Aspergillus flavus
I. Organism Information
A. Taxonomy Information
-
Species:
-
Aspergillus flavus
(Website 1):
-
GenBank Taxonomy No.:
5059
-
Description:
Aspergillus flavus belongs to the Genus Aspergillus, Subdivision Deutoromycotina (Alexopoulos et al., 1996).
Aspergillus flavus causes diseases of agronomically important crops, such as corn and peanuts, is second only to Aspergillus fumigatus as the cause of human invasive aspergillosis, and is the Aspergillus species most frequently reported to infect insects (St. Leger et al., 2000).
It was demonstrated that most A. flavus strains can cause disease in both plants and animals. Many fungi moved from opportunistic forms to specialized pathogens by gaining the ability to produce host-selective toxins that provided the genetic isolation for evolutionary change. Although A. flavus produces a variety of toxins, including aflatoxins, the routine association of A. flavus with various plants and insects in an opportunistic fashion, as these nutritional resources temporarily become available, could explain why populations of A. flavus have not diverged into separate pathogenicity types. It is possible that A. flavus routinely infects both plants and animals with the insect acting as vector. In this scenario, the insect eventually serves as a substrate to create a very large inoculum to exploit insect damage in the plant (St. Leger et al., 2000).
The occurrence of Aspergillus flavus in field maize was first reported 75 years ago (Taubenhaus, 1920).
Aspergillus flavus and A. parasiticus are the predominant species responsible for aflatoxin contamination of crops prior to harvest or during storage (Yu et al., 2004).
The genes of both important aflatoxinogenic species are very homologous (Yu et al., 2004).
Researchers have frequently failed to distinguish between the two species in their research, or the identity of the species was not verified by a taxonomist (Diener et al., 1987).
The genes of both important aflatoxinogenic species, A. flavus as well as A. parasiticus, are very homologous (Yu et al., 2004).
A. flavus has been reported to occur in most agricultural soils of the south. The fungus occurs on many types of organic material in various stages of decomposition including forages, cereal grains, food, and feed products. All isolates of the fungus do not produce aflatoxins; thus, the mere presence of A. flavus does not mean that aflatoxins will be present in the substrate. The fungus has not been associated with causing a yield reduction in corn. However, it has been associated with causing a reduction in quality (Duncan and Hagler, 1986).
The acute toxicity of aflatoxins and the carcinogenic property of aflatoxins were established and recognized for over 40 years (Lancaster et al., 1961).
Aflatoxins are harmful or fatal to livestock and are considered carcinogenic (Moreno and Kang, 1999).
Aflatoxins, a group of polyketide-derived furanocoumarins (Yu et al., 2004)
are produced by a poliketide pathway by many strains of A. flavus and A. parasiticus; in particular, A. flavus is a common contaminant in agriculture. Among the at least 16 structurally related aflatoxins characterized, however, there are only four major aflatoxins, B1, B2, G1, and G2 (AFB1, AFG1, AFB2, and AFG2), that contaminate agricultural commodities and pose a potential risk to livestock and human health. Aspergillus flavus produces AFB1 and AFB2. Aspergillus parasiticus produces AFB1, AFG1, AFB2, and AFG2 (Bennett and Klich, 2004).
Thousands of studies on aflatoxin toxicity have been conducted, mostly concerning laboratory models or agriculturally important species (Yu et al., 2004).
Because of the differences in aflatoxin susceptibility in test animals, it has been difficult to extrapolate the possible effects of aflatoxin to humans, but acute toxicity of aflatoxins in Homo sapiens has not been observed very often. It is believed that a 1974 Indian outbreak of hepatitis in which 100 people died may have been due to the consumption of maize that was heavily contaminated with aflatoxin. Some adults may have eaten 2 to 6 mg of aflatoxin in a single day. Subsequently, it was calculated that the acute lethal dose for adults is approximately 10 to 20 mg of aflatoxins. One anecdotal report refutes this estimate. A woman who had ingested over 40 mg of purified aflatoxin in a suicide attempt was still alive 14 years later. Multiple laboratory tests of her urine and blood, and X-ray, ultrasound, and computerized axial tomography analyses of her abdomen, liver, and spleen all gave normal results (Bennett and Klich, 2004).
