaviridae family (Donets et al., 1982).
   2. Indirect immunofluorescence assay:
      1. Ontology: UMLS:C0282647
      2. Time to Perform: unknown
      3. Description: Indirect immunofluorescent assay was used for the detection of specific CCHF antibodies. Sera were tested in twofold dilutions (initial dilution 1:8) with fluorescein-labeled goat IgG and IgM anti-human immunoglobulin on spot slides containing Vero E6 cells (ATCC CRL 1586), with approximately 50% of the cells infected with the 10200 IbAr strain of the prototype CCHF virus. Titers were recorded as the greatest dilution of serum at which characteristic cytoplasmic immunofluorescence was detected (Papa et al., 2002B).
      4. False Negative: Specific IgG and IgM antibodies to CCHF virus were detected in all patients except patient 3. Although no specific antibodies were detectable in this patient (the 9-year-old boy), the diagnosis was established on the basis of the clinically compatible syndrome and the fact that CCHF was confirmed by serological and/or molecular methods in members of his family (cases 4 and 5) who were taking care of him and came in close contact with him (Papa et al., 2002B).
   3. ELISA and Reversed Passive Hemagglutination (RPHA) Test:
      1. Time to Perform: unknown
      2. Description: Enzyme-linked immunosorbent assay (ELISA) and a reversed passive hemagglutination (RPHA) test were evaluated for rapid detection of Crimean-Congo hemorrhagic fever (CCHF) virus antigens. Both RPHA and ELISA detected CCHF antigen in the brains of infant mice 2 to 3 days after infection, several days before the animals sickened and died. Antigen was also detected after 1 to 2 days in infected cell culture extracts and after 2 to 4 days in culture supernatant fluids. Both tests detected CCHF antigen at threshold values of approximately 2.5 log10 tissue culture infective doses per ml and were more sensitive than complement fixation, immunodiffusion, or immunofluorescence. In a comparative study on specimens from CCHF patients, virus was isolated from 38 of 49 sera and 23 of 28 patients. Antigen was detected in 20 of 49 sera (15 of 28 patients) by RPHA and in 29 of 49 sera (18 of 28 patients) by ELISA. Antigenemia was detected more frequently in fatal cases (9 of 11) than in nonfatal cases (9 of 17). Although the antigen detection assays offered a more rapid approach than infectivity assays for diagnosing CCHF, the latter test was more sensitive. The results suggest that RPHA and ELISA may be of use in rapid diagnosis of CCHF infection, particularly in severe cases, in which the danger of nosocomial spread is greatest (Shepherd et al., 1988). IgG and IgM antibodies became demonstrable by indirect immunofluorescence on days 7 to 9 of illness in 35 survivors of Crimean-Congo hemorrhagic fever. Maximum titers of antibody were usually attained in the second to third week of illness. Titers of IgM declined gradually thereafter and were low or negative by the fourth month. In some patients titers of IgG increased markedly between 2 and 4 months after onset of illness and remained readily demonstrable by indirect immunofluorescence 3 years after infection. Endogenous antibody response was demonstrated in only two of 15 patients who died of infection. Techniques for demonstrating antibody were (in order of decreasing sensitivity) enzyme-linked immunosorbent assay, reversed passive hemagglutination-inhibition, indirect immunofluorescence, fluorescent-focus reduction, complement-fixation, and immunodiffusion. Most patients developed relatively low levels of neutralizing antibodies (range, 1:8 to 1:32 by fluorescent-focus reduction tests), but some developed titers of 1:256 to 1:512. Plasma intended for therapeutic use should be selected on the basis of its neutralizing ability (Shepherd et al., 1989).
      3. False Negative: Antigen was detected in 20 of 49 sera (15 of 28 patients) by RPHA and in 29 of 49 sera (18 of 28 patients) by ELISA (Shepherd et al., 1988).
   4. Recombinant Nucleoprotein-Based Enzyme-Linked Immunosorbent Assay:
      1. Time to Perform: unknown
      2. Description: The full-length nucleoprotein of Crimean-Congo hemorrhagic fever virus (CCHFV; 482 amino acid residues) was expressed as a His-tagged recombinant protein (His-CCHFV rNP) in the baculovirus system. The His-CCHFV rNP was efficiently expressed in insect cells and purified by Ni2+ column chromatography. Using this substrate, an immunoglobulin G (IgG) enzyme-linked immunosorbent assay (ELISA) was developed. We evaluated the sensitivity and specificity of the IgG ELISA, using serum samples previously determined to be antibody positive or negative by immunofluorescence tests on CCHFV-infected Vero E6 cells. We found very good correlation between the two tests: 87% for the positive sera (13 of 15) and 99% for the negative sera (107 of 108). These results indicate that the new IgG ELISA using His-CCHFV rNP has high sensitivity and specificity for detecting CCHFV antibodies. The CCHF patients' sera with high titers reacted only with the NP fragment containing amino acid residues between 201 and 306 in Western blotting. It is known that amino acid homologies are high in this region among various isolates. Thus, it is expected that this ELISA can detect antibodies not only for Chinese strains of CCHFV but also for other strains circulating in the world. These results suggest that the IgG ELISA system developed with the recombinant CCHFV NP is a valuable tool for diagnosis and epidemiological investigations of CCHFV infections (Saijo et al., 2002).
   5. Enzyme-Linked Immunosorbent Assay (ELISA):
      1. Ontology: UMLS:C0014441
      2. Time to Perform: unknown
      3. Description: An enzyme-linked immunosorbent assay (ELISA) was developed to detect Crimean-Congo hemorrhagic fever (CCHF) virus-specific immunoglobulin M (IgM) in human serum samples. For this test, a heat-inactivated antigen was prepared from the brains of suckling mice infected with CCHF virus. The IgM-capture ELISA proved more sensitive than indirect fluorescence tests for IgM to this virus. A human serum containing high-titer IgM to CCHF virus was used for an antigen-capture ELISA to detect this virus in heat-inactivated suspensions of virus-infected ticks. The antigen-capture ELISA appeared to be as sensitive as virus isolation in suckling mice. The studies described suggest that the IgM-capture ELISA and the antigen-detection ELISA should provide a rapid and sensitive diagnosis of human CCHF virus infection (Saluzzo and Le Guenno, 1987).
   