Aflatoxin has achieved some notoriety as a poison. The plot of The Human Factor, a spy thriller by Graham Greene, revolves around the murder of a central figure whose whiskey was laced with aflatoxin (a toxicologically improbable way to kill someone). Nevertheless, aflatoxins reputation as a potent poison may explain why it has been adopted for use in bioterrorism (Bennett and Klich, 2004).
The US Food and Drug Administration (FDA) has established acceptance level of 20 ppb for aflatoxin in maize for human consumption, with the level in milk being even lower (0.5 ppb). Maize grain with contamination levels of 200 ppb and 300 ppb may be fed to finishing swine and cattle, respectively (Munkvold et al., 1999).
These regulatory guidelines (within U.S. as well as those enforced internationally) and crop losses due to disease caused by mycotoxigenic fungi have put a tremendous economic burden on U.S. agriculture. It is estimated that the mean direct economic annual costs of crop losses from just three mycotoxins, namely aflatoxins, fumonisins, and deoxynivalenol, are $932 million (Website 2).
Aspergillus flavus causes aspergillosis, a life-threatening human disease, particularly in patients who are immunosuppressed or have chronic lung disease. Aspergillus flavus is responsible for about 30% of the cases of aspergillosis (Website 3).
-
Variant(s):
-
Aspergillus flavus var. columnaris
(Website 15):
-
GenBank Taxonomy No.:
41123
-
Parent:
Aspergillus flavus
-
Description:
Studies to modernize the soy sauce fermentation in Thailand began in 1978 when a locally yellow-green Aspergillus strain was recommended for use in soy sauce factories because it was a high protease producer, was free of aflatoxin and other toxins, and it produced good taste and aroma in the final fermentation strain This strain was first labeled as a strain of Aspergillus oryzae but was later found to conform well to the description of A. flavus var. columnaris (Kalayanamitr et al., 1987).
-
Aspergillus sp. L
(Website 16):
-
GenBank Taxonomy No.:
187393
-
Parent:
Aspergillus flavus
-
Description:
Aspergillus flavus is a widely distributed filamentous fungus that contaminates crops with the potent carcinogen aflatoxin. This species can be divided into S and L strains on the basis of sclerotial morphology (Mellon and Cotty, 2004).
-
Aspergillus sp. S
(Website 17):
-
GenBank Taxonomy No.:
187381
-
Parent:
Aspergillus flavus
-
Description:
Aspergillus flavus is a widely distributed filamentous fungus that contaminates crops with the potent carcinogen aflatoxin. This species can be divided into S and L strains on the basis of sclerotial morphology (Mellon and Cotty, 2004).
-
Aspergillus sp. S(B)
(Website 18):
-
GenBank Taxonomy No.:
187392
-
Parent:
Aspergillus flavus
-
Description:
In buffered medium, West African Aspergillus flavus S(BG) isolates were more sensitive to nitrate repression of aflatoxin biosynthesis than were North American S(B) isolates (Ehrlich and Cotty, 2004).
-
Aspergillus sp. S(BG)
(Website 19):
-
GenBank Taxonomy No.:
187380
-
Parent:
Aspergillus flavus
-
Description:
In buffered medium, West African Aspergillus flavus S(BG) isolates were more sensitive to nitrate repression of aflatoxin biosynthesis than were North American S(B) isolates (Ehrlich and Cotty, 2004).
B. Lifecycle Information
(Scheidegger and Payne, 2003):
-
Stage Information:
-
Mycelium and Sclerotia in soil or crop debris: (Alexopoulos et al., 1996):
-
Size:
The hyphae are well developed, profusely branched, septate, and hyaline; their cells are, as a rule, multinucleate (Alexopoulos et al., 1996).
-
Picture(s):
-
Hyphae of A. flavus (Website 64):
Description:
Mycelium growing in tissue. (Copyright Doctorfungus Corporation) (Website 64)
-
Description:
Fungal mycelium appears to be the predominant structure found in the soil, but sclerotia can be formed, thus contributing to the long-term survival of the fungus (Scheidegger and Payne, 2003).
Several studies have shown that aflatoxin production and sclerotial formation are interrelated (Cotty, 1988).
Cotty determined a link between aflatoxin production and sclerotial morphogenesis based on changes of both chemical and morphological differentiation in response to pH. At pH 4.0 or below, sclerotial production is reduced by 50% in A. flavus while aflatoxin production is maximal (Cotty, 1988)
-
Conidiophores: (Alexopoulos et al., 1996):
-
Size:
While still young and vigorous, the mycelium produces an abundance of conidiophores. These are not organized in many ways, but arise singly from a somatic hyphae. The hyphal cell that branches to give rise to the conidiophore is called the foot cell (Alexopoulos et al., 1996).
-
Shape:
The conidiophores are long, erect hyphae, each terminating in a bulbous head, the vesicle (Alexopoulos et al., 1996)
-
Picture(s):
-
Conidiophore of A. flavus. (Website 50):
Description:
Conidiophore of A. flavus with conidium-bearing cell. (Copyright Gesellschaft f?r Mykotoxinforschung) (Website 50)
-
Conidiogenous cells (or sterigmata): (Alexopoulos et al., 1996):
-
Size:
As a multinucleate vesicle develops, a large number of conidiogenous cells are produced over its entire surface, completely covering it. One or two layers of conidiogenous cells (sometimes called sterigmata) may be produced, according to the species. When two layers of sterigmata are produced, the secondary are the ones from which the conidia arise. The conidium- bearing cells are typical phialides (Alexopoulos et al., 1996).
-
Shape:
The conidium-bearing cells are typical phialides (Alexopoulos et al., 1996).
-
Picture(s):
-
Conidial head (Website 13):
Description:
Conidial head of A. flavus: conidial heads with both uniseriate and biseriate arrangement of phialides may be present.(Copyright University of Adelaide) (Website 1)
-
Electron microscopy conidial head
Description:
The conidium- bearing cells are typical phialides (Alexopoulos et al., 1996)
-
Description:
Electron microscopy of A. flavus conidial head. (Copyright Dennis Kunkel Microscopy) (Website 67)
-
Conidia: (Alexopoulos et al., 1996):
-
Size:
As the phialides reach maturity, they begin to form conidia at the tips, one below the other, in chains. The conidia of Aspergillus are formed inside of the phialide, which is actually a tube. A portion of the protoplasm with a nucleous at the tip of the sterigma is delimited by a septum. The protoplast rounds off, secretes a wall of its own within the tubular phialide, and develops into a conidium. In the meantime, a second protoplast below the first develops into a spore and pushes the first spore outward without disjunction, so that the chain of spores is formed as the phialide protoplasm continues to grow and cuts off more conidia, one below the other (Alexopoulos et al., 1996).
-
Shape:
The conidia are typically globose and unicellular with extremely roughened walls (Alexopoulos et al., 1996).
-
Picture(s):
-
Conidia (Website 41):
Description:
Microscopic characters: Conidia 1470x (Copyright International Union of Microbiological Society) (Website 41)
-
A. flavus on groundnuts (Website 65):
Description:
Because conidiophores and conidia are produced in such an abundance, their color is the predominant one of the colony they covered. (Copyright: ww.nri.org/images/foodsafety1) (Alexopoulos et al., 1996)
Conidia produced by mycelium or sclerotia serve as the primary inoculum in corn fields in the South (Diener et al., 1987).
-
Conidia in air or insects : (Diener et al., 1987):
-
Description:
Conidia are carried by wind or insects to nearby plants (Diener et al., 1987).
Conidia of A. flavus carried by insects such as sting (Chorochroa sayi) and lygus (Lygus herperus) bugs, may be sources of primary inoculum in Arizona cotton fields. The fungus was isolated from surface-sterilize external parts of these insects 33 to 37% of the time and from intestinal tissue 20 to 23% of the time. A. flavus was also isolated from 61 to 79% of nonsterile sting and lygus bugs, respectively (Diener et al., 1987).