   
3. Nucleic Acid Detection Tests: :
   1. One-step RT-PCR with real-time SybrGreen detection:
      1. Time to Perform: 1-hour-to-1-day
      2. Description: Viral hemorrhagic fevers (VHFs) are acute infections with high case fatality rates. Important VHF agents are Ebola and Marburg viruses (MBGV/EBOV), Lassa virus (LASV), Crimean-Congo hemorrhagic fever virus (CCHFV), Rift Valley fever virus (RVFV), dengue virus (DENV), and yellow fever virus (YFV). VHFs are clinically difficult to diagnose and to distinguish; a rapid and reliable laboratory diagnosis is required in suspected cases. Drosten and coworkers have established six one-step, real-time reverse transcription PCR assays for Viral hemorrhagic fevers (VHFs) based on the Superscript reverse transcriptase-Platinum Taq polymerase enzyme mixture. Novel primers and/or 5'-nuclease detection probes were designed for RVFV, DENV, YFV, and CCHFV by using the latest DNA database entries. PCR products were detected in real time on a LightCycler instrument by using 5'-nuclease technology (RVFV, DENV, and YFV) or SybrGreen dye intercalation (MBGV/EBOV, LASV, and CCHFV). The inhibitory effect of SybrGreen on reverse transcription was overcome by initial immobilization of the dye in the reaction capillaries. Universal cycling conditions for SybrGreen and 5'-nuclease probe detection were established. Thus, up to three assays could be performed in parallel, facilitating rapid testing for several pathogens. All assays were thoroughly optimized and validated in terms of analytical sensitivity by using in vitro-transcribed RNA. The 95% detection limits as determined by probit regression analysis ranged from 1,545 to 2,835 viral genome equivalents/ml of serum (8.6 to 16 RNA copies per assay). The suitability of the assays was exemplified by detection and quantification of viral RNA in serum samples of VHF patients (Drosten et al., 2002). There are presently no data available on viral RNA concentrations in patients with VHF. Using the established assays, we have analyzed a few sera of patients with VHF. The RNA concentrations in all patients were orders of magnitudes above the detection limits, suggesting that the assays are sufficiently sensitive to diagnose VHF during the acute febrile phase. To define the clinical sensitivity of the assays more precisely would require testing of well-characterized serum panels from patients with different courses of VHF and in different stages of the disease. However, such panels are not available. The possibility of quantifying viral RNA may prove to be useful in therapy monitoring and to estimate the prognosis (Drosten et al., 2002).
      3. Primers:
         • CCS, CCAs
           • Forward: CCS (ATGCAGGAACCATTAARTCTTGGGA [351-375])
           • Reverse: CCAs (CTAAT CATATCTGACAACATTTC plus CTAATCATGTCTGACAGCATCTC, 1:1 [579-557])
           • Real-time-probe: Sybrgreen I
   2. Reverse Transcription Polymerase Chain Reaction (RT PCR):
      1. Ontology: UMLS:C0814037
      2. Time to Perform: 1-hour-to-1-day
      3. Description: A reverse transcription polymerase chain reaction (RT PCR) was applied retrospectively to 80 stored serum samples from 45 confirmed Crimean Congo haemorrhagic fever (CCHF) patients in southern Africa, and it was found that viral RNA could be detected in a proportion of samples up to day 16 of illness. Early in the disease there is relatively good correlation between the results obtained by RT PCR and virus isolation, but after the first week it appears that infective virus is progressively cleared from serum while nucleic acid remains demonstrable in a proportion of patients well into convalescence. A further 47 serum samples from 38 patients with suspected viral haemorrhagic fever, 19 of whom proved to be cases of CCHF, were tested prospectively on being received at the laboratory. The combined use of RT PCR with ethidium bromide stained gels for the detection of viral RNA, plus indirect immunofluorescence for the detection of IgG and IgM antibodies to CCHF virus, permitted a presumptive diagnosis to be reported within 8 h of receiving the first specimen from 18/19 cases of the disease studied prospectively. The nineteenth case was confirmed within 48 h when antibody response was demonstrated in a second serum sample. Viral nucleic acid was not detected in serum samples from 19 patients in whom alternative diagnoses were established (Burt et al., 1998).
      4. Primers:
         • F2, R3
           • Forward: F2: 5' TGG ACA CCT TCA CAA ACT C 3' The forward DNA primer, designated F2, is complementary to viral RNA between nucleotide positions 135 and 153 relative to the positive sense strand of CCHF virus reference strain 10200 (Burt et al., 1998).
           • Reverse: R3: 5' GAC AAA TTC CCT GCA CCA 3' The reverse primer, is complementary to the message sense between nucleotide positions 670 and 653 (Burt et al., 1998).
           • Product
             • Size: 536 bp
      5. False Positive: Taking into account only the first serum sample received from each of the 19 CCHF patients, 12 were found to be positive by RT PCR on ethidium bromide stained gels, and all of these 12 yielded virus in culture while 8/12 also had IgM antibody activity, indicative of current or recent infection. A further six sera were negative in RT PCR tests and lacked infective virus, but had IgM antibody activity. The remaining serum sample was negative in RT PCR tests and lacked demonstrable antibody, but yielded virus in culture (Burt et al., 1998).
   3. One-step Real-Time RT-PCR Assay:
      1. Time to Perform: 1-hour-to-1-day
      2. Description: The development of real-time RT-PCR assay for the detection of Crimean-Congo hemorrhagic fever virus (CCHFV) has been hampered by a virus strain variation. The development of a one-step real-time RT-PCR assay for the detection of CCHFV is described. The technique is based on the fluorescence resonance energy transfer probe technology employing the endonuclease activity of Taq polymerase enzyme. The assay was designed to detect specifically the strains from a phylogenetic cluster of CCHFV which encompasses the known CCHFV strains circulating in the Balkan region. The detection system was tested using CCHFV strain Kosovo Hoti, clinical serum samples and ticks. The real-time assay described is rapid, specific and sensitive. Since the Balkan peninsula is also an endemic region for hemorrhagic fever with renal syndrome (HFRS), this method is suggested as convenient for early differential diagnosis of suspected viral hemorrhagic fever patients (Duh et al., 2006).
      3. Primers:
         • CCHF L1, CCHF D1
           • Forward: CCHF L1: 5'-GCTTGGGTCAGCTCTACTGG-3' [nt position at the Drosdov strain: 294-313]
           • Reverse: CCHF D1: 5'-TGCATTGACACGGAAACCTA-3' [nt: 463-482]
           • Real-time-probe: probe CCHF S1: 5' AGAAGGGGCTTGAGTGGTT [nt: 322-340] The primers and probe were designed based on the alignment of S segment of the Kosovo Hoti and Drosdov strain of CCHFV (Accession No. U88412), which are phylogenetically most closely related. The 5'-nuclease probe was conjugated with fluorophore FAM on 5' end and quencher molecule DABCYL on 3' end of the probe sequence (Duh et al., 2006).
   4. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR):
      1. Ontology: UMLS:C0814037
      2. Time to Perform: 1-hour-to-1-day
      3. Description: Genomic RNA of Crimean-Congo hemorrhagic virus (C-CHFV) was detected by a newly developed, nested reverse transcriptase polymerase chain reaction (RT-PCR) in the sera of four (25.0%) of 16 suspected cases of viral hemorrhagic fever. The RT-PCR was based on oligonucleotide primers deducted from the small RNA segment encoding the nucleoprotein of the virus. By comparison with a nucleotide sequence of a C-CHFV isolate from a Chinese sheep, a divergence of 10.0-11.8% was detected in the C-CHFV variants causing the UAE outbreak. In the four positive sera, three phylogenetically distinct C-CHFV variants were amplified and confirmed by direct sequencing of the PCR fragments. These C-CHFV sequences were obtained directly from sera of infected humans without prior propagation in cell culture. The RT-PCR allows rapid detection of genomic C-CHFV RNA in clinical specimens and study of the molecular epidemiology of this infection (Schwarz et al., 1996).
      4. Primers:
         • F2, R2
           • Forward: F2: 5'-TGG ACA CCT TCA CAA ACT A-3' [135-153]
           • Reverse: R2: 5'-GAC ATC ACA ATT TCA CCA GG-3' [549-530]
           • Product
             • Size: 260 bp
         • Nested primers: F3, R3
           • Forward: F3: 5'-GAA TGT GCA TGG GTT AGC TC-3' [290-309]
           • Reverse: R3: 5'-GAC AAA TTC CCT GCA CCA-3' [670-653]
           • Product
             • Size: 220 bp
   5. One-step Real-Time Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR):
      1. Time to Perform: 1-hour-to-1-day
      2. Description: The development of a new TaqMan-based one-step real-time reverse transcriptase-polymerase chain reaction (RT-PCR) assay for detection and quantification of Crimean-Congo hemorrhagic fever virus (CCHFV) RNA is described. Selected oligos targeting the highly conserved S region of CCHFV were designed by using our oligo design and analysis software, Oligoware 1.0. None of the primer sequences showed genomic cross-reactivity with other viruses or cells in a BLAST (NCBI) search analysis. The sensitivity and specificity of the primers and the probe were tested using 18 serum samples from patients from East Anatolian who were suspected of having CCHFV, including 2 samples that had already been confirmed to be positive for CCHFV. Among the 16 previously unconfirmed samples, 5 were positive by TaqMan-based one-step real-time RT-PCR and 1 was positive by non-nested RT-PCR, and these results were confirmed with DNA sequencing analysis. The 2 previously confirmed CCHFV RNA samples were also positive by both TaqMan-based one-step real-time RT-PCR and non-nested RT-PCR tests. To ensure the quantitative reproducibility of TaqMan-based one-step real-time RT-PCR, the procedure was repeated several times and the same results were obtained (SD = 0.84 [maximum value]). The developed assay was able to sensitively quantify the concentration of CCHFV RNA, which ranged from 10(2) to 10(7) copies/ml per reaction, using plasmid standards generated from the CCHFV RNA (correlation coefficiency = 0.989). The results of the one-step real-time RT-PCR assay were more sensitive than those of the non-nested RT-PCR assay. It can be concluded that our one-step real-time RT-PCR assay is a reliable, reproducible, specific, sensitive and simple tool for the detection and quantification of CCHFV (Yapar et al., 2005).
      3. Primers:
         • CCReal P1, CCReal P2
           • Forward: CCReal P1: 5'-TCTTYGCHGATGAYTCHTTYC-3'
           • Reverse: CCReal P2: 5'-GGGATKGTYCCRAAGCA-3'
           • Real-time-probe: 5'-FAMACASRATCTAYATGCAYCCTGCTAMRA-3' FAM and TAMRA are fluorescent labels in the probe. The TaqMan probe was labeled with 6-carboxyfluorescein at the 5' end (FAM) as a reporter and 6-carboxy-N,N,N',N'-tetramethylrhodamine at the 3' end (TAMRA) as a quencher
           • Product
             • Size: 103 bp
   
   
4. Other Types of Diagnostic Tests:
   
   No other tests available here.
   
   

V. References

A. Journal References:

Altaf et al., 1998: Altaf A, Luby S, Ahmed AJ, Zaidi N, Khan AJ, Mirza S, McCormick J, Fisher-Hoch S. Outbreak of Crimean-Congo haemorrhagic fever in Quetta, Pakistan: contact tracing and risk assessment. Trop Med Int Health. 1998; 3(11): 878 - 882. [PubMed: 9855399].

Bakir et al., 2005: Bakir M, Ugurlu M, Dokuzoguz B, Bodur H, Tasyaran MA, Vahaboglu H. Crimean-Congo haemorrhagic fever outbreak in Middle Anatolia: a multicentre study of clinical features and outcome measures. J Med Microbiol. 2005; 54(Pt 4): 385 - 389. [PubMed: 15770025].

Bossi et al., 2004: Bossi P, Tegnell A, Baka A, Van Loock F, Hendriks J, Werner A, Maidhof H, Gouvras G. Task Force on Biological and Chemical Agent Threats, Public Health Directorate, European Commission, Luxembourg. Bichat guidelines for the clinical management of haemorrhagic fever viruses and bioterrorism-related haemorrhagic fever viruses. Euro Surveill. 2004; 9(12): E11 - E12. [PubMed: 15677844].