-
Conidia on healthy plants: (Diener et al., 1987):
-
Description:
Conidia are carried by wind or insect to healthy plants (Diener et al., 1987)
-
Conidia on crop debris or infected plants: (Scheidegger and Payne, 2003):
-
Description:
Later in the growing season, conidia produced on crop debris or on infected plants provide high levels of secondary inoculum when environmental conditions are conducive for disease development (Scheidegger and Payne, 2003).
Saprophytic growth is also important to consider in the life cycle of this pathogen. Infected plant tissue such as corn kernels, cobs, and leaf tissue can remain in the soil and support the fungus until the following season when newly exposed mycelium or sclerotia can give rise to conidial structures, thus producing the primary inoculum for the next infection cycle (Payne and Brown, 1998).
-
Saprophytic mycelia: (Scheidegger and Payne, 2003):
-
Description:
A. flavus appears to spend most of its life growing as a saprophyte in the soil. Growth of the fungus in this habitat is supported largely by the presence of plant and animal debris (Scheidegger and Payne, 2003).
-
Progression Information:
-
Life cycle --
From stage:
Mycelium and Sclerotia in soil or crop debris
, To stage:
Saprophytic mycelia (Diener et al., 1987):
-
Description:
Conidia produced by mycelium or sclerotia serve as the primary inoculum for diseases caused by A. flavus. Spores are carried by wind or insects to nearby plants. Insects clearly play an important role in the epidemiology of A. flavus (Diener et al., 1987).
-
Diagram of infection (Scheidegger and Payne, 2003):
Description:
Diagram of the pre-harvest infection of cotton, corn, and peanuts by Aspergillus flavus. Sclerotia and conidia produced by A. flavus growing on crop debris and in the soil serve as primary inoculum for young plants in the spring. Later in the growing season, conidia produced on crop debris or on infected plants provide high levels of secondary inoculum when environmental conditions are conducive for disease development.(Copyright Marcel Dekker Inc.) (Scheidegger and Payne, 2003)
C. Genome Summary:
-
Genome of
Aspergillus flavus
-
Description:
The whole genome sequencing and assembly of Aspergillus flavus is to be funded by The Microbial Genome Sequencing Project of the United States Department of Agricultures National Research Initiative. The USDA Food and Safety Research Group in New Orleans will match some funding for finishing. The proposal was submitted by Professor Gary Payne of North Carolina State University. Funding will commence 1st November 2003. The project will extend over two years but initial 3x sequence coverage and assemblies should be available early in 2004. All sequencing and annotation will be performed at TIGR. An Aspergillus flavus Genomics Advisory Committee has been established (Website 42).
In A. flavus there are eight chromosomes with an estimated genome size of about 33-36 Mbp that harbor an estimated 12,000 functional genes (Yu et al., 2004).
II. Epidemiology Information
The extent of yellow mould damage and aflatoxin production is dependent on the environmental conditions and production, harvesting and storage practices. The pathogen is seedborne and soilborne, and active in high humidity (90-98%) and low soil moisture. Temperatures conducive to growth are 17-42C with aflatoxin production between 25-35C (Website 10).
Growth of the fungus is poor at temperatures below 55 F, but slow growth will occur and low amounts of aflatoxins may be produced under favorable moisture conditions at the lower range of temperatures. Moisture levels in corn below 12 to 13% inhibit growth of the fungus at any temperature (Duncan and Hagler, 1986).
Environmental conditions can play an important role in disease development. Growth of A. flavus is optimal when temperatures are between 36 and 38C. At the same time, temperatures above 30C can start to cause heat stress in corn plants, thus leaving the invading fungus at an even greater advantage. Researchers have also noted that aflatoxin contamination is greater in years with below average rainfall (Payne, 1992).
Drought stress can lead to cracks in corn kernel surfaces, providing additional entry sites for hyphae of A. flavus. It is important to note that the conditions that favor growth of Aspergillus flavus (high temperature, low humidity) are less than ideal for many of the microbes that would typically be present in the soil or on plant surfaces. This puts the fungus at an even greater advantage, allowing it to easily out-compete these organisms for substrates in the soil or in the plant (Bhatnagar et al., 2000).