Burt and Swanepoel, 2005: Burt FJ, Swanepoel R. Molecular epidemiology of African and Asian Crimean-Congo haemorrhagic fever isolates. Epidemiol Infect. 2005; 133(4): 659 - 666. [PubMed: 16050511].

Burt et al., 1993: Burt FJ, Swanepoel R, Braack LE. Enzyme-linked immunosorbent assays for the detection of antibody to Crimean-Congo haemorrhagic fever virus in the sera of livestock and wild vertebrates. Epidemiol Infect. 1993; 111(3): 547 - 557. [PubMed: 8270014].

Burt et al., 1998: Burt FJ, Leman PA, Smith JF, Swanepoel R. The use of a reverse transcription-polymerase chain reaction for the detection of viral nucleic acid in the diagnosis of Crimean-Congo haemorrhagic fever. J Virol Methods. 1998; 70(2): 129 - 137. [PubMed: 9562407].

Camicas et al., 1994: Camicas JL, Cornet JP, Gonzalez JP, Wilson ML, Adam F, Zeller HG. Crimean-Congo hemorrhagic fever in Senegal. Latest data on the ecology of the CCHF virus. Bull Soc Pathol Exot. 1994; 87(1): 11 - 16. [PubMed: 8003897].

Chamberlain et al., 2005: Chamberlain J, Cook N, Lloyd G, Mioulet V, Tolley H, Hewson R. Co-evolutionary patterns of variation in small and large RNA segments of Crimean-Congo hemorrhagic fever virus. J Gen Virol. 2005; 86(Pt 12): 3337 - 3341. [PubMed: 16298979].

Donets et al., 1982: Donets MA, Rezapkin GV, Ivanov AP, Tkachenko EA. Immunosorbent assays for diagnosis of Crimean-Congo hemorrhagic fever (CCHF). Am J Trop Med Hyg. 1982; 31(1): 156 - 162. [PubMed: 6800272].

Drosten et al., 2002: Drosten C, Gottig S, Schilling S, Asper M, Panning M, Schmitz H, Gunther S. Rapid detection and quantification of RNA of Ebola and Marburg viruses, Lassa virus, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, dengue virus, and yellow fever virus by real-time reverse transcription-PCR. J Clin Microbiol. 2002; 40(7): 2323 - 2330. [PubMed: 12089242].

Drosten et al., 2003: Drosten C, Kummerer BM, Schmitz H, Gunther S. Molecular diagnostics of viral hemorrhagic fevers. Antiviral Res. 2003; 57(1-2): 61 - 87. [PubMed: 12615304].

Duh et al., 2006: Duh D, Saksida A, Petrovec M, Dedushaj I, Avsic-Zupanc T. Novel one-step real-time RT-PCR assay for rapid and specific diagnosis of Crimean-Congo hemorrhagic fever encountered in the Balkans. J Virol Methods. 2006; 133(2): 175 - 179. [PubMed: 16343650].

Dunster et al., 2002: Dunster L, Dunster M, Ofula V, Beti D, Kazooba-Voskamp F, Burt F, Swanepoel R, DeCock KM. First documentation of human Crimean-Congo hemorrhagic fever, Kenya. Emerg Infect Dis. 2002; 8(9): 1005 - 1006. [PubMed: 12194785].

Ergonul, 2006: Ergonul O. Crimean-Congo haemorrhagic fever. Lancet Infect Dis. 2006; 6(4): 203 - 214. [PubMed: 16554245].

[European Surveillance]: Euro Surveillance Increase in cases of Crimean-Congo haemorrhagic fever, Turkey, 2006. Euro Surveill. 2006; 11(7): E060720.2 - E060720.2. [PubMed: 16966763].

Fisher-Hoch et al., 1992: Fisher-Hoch SP, McCormick JB, Swanepoel R, Van Middlekoop A, Harvey S, Kustner HG. Risk of human infections with Crimean-Congo hemorrhagic fever virus in a South African rural community. Am J Trop Med Hyg. 1992; 47(3): 337 - 345. [PubMed: 1524147].

Fisher-Hoch et al., 1995: Fisher-Hoch SP, Khan JA, Rehman S, Mirza S, Khurshid M, McCormick JB. Crimean Congo-haemorrhagic fever treated with oral ribavirin. Lancet. 1995; 346(8973): 472 - 475. [PubMed: 7637481].

Flick et al., 2005: Flick R, Whitehouse CA. Crimean-Congo hemorrhagic fever virus. Curr Mol Med. 2005; 5(8): 753 - 760. [PubMed: 16375710].

Franz et al., 1997: Franz DR, Jahrling PB, Friedlander AM, McClain DJ, Hoover DL, Bryne WR, Pavlin JA, Christopher GW, Eitzen EM Jr. Clinical recognition and management of patients exposed to biological warfare agents. JAMA. 1997; 278(5): 399 - 411. [PubMed: 9244332].

Geisbert and Jahrling, 2004: Geisbert TW, Jahrling PB. Exotic emerging viral diseases: progress and challenges. Nat Med. 2004; 10((12 Suppl)): S110 - S121. [PubMed: 15577929].

Gonzalez et al., 1991: Gonzalez JP, Cornet JP, Wilson ML, Camicas JL. Crimean-Congo haemorrhagic fever virus replication in adult Hyalomma truncatum and Amblyomma variegatum ticks. Res Virol. 1991; 142(6): 483 - 488. [PubMed: 1803413].

Gordon et al., 1993: Gordon SW, Linthicum KJ, Moulton JR. Transmission of Crimean-Congo hemorrhagic fever virus in two species of Hyalomma ticks from infected adults to cofeeding immature forms. Am J Trop Med Hyg. 1993; 48(4): 576 - 580. [PubMed: 8480867].

Hoogstraal, 1979: Hoogstraal H. The epidemiology of tick-borne Crimean-Congo hemorrhagic fever in Asia, Europe, and Africa. J Med Entomol. 1979; 15(4): 307 - 417. [PubMed: 113533].

Huggins, 1989: Huggins JW. Prospects for treatment of viral hemorrhagic fevers with ribavirin, a broad-spectrum antiviral drug. Rev Infect Dis. 1989; 11(Suppl 4): S750 - S761. [PubMed: 2546248].

Issacson, 2001: Isaacson M. Viral Hemorrhagic Fever Hazards for Travelers in Africa. Clinical Infectious Diseases. 2001; 33(10): 1707 - 1712. [PubMed: 11595975 ].

Joubert et al., 1985: Joubert JR, King JB, Rossouw DJ, Cooper R. A nosocomial outbreak of Crimean-Congo haemorrhagic fever at Tygerberg Hospital. Part III. Clinical pathology and pathogenesis. S Afr Med J. 1985; 68(10): 722 - 728. [PubMed: 3933128].

Karti et al., 2004: Karti SS, Odabasi Z, Korten V, Yilmaz M, Sonmez M, Caylan R, Akdogan E, Eren N, Koksal I, Ovali E, Erickson BR, Vincent MJ, Nichol ST, Comer JA, Rollin PE, Ksiazek TG. Crimean-Congo hemorrhagic fever in Turkey. Emerg Infect Dis. 2004; 10(8): 1379 - 1384. [PubMed: 15496237].

Khan et al., 1997: Khan AS, Maupin GO, Rollin PE, Noor AM, Shurie HH, Shalabi AG, Wasef S, Haddad YM, Sadek R, Ijaz K, Peters CJ, Ksiazek TG. An outbreak of Crimean-Congo hemorrhagic fever in the United Arab Emirates, 1994-1995. Am J Trop Med Hyg. 1997; 57(5): 519 - 525. [PubMed: 9392589].

Kotti et al., 2001: Kotti BK, Shaposhnikova LI, Evchenko IuM, Levchenko BI, Surkhaev DB, Korzhov PN, Tokhov IuM. Hyalomma marginatum Koch in Stavropol' region. Zh Mikrobiol Epidemiol Immunobiol. 2001; (6 Suppl): 105 - 108. [PubMed: 12718195].

Mardani et al., 2003: Mardani M, Jahromi MK, Naieni KH, Zeinali M. The efficacy of oral ribavirin in the treatment of crimean-congo hemorrhagic fever in Iran. Clin Infect Dis. 2003; 36(12): 1613 - 1618. [PubMed: 12802764].

Markeshin et al., 1992: Markeshin SIa, Smirnova SE, Evstafev IL. An assessment of the status of natural foci of Crimean-Congo hemorrhagic fever in the Crimea. Zh Mikrobiol Epidemiol Immunobiol. 1992; 4: 28 - 31. [PubMed: 1379771].

Marriott and Nuttall, 1992: Marriott AC, Nuttall PA. Comparison of the S RNA segments and nucleoprotein sequences of Crimean-Congo hemorrhagic fever, Hazara, and Dugbe viruses. Virology. 1992; 189(2): 795 - 799. [PubMed: 1641991].

Meissner et al., 2006A: Meissner JD, Seregin SS, Seregin SV, Vyshemirskii OI, Yakimenko NV, Netesov SV, Petrov VS. The complete genomic sequence of strain ROS/HUVLV-100, a representative Russian Crimean Congo hemorrhagic fever virus strain. Virus Genes. 2006; 33(1): 87 - 93. [PubMed: 16791423].

Meissner et al., 2006B: Meissner JD, Seregin SS, Seregin SV, Yakimenko NV,Vyshemirskii OI, Netesov SV, Petrov VS. Complete L segment coding-region sequences of Crimean Congo hemorrhagic fever virus strains from the Russian Federation and Tajikistan. Arch Virol. 2006; 151(3): 465 - 475. [PubMed: 16195783].

MMWR, 1988: Center for Disease Control and Prevention. Management of Patients with Suspected Viral Hemorrhagic Fever. Morb Mortal Weekly Report. 1988; 37(Supplemental 3): 1 - 16. [PubMed: 3126390].

Morikawa et al., 2002: Morikawa S, Qing T, Xinqin Z, Saijo M, Kurane I. Genetic diversity of the M RNA segment among Crimean-Congo hemorrhagic fever virus isolates in China. Virology. 2002; 296(1): 159 - 164. [PubMed: 12036327].

Morrill et al., 1990: Morrill JC, Soliman AK, Imam IZ, Botros BA, Moussa MI, Watts DM. Serological evidence of Crimean-Congo haemorrhagic fever viral infection among camels imported into Egypt. J Trop Med Hyg. 1990; 93(3): 201 - 204. [PubMed: 2112203].

Nabeth et al., 2004: Nabeth P, Cheikh DO, Lo B, Faye O, Vall IO, Niang M, Wague B, Diop D, Diallo M, Diallo B, Diop OM, Simon F. Crimean-Congo hemorrhagic fever, Mauritania. Emerg Infect Dis. 2004; 10(12): 2143 - 2149. [PubMed: 15663851].

Onishchenko et al., 2005A: Onishchenko GG, Tumanova IIu, Vyshemirskii OI, Kuhn J, Seregin SV, Tiunnikov GI, Petrova ID, Tishkova FKh, Ospanov KS, Kazakov SV, Karimov SK, Esmagambetova AS, Netesov SV, Petrov VS. [Study of virus contamination of Ixodes ticks in the foci of Crimean-Congo hemorrhagic fever in Kazakhstan and Tajikistan]. Zh Mikrobiol Epidemiol Immunobiol. 2005; 1: 27 - 31. [PubMed: 15773396].

Onishchenko et al., 2005B: Onishchenko GG, Tumanova IIu, Vyshemirskii OI, Kuhn J, Seregin SV, Tiunnikov GI, Petrova ID, Tishkova F, Ospanov KS, Kazakov SV, Karimov SK, Esmagambetova AS, Netesov SV, Petrov VS. [ELISA and RT-PCR-based research of viruses in the ticks collected in the foci of Crimean-Congo fever in Kazakhstan and Tajikistan in 2001-2002]. Vopr Virusol. 2005; 50(1): 23 - 26. [PubMed: 15747867].

Ozkurt et al., 2006: Ozkurt Z, Kiki I, Erol S, Erdem F, Yilmaz N, Parlak M, Gundogdu M, Tasyaran MA. Crimean-Congo hemorrhagic fever in Eastern Turkey: clinical features, risk factors and efficacy of ribavirin therapy. J Infect. 2006; 52(3): 207 - 215. [PubMed: 15953646].