A. Outbreak Locations:
-
We report the clinical data for 9 patients affected during an outbreak of Aspergillus flavus sternal wound infections after cardiac surgery. In 7 patients, the infection had a locally invasive character, with 3 of these patients having multiple relapses; 2 patients had fulminant mediastinitis and died. Most patients received combined surgical and medical treatment (Vandecasteele al., 2002).
In 1960, aflatoxins literally exploded onto the scene when over 100,000 turkeys died after consuming contaminated peanut meal. Hepatomas in trout hatcheries, later traced to contaminated cotton seed meal, was almost simultaneously found to be due to aflatoxins in the western United States as was turkey X disease in England. Through the work of several scientists in many disciplines, it was discovered that aflatoxins could be produced by two fungi, Aspergillus flavus and Aspergillus parasiticus. For many years, it was thought that aflatoxins were produced only in storage. However, surveys done in South Carolina in the early 1970s clearly demonstrated that aflatoxins could also be produced prior to harvest. Evidence of preharvest contamination of corn with aflatoxins caused additional concerns with regard to potential control measures (Duncan and Hagler, 1986).
Unlike third-world countries, where large outbreaks have occurred from the lack of regulatory measures and high exposure levels, the U.S. has no reported human outbreaks of acute aflatoxicosis (Website 40).
The most severe case of acute poisoning of aflatoxin was reported in north-west India in 1974 where 25% of the exposed population died after ingestion of the molded maize with aflatoxin levels ranging from 6250 to 15600 mg/kg (Website 66).
An outbreak of a disease characterised by jaundice, rapidly developing ascites and portal hypertension associated with 20 people with100% mortality rate was investigated in 1974 in India. Analysis of food samples revealed that the disease outbreak was due to the consumption of maize (corn) heavily infested with the fungus Aspergillus flavus. Unseasonal rains prior to harvest, chronic drought conditions, poor storage facilities and ignorance of dangers of consuming fungal contaminated food seem to have caused the outbreak (Krishnamachari et al., 1977 ).
B. Transmission Information:
-
From: (at lifecycle stage: Conidia), To: (at lifecycle stage: Conidia in air or insects ) ,
With Destination: (at lifecycle stage: Conidia on healthy plants)
Mechanism:
A. flavus produces prodigious numbers of airborne conidia (Diener et al., 1987).
Conidia are readily dispersed by air movements. Conidia produced on sporogenic sclerotia are disseminated by air currents and possibly by insects. Insects physically move conidia adhering to their bodies to plant parts in feeding and leave them via defecation (Diener et al., 1987).
It would appear that stress on the corn plant at time of pollination is conducive to high aflatoxin levels at time of harvest. Although insects may not be involved in the primary infection process, they certainly can be involved in spreading the fungus within infected ears. When the pericarp of a kernel is broken, its contents are exposed to invasion by many microorganisms. As the moisture content drops rapidly to levels where A. flavus can compete successfully with other microorganisms, it becomes an excellent competitor (Jones et al., 1981).
Once Aspergillus flavus is present in plant tissue, it can continue to grow (Scheidegger and Payne, 2003).
Saprophytic growth is important to consider in the life cycle of this pathogen. Infected plant tissue such as corn kernels, cobs, and leaf tissue can remain in the soil and support the fungus until the following season when newly exposed mycelium or sclerotia can give rise to conidial structures, thus producing the primary inoculum for the next infection cycle (Scheidegger and Payne, 2003).
C. Environmental Reservoir:
-
Crop debris and soil
:
-
Description:
Once Aspergillus flavus is present in plant tissue, it can continue to grow and to produce aflatoxin, and toxin levels in improperly stored infected plant tissue can continue to increase long after harvest. While this has severe consequences for the food and feed supply, saprophytic growth is also important to consider in the life cycle of this pathogen. Infected plant tissue such as corn kernels, cobs, and leaf tissue can remain in the soil and support the fungus until the following season when newly exposed mycelium or sclerotia can give rise to conidial structures, thus producing the primary inoculum for the next infection cycle (Scheidegger and Payne, 2003).