Papa et al., 2002A: Papa A, Ma B, Kouidou S, Tang Q, Hang C, Antoniadis A. Genetic Characterization of the M RNA Segment of Crimean Congo Hemorrhagic Fever Virus Strains, China. Emerg Infect Dis. 2002; 8(1): 50 - 53. [PubMed: 11749748].

Papa et al., 2002B: Papa A, Bozovi B, Pavlidou V, Papadimitriou E, Pelemis M, Antoniadis A. Genetic detection and isolation of crimean-congo hemorrhagic fever virus, Kosovo, Yugoslavia. Emerg Infect Dis. 2002; 8(8): 852 - 854. [PubMed: 12141973].

Qing et al., 2003: Qing T, Saijo M, Niikura M, Maeda A, Ikegami T, Xinjung W, Kurane I, Morikawa S. Detection of immunoglobulin G to Crimean-Congo hemorrhagic fever virus in sheep sera by recombinant nucleoprotein-based enzyme-linked immunosorbent and immunofluorescence assays. J Virol Methods. 2003; 108(1): 111 - 116. [PubMed: 12565161].

Saijo et al., 2002: Saijo M, Qing T, Niikura M, Maeda A, Ikegami T, Prehaud C, Kurane I, Morikawa S. Recombinant nucleoprotein-based enzyme-linked immunosorbent assay for detection of immunoglobulin G antibodies to Crimean-Congo hemorrhagic fever virus. J Clin Microbiol. 2002; 40(5): 1587 - 1591. [PubMed: 11980926].

Saluzzo and Le Guenno, 1987: Saluzzo JF, Le Guenno B. Rapid diagnosis of human Crimean-Congo hemorrhagic fever and detection of the virus in naturally infected ticks. J Clin Microbiol. 1987; 25(5): 922 - 924. [PubMed: 3108314].

Schwarz et al., 1996: Schwarz TF, Nsanze H, Longson M, Nitschko H, Gilch S, Shurie H, Ameen A, Zahir AR, Acharya UG, Jager G. Polymerase chain reaction for diagnosis and identification of distinct variants of Crimean-Congo hemorrhagic fever virus in the United Arab Emirates. Am J Trop Med Hyg. 1996; 55(2): 190 - 196. [PubMed: 8780459].

Schwarz et al., 1997: Schwarz TF, Schwarz TF, Nsanze H, Ameen AM. Clinical features of Crimean-Congo haemorrhagic fever in the United Arab Emirates . Infection. 1997; 25(6): 364 - 367. [PubMed: 9427056].

Seregin et al., 2006: Seregin SV, Tumanova IIu, Petrova ID, Iashina LN, Kuzina II, Vyshemirskii OI, Gutorov VV, Seregin SS, Tiunnikov GI, Samokhvalov EI, L'vov DK, Netesov SV, Petrov VS. Genomic S segment of Crimean-Congo hemorrhagic fever virus circulating in Russia and Bulgaria. Vopr Virusol. 2006; 51(3): 25 - 32. [PubMed: 16826753].

Shepherd et al., 1986: Shepherd AJ, Swanepoel R, Leman PA, Shepherd SP. Comparison of methods for isolation and titration of Crimean-Congo hemorrhagic fever virus. J Clin Microbiol. 1986; 24(4): 654 - 656. [PubMed: 3095367].

Shepherd et al., 1987: Shepherd AJ, Swanepoel R, Leman PA, Shepherd SP. Field and laboratory investigation of Crimean-Congo haemorrhagic fever virus (Nairovirus, family Bunyaviridae) infection in birds. Trans R Soc Trop Med Hyg. 1987; 81(6): 1004 - 1007. [PubMed: 3140434].

Shepherd et al., 1988: Shepherd AJ, Swanepoel R, Gill DE. Evaluation of enzyme-linked immunosorbent assay and reversed passive hemagglutination for detection of Crimean-Congo hemorrhagic fever virus antigen. J Clin Microbiol. 1988; 26(2): 347 - 353. [PubMed: 3125221].

Shepherd et al., 1989: Shepherd AJ, Swanepoel R, Leman PA. Antibody response in Crimean-Congo hemorrhagic fever. Rev Infect Dis. 1989; 11(Suppl 4): S801 - S806. [PubMed: 2501854].

Smirnova et al., 1997: Smirnova SE, Karganova GG Gmyl' L V. Adaptation of Crimean-Congo hemorrhagic fever virus to culture in Vero-E6 cells. Vopr Virusol. 1997; 42(6): 280 - 283. [PubMed: 9499243].

Suleiman et al., 1980: Suleiman MN, Muscat-Baron JM, Harries JR, Satti AG, Platt GS, Bowen ET, Simpson DI. Congo/Crimean haemorrhagic fever in Dubai. An outbreak at the Rashid Hospital. Lancet. 1980; 2(8201): 939 - 941. [PubMed: 6107588].

Swanepoel et al., 1985: Swanepoel R, Shepherd AJ, Leman PA, Shepherd SP, Miller GB. A common-source outbreak of Crimean-Congo haemorrhagic fever on a dairy farm. S Afr Med J. 1985; 68(9): 635 - 637. [PubMed: 3933131].

Swanepoel et al., 1989: Swanepoel R, Gill DE, Shepherd AJ, Leman PA, Mynhardt JH, Harvey S. The clinical pathology of Crimean-Congo hemorrhagic fever. Rev Infect Dis. 1989; 11(Suppl 4): S794 - S800. [PubMed: 2749111].

Swanepoel et al., 1998: Swanepoel R, Leman PA, Burt FJ, Jardine J, Verwoerd DJ, Capua I, Bruckner GK, Burger WP. Experimental infection of ostriches with Crimean-Congo haemorrhagic fever virus. Epidemiol Infect. 1998; 121(2): 427 - 432. [PubMed: 9825796].

Tang et al., 2003: Tang Q, Saijo M, Zhang Y, Asiguma M, Tianshu D, Han L, Shimayi B, Maeda A, Kurane I, Morikawa S. A patient with Crimean-Congo hemorrhagic fever serologically diagnosed by recombinant nucleoprotein-based antibody detection systems. Clin Diagn Lab Immunol. 2003; 10(3): 489 - 491. [PubMed: 12738657].