-
Survival Information:
They found that production of conidia from sclerotia was greatly reduced by one to two years of burial in the soil, but that sclerotia remained viable even after years of burial . They also observed large numbers of propagules in the soil, such as might be present following conidial germination of the sclerotia (Wicklow et al., 1993).
D. Intentional Releases:
-
Intentional Release information
:
-
Description:
Most intriguing to some experts is Iraqs decision to weaponize aflatoxin, a compound derived from Aspergillus molds that grow on peanuts and other crops. Iraq declared that it had produced 2390 liters of concentrated aflatoxin, filling roughly 70% of this amount into munitions. But aflatoxin is a curious choice of weapon, as it is best known for causing liver cancer--hardly a knockout punch on the battlefield. Some observers speculate that Iraq may have developed aflatoxin as an ethnic weapon against Kurds or Shiites. The cancer might not show up for years, but the psychological effects could be devastating, possibly emptying contaminated villages. That would make it a true terror weapon, says one U.N. inspector. Or aflatoxin could simply have been what one scientist calls the pet toxin of an Iraqi specialist (Stone, 2002).
III. Infected Hosts
-
Human:
-
Taxonomy Information:
-
Species:
-
Man
(Website 54):
-
GenBank Taxonomy No.:
9606
-
Scientific Name:
Homo sapiens (Website 54)
-
Description:
The clinical syndrome of aflatoxicosis is characterized by abdominal pain, vomiting, pulmonary edema, convulsions, coma, liver damage, and death. Aflatoxin B1 is positively associated with liver cell cancer, supported by epidemiological studies done in Asia and Africa. Susceptibility to aflatoxicosis may be influenced by age, sex, nutritional status, health, and the level and duration of exposure. Long-term exposure to low levels of aflatoxins in the food supply may have adverse effects over time to humans. Humans can become sick by consuming unsafe levels of aflatoxin contaminated food and food products from grains, nuts and milk (Website 40).
The symptoms of severe aflatoxicosis include hemorrhagic necrosis of the liver, bile duct proliferation, edema, and lethargy. Animal studies have found 2 orders of magnitude difference in the median lethal dose for AFB1 (Williams et al., 2004).
-
Infection Process:
-
Infectious Dose:
-
Description:
Epidemiological, clinical, and experimental studies reveal that exposure to large doses (less than 6000mg) of aflatoxin may cause acute toxicity with lethal effect whereas exposure to small doses for prolonged periods is carcinogenic. The adverse effects of aflatoxins on animal can be categorized into acute toxicity and chronic toxicity. Acute toxicity is caused when large doses of aflatoxin are ingested. This is common in livestock. The principal target organ for aflatoxins is the liver. After the invasion of aflatoxins into the liver, lipids infiltrate hepatocytes and leads to necrosis or liver cell death. This is mainly because aflatoxin metabolites react negatively with different cell proteins, which leads to inhibition of carbohydrate and lipid metabolism and protein synthesis. In correlation with the decrease in liver function, there is a derangement of the blood clotting mechanism, icterus (jaundice), and a decrease in essential serum proteins synthesized by the liver. Other general signs of Aflatoxicosis are edema of the lower extremities, abdominal pain, and vomiting (Website 66).
Exposure to aflatoxin is widespread in West Africa, probably starting in the utero, and blood tests have shown that very high percentage of West Africans are exposed to aflatoxins. In a study carried out in the Gambia, Guinea Conakry, Nigeria and Senegal, over 98% of subjects tested positive to aflatoxin markers (Bankhole and Adebanjo, 2003).
Studies have shown that exposure to aflatoxin has several established consequences and other likely consequences for human health, depending on levels of exposure:1) The risk of cancer. This risk is a function of cumulative aflatoxin exposure, so low exposure rates still have significant health implications, particularly for the 20% of people in developing countries with HBV. 2) Serious effects on childhood nutrition. At the levels of exposure in some developing countries, child nutrition and development are interfered with, as is selenium. Animal studies show that aflatoxin also interferes with vitamins A and D, iron, selenium, and zinc nutrition. 3) Immunosuppression. This risk is well established in farm and laboratory animals, and immune system involvement of aflatoxin is confirmed for humans in a few studies. 4) Modulation of infectious diseases and vaccination titers in animals. There is evidence suggesting that aflatoxin may well be a factor in the HIV epidemic and in malaria incidence (Williams et al., 2004).
The level of aflatoxin in food samples consumed during the outbreak was ranging between 2.5 and 15.6 microgram/g. Anywhere between 2 and 6 mg of aflatoxin seems to have been consumed daily by the affected people for many weeks. In contrast, during 1975, analysis of corn samples from the same areas revealed very low levels of aflatoxin, less than 0.1 microgram/g. This was in line with the absence of major outbreaks in 1975 (Krishnamachari et al., 1977 )
Animal studies have found 2 orders of magnitude difference in the median lethal dose for AFB1. Susceptible species such as rabbits and ducks have a low (0.3 mg/kg) median lethal dose, whereas chickens (18 mg/kg) and rats have greater tolerance. Adult humans usually have a high tolerance of aflatoxin, and, in the reported acute poisonings, it is usually the children who die (Williams et al., 2004).
-
Disease Information:
-
Aflatoxin poisoning
(i.e., Aflatoxicosis)
:
-
Pathogenesis Mechanism:
In animal experiments, AFB1 has been shown to induce thymic aplasia, reduce T-lymphocyte function and number, suppress phagocytic activity, and reduce complement activity. Many studies conducted in poultry, pigs, and rats showed that exposure to aflatoxin in contaminated food results in suppression of the cell-mediated immune responses. Thymic and bursal involution, suppression of lymphoblastogenesis, impairment of delayed cutaneous hypersensitivity , and graft-versus-host reaction also occur in animals exposed to aflatoxin. Splenic CD4 (helper T) cell numbers and interleukin 2 (IL-2) production decreased significantly when mice were treated with AFB1 at a dose of 0.75 mg/kg. Impairment of cellular function by aflatoxin seems to be due to its effects on such factors as the production of lymphokines and antigen processing by macrophages, as well as a decrease in or lack of the heat-stable serum factors involved in phagocytosis (Williams et al., 2004).
Macrophages play a major role in host defenses against infection. They present antigen to lymphocytes during the development of specific immunity and serve as supportive accessory cells to lymphocytes. Macrophages also increase their phagocytic activity and release various active products, such as cytokines and reactive intermediates, to carry out nonspecific immune responses. Several reports suggest that aflatoxin impairs the function of macrophages in animal species. In addition to its reported effect in reducing phagocytic activity in rabbit alveolar macrophages, aflatoxin has more recently been shown in vitro to inhibit phagocytic cell function in normal human peripheral blood monocytes. AFB1 at concentrations greater than or equal to 100 pg/mL was cytotoxic to the monocytes, and concentrations of 0.5 to 1 pg/mL inhibited monocyte phagocytic activity and intracellular killing of Candida albicans; however, superoxide production and the ability of the monocytes to destroy intracellular herpes simplex virus were not affected (Williams et al., 2004).
-
Prognosis:
Conditions increasing the likelihood of acute aflatoxicosis in humans include limited availability of food, environmental conditions that favor fungal development in food and commodities, and lack of regulatory systems for aflatoxin monitoring and control. Because aflatoxins, especially aflatoxin B1, are potent carcinogens in some animals, there is interest in the effects of long-term exposure to low levels of these importants mycotoxins on humans. In 1988, IARC placed aflatoxin B1 on the list of human carcinogens. This is supported by a number of studies done in Asia and Africa that have demonstrated a positive association between dietary aflatoxins and Liver Cell Cancer (LCC). Additionally, aflatoxin-related diseases in humans may be influence by factors such as age, sex, nutritional status, or concurrent exposure to other causative agents such as viral hepatitis (HBV) or parasite infestation (Langford, 2004)
Acute aflatoxicosis results in direct liver damage and subsequent illness or death (Williams et al., 2004).