Tantawi et al., 1981: Tantawi HH, Shony MO, Al-Tikriti SK. Antibodies to Crimean-Congo haemorrhagic fever virus in domestic animals in Iraq: a seroepidemiological survey. Int J Zoonoses. 1981; 8(2): 115 - 120. [PubMed: 6806205].

Tignor and Hanham, 1993: Tignor GH, Hanham CA. Ribavirin efficacy in an in vivo model of Crimean-Congo hemorrhagic fever virus (CCHF) infection . Antiviral Res. 1993; 22(4): 309 - 325. [PubMed: 8279818].

van de Wal et al., 1985: van de Wal BW, Joubert JR, van Eeden PJ, King JB. A nosocomial outbreak of Crimean-Congo haemorrhagic fever at Tygerberg Hospital. Part IV. Preventive and prophylactic measures. S Afr Med J. 1985; 68(10): 729 - 732. [PubMed: 2414853].

Vassilenko et al., 1990: Vassilenko SM, Vassilev TL, Bozadjiev LG, Bineva IL, Kazarov GZ. Specific intravenous immunoglobulin for Crimean-Congo haemorrhagic fever. Lancet. 1990; 335(8692): 791 - 792. [PubMed: 1969533].

Whitehouse, 2004: Whitehouse CA. Crimean-Congo hemorrhagic fever. Antiviral Res. 2004; 64(3): 145 - 160. [PubMed: 15550268].

Williams et al., 2000: Williams RJ, Al-Busaidy S, Mehta FR, Maupin GO, Wagoner KD, Al-Awaidy S, Suleiman AJ, Khan AS, Peters CJ, Ksiazek TG. Crimean-congo haemorrhagic fever: a seroepidemiological and tick survey in the Sultanate of Oman. Trop Med Int Health. 2000; 5(2): 99 - 106. [PubMed: 10747269].

Yapar et al., 2005: Yapar M, Aydogan H, Pahsa A, Besirbellioglu BA, Bodur H, Basustaoglu AC, Guney C, Avci IY, Sener K, Setteh MH, Kubar A. Rapid and quantitative detection of Crimean-Congo hemorrhagic fever virus by one-step real-time reverse transcriptase-PCR. Jpn J Infect Dis. 2005; 58(6): 358 - 362. [PubMed: 16377867].

Yashina et al., 2003: Yashina L, Vyshemirskii O, Seregin S, Petrova I, Samokhvalov E, Lvov D, Gutorov V, Kuzina I, Tyunnikov G, Tang YW, Netesov S, Petrov V. Genetic analysis of Crimean-Congo hemorrhagic fever virus in Russia. J Clin Microbiol. 2003; 41(2): 860 - 862. [PubMed: 12574301].

Yashina et al., 2003: Yashina L, Petrova I, Seregin S, Vyshemirskii O, Lvov D, Aristova V, Kuhn J, Morzunov S, Gutorov V, Kuzina I, Tyunnikov G, Netesov S, Petrov V. Genetic variability of Crimean-Congo haemorrhagic fever virus in Russia and Central Asia. J Gen Virol. 2003; 84(Pt 5): 1199 - 1206. [PubMed: 12692285].

Zeller et al., 1994A: Zeller HG, Cornet JP, Camicas JL. Experimental transmission of Crimean-Congo hemorrhagic fever virus by west African wild ground-feeding birds to Hyalomma marginatum rufipes ticks. Am J Trop Med Hyg. 1994; 50(6): 676 - 681. [PubMed: 8024058].

Zeller et al., 1994B: Zeller HG, Cornet JP, Camicas JL. Crimean-Congo hemorrhagic fever virus infection in birds: field investigations in Senegal. Res Virol. 1994; 145(2): 105 - 109. [PubMed: 8059064].

Zeller et al., 1997: Zeller HG, Cornet JP, Diop A, Camicas JL. Crimean-Congo hemorrhagic fever in ticks (Acari: Ixodidae) and ruminants: field observations of an epizootic in Bandia, Senegal (1989-1992). J Med Entomol. 1997; 34(5): 511 - 516. [PubMed: 9379454].

B. Book References:

AHFS Drug Information, 2006: The American Society of Health-System Pharmacists. Ribavirin. 826 - 840. In: McEvoy Gerald K. AHFS Drug Information Handbook 2006. The American Society of Health-System Pharmacists, Inc., Bethesda, MD, USA.

Gear, 1988: Gear JHS. Congo Fever - Crimean-Congo Hemorrhagic Fever. 121 - 129. In: Gear James HS. Handbook of Viral and Rickettsial Hemorrhagic Fevers 1988. CRC Press, Boca Raton, Florida.

Gonzalez-Scarano et al., 1996: Gonzalez-Scarano Francisco, Nathanson Neal. Bunyaviridae. 1473 - 1504. In: Fields Bernard N, Knipe David M, Howley Peter M. Field's Virology Third Edition Volume 1 1996. Lippincott-Raven Publishers, Philadelphia PA.

Jahrling, 1997: Jahrling PB. Viral Hemorrhagic Fevers. 591 - 602. In: Zajtchuk R, Bellamy RF. Textbook of Melitary Medicine: Medical aspects of chemical and biological warfare 1997. Office of The Surgeon General at TMM Publications, Borden Institute, Walter Reed Army Medical center., Washington, DC.

Nichol, 2001: Nichol Stuart T. Chapter 49:Bunyaviruses. 1603 - 1633. In: Knipe David M, Howley Peter M, Griffin Diane E, Martin Malcolm A, Lamb Robert A, Roizman Bernard, Straus Stephen E. Field's Virology Fourth Edition Volume 2 2001. Lippincott Williams & Wilkins, Philadelphia . Baltimore . New York . London . Buenos Aires . Hong Kong . Sydney . Tokyo.

Sandia Report: SAND2003-3080, 2003: Sandia National Laboratories. Crimean-Congo heamorrhagic fever virus. 1 - 148. In: Barnett Natalie. Biosecurity Reference: CFR-Listed Agent and Toxin Summaries 2003. Sandia National Laboratories, Albuquerque, New Mexico and Livermore, California.

Schmaljohn et al., 1996: Schmaljohn Connie S. Then Bunyaviridae: The viruses and their replication. 1447 - 1471. In: Fields Bernard N, Knipe David M, Howley Peter M. Field's Virology Third Edition Volume 1 1996. Lippincott-Raven Publishers, Philadelphia PA.

Watts et al., 1988: Watts Douglas M, Ksiazek Thomas G, Linthicum Kenneth J, Hoogstraal Harry. Crimean-Congo Hemorrhagic Fever. 177 - 222. In: Monath Thomas P. The Arboviruses: Epidemiology and Ecology Volume II 1988. CRC Press, Boca Raton, Florida.

C. Website References:

WHO: Crimean-Congo haemorrhagic fever (CCHF) [ http://www.who.int/csr/disease/crimean_congoHF/en/ ].

NCBI Taxonomy: Crimean-Congo hemorrhagic fever virus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=11593&lvl=3&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Crimean-Congo hemorrhagic fever virus (isolate C68031) [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=11594&lvl=3&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Crimean-Congo hemorrhagic fever virus strain BA88166 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=154120&lvl=3&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Crimean-Congo Hemorrhagic Fever virus strain China [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=170517&lvl=3&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Hazara virus (isolate JC280) [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=11597&lvl=3&keep=1&srchmode=1&unlock ].

NCBI Taxonomy Hsapiens: Homo sapiens [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Tree&id=9606&lvl=3&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Bos taurus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9913&lvl=3&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Capra hircus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9925&lvl=3&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Ovis aries [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9940&lvl=3&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Lepus europaeus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9983&lvl=3&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Atelerix albiventris [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9368 ].

NCBI Taxonomy: Mastomys [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=30639&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Ixodidae [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=6939&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Argasidae [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=6936&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Ixodida [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=6935&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Entrez: Crimean-Congo hemorrhagic fever virus strain Baghdad-12 [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=62997547 ].

NCBI Entrez: Crimean-Congo hemorrhagic fever virus strain Semunya [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=71648472 ].

NCBI Entrez: Crimean-Congo hemorrhagic fever virus strain SPU4/81 [ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=71648480 ].

NCBI Taxonomy: Homo sapiens [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9606&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Vertebrata [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=7742&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Vulpes vulpes [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9627 ].

NCBI Genome: Crimean-Congo hemorrhagic fever virus segment L, complete sequence. [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genome&cmd=Retrieve&dopt=Overview&list_uids=17506 ].

NCBI Genome: Crimean-Congo hemorrhagic fever virus segment M, complete sequence [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genome&cmd=Retrieve&dopt=Overview&list_uids=17505 ].

NCBI Taxonomy: Lepus capensis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9981&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Equus caballus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9796 ].

NCBI Taxonomy: Equus asinus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9793&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Sus scrofa [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9823&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Otocolobus manul [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=61408 ].

NCBI Taxonomy: Genetta genetta [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=94190&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Camelus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9836&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Struthio camelus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=8801 ].

NCBI Taxonomy: Rhinoceros [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9808&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Giraffa camelopardalis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9894 ].

NCBI Taxonomy: Bubalus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9918&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Amblyomma variegatum [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=34610 ].

NCBI Taxonomy: Dermacentor marginatus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=49202 ].

NCBI Taxonomy: Tockus erythrorhynchus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=81911&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Hyalomma anatolicum [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=176092&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Hyalomma asiaticum [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=266040&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Hyalomma marginatum [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=34627&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Hyalomma marginatum rufipes [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=72862&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Hyalomma truncatum [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=72855&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Coraciiformes [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=8936&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Rhipicephalus evertsi [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=60190&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Bucerotidae [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=57380&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

NCBI Taxonomy: Numida meleagris [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=8996&lvl=3&lin=f&keep=1&srchmode=1&unlock ].

Website 1: Crimean Congo Hemorrhagic Fever Virus [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Tree&id=11593&lvl=3&keep=1&srchmode=1&unlock ].

Website 17: Crimean-Congo hemorrhagicfever virus Group [ http://www.ncbi.nlm.nih.gov/ICTVdb/ICTVdB/11030100.htm ].

Website 19: Viral Hemorrhagic Fevers [ http://www.emedicine.com/ped/topic2406.htm ].

Website 20: Crimean-Congo hemorrhagic fever virus isolate BA66019 envelope glycoprotein precursor, gene, complete cds [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_uids=14029591&dopt=GenBank ].

Website 21: Crimean-Congo hemorrhagic fever virus isolate BA8402 envelope glycoprotein precursor, gene, complete cds [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_uids=14029593&dopt=GenBank ].

Website 22: Crimean-Congo hemorrhagic fever virus (isolate C68031) S RNA segment, viral-complementary strand [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_uids=323278&dopt=GenBank ].

WHO Report: Epidemic and Pandemic Alert and Response (EPR) March, 2003: (Crimean-Congo haemorrhagic fever (CCHF) in Mauritania - Update) [ http://www.who.int/csr/don/2003_03_24/en/index.html ].

WHO's Fact Sheet No. 208, November, 2001: Crimean-Congo haemorrhagic fever. [ http://www.who.int/mediacentre/factsheets/fs208/en/ ].

D. Thesis References:

No thesis or dissertation references used.

VI. Curation Information

• Curators: Rebecca Wattam (Virginia Bioinformatics Institute Phase I, Washington Street, Virginia Tech, Blacksburg VA 24061, pathinfo@vbi.vt.edu. Tel: 540-231-2100)
• Date: 06/11/2003
• Version: 1.0
• Note: Edited version
• Revision:
  • Curators: Herman Formadi (Virginia Bioinformatics Institute Phase I, Washington Street, Virginia Tech, Blacksburg VA 24061, pathinfo@vbi.vt.edu. Tel: 540-231-2100);
  • Date: 09/06/06
  • Version: 2.0
  • Note: 2006 Edited version
• Contact information:
  • Email: pathinfo@vbi.vt.edu
  • Telephone: 540-231-2100
  • Address: Virginia Bioinformatics Institute Phase I, Washington Street, Virginia Tech, Blacksburg VA 24061