-
Diagnosis Overview:
Diagnosis is based on a combination of imaging (high-resolution computed tomography) and a number of laboratory techniques including direct examination, culture and circulating markers (galactomannan and Aspergillus DNA) which can be detected at early stages of the infection (del Palacio et al., 2003 ).
Other tests include * Sputum stain and culture showing Aspergillus; * Tissue biopsy for aspergillosis; * Aspergillus antigen skin test; * Aspergillosis precipitin antibody; * Elevated serum total IgE (immunoglobulin); * Peripheral eosinophilia with allergic disease (Website 60).
-
Symptom Information
:
-
Syndrome --
Chronic toxicity:
-
Description:
Chronic toxicity is due to long term exposure of moderate to low aflatoxin concentration. The symptoms include decrease in growth rate, lowered milk or egg production, and immunosuppression. There is some observed carcinogenecity, mainly related to aflatoxin B1. Liver damage is apparent due to the yellow color that is characteristic of jaundice, and the gall bladder becomes swollen. Immunosuppression is due to the reactivity of aflatoxins with T-cells, decrease in Vitamin K activities, and a decrease in phagocytic activity in macrophages. These immuno-suppressive effects of aflatoxins predispose the animals to many secondary infections due to other fungi, bacteria and viruses (Website 66).
-
Syndrome --
Aflatoxicosis:
-
Description:
Aflatoxicosis is the poisoning that results from ingesting aflatoxins. Two forms of aflatoxicosis have been identified: the first is acute severe intoxication, which results in direct liver damage and subsequent illness or death, and the second is chronic subsymptomatic exposure (Williams et al., 2004).
The differences in susceptibility to aflatoxin across species and between persons depend largely on the fraction of the dose that is directed into the various possible pathways, with harmful "biological" exposure being the result of activation to the epoxide and the reaction of the epoxide with proteins and DNA. There is also evidence that the fractions that follow the different possible pathways are influenced by dosage, perhaps because of the saturation of the most chemically competitive processes. Susceptibility to aflatoxin is greatest in the young, and there are very significant differences between species, persons of the same species (according to their differing abilities to detoxify aflatoxin by biochemical processes), and the sexes (according to the concentrations of testosterone). The toxicity of aflatoxin also varies according to many nutritional factors, and recovery from protein malnutrition is delayed by exposure to aflatoxin (Williams et al., 2004).
Symptoms Shown in the Syndrome:
-
Abdominal pain:
-
Description:
The clinical syndrome of aflatoxicosis is characterized by abdominal pain (Website 40).
-
Vomiting:
-
Description:
The clinical syndrome of aflatoxicosis is characterized by vomiting (Website 40).
-
Convulsions:
-
Description:
The clinical syndrome of aflatoxicosis is characterized by convulsions (Website 40).
-
Coma:
-
Description:
The clinical syndrome of aflatoxicosis is characterized by coma (Langford, 2004).
-
Cancer:
-
Description:
For humans, aflatoxin is predominantly perceived as an agent promoting liver cancers, although lung cancer is also a risk among workers handling contaminated grain. The increased risk of hepatomas is caused by deletion mutations in the P53 tumor-suppressing gene and by activation of dominant oncogenes. The risk of cancers due to exposure to the various forms of aflatoxin is well established and is based on the cumulative lifetime dose. The International Cancer Research Institute identifies aflatoxin as a Class 1 carcinogen (Williams et al., 2004).
In many developing countries, epidemics of hepatitis B virus (HBV) and hepatitis C virus (HCV) affect 20% of the population. A strong synergy is observed between aflatoxin and these biological agents for liver cancer. In hepatitis B surface antigen-positive subjects, aflatoxin is approx. 30 times more potent than in persons without the virus, and the relative risk of cancer for HBV patients increases from approx 5 with only HBV infection to approx. 60 when HBV infection and aflatoxin exposure are combined. In some areas where aflatoxin contamination and HBV occur together, hepatomas are the predominant cancer (64% of cancers), and they may be a predominant cause of death: approx 10% of males in Gambia die of liver cancer, and in Qidong, China, 10% of all adult deaths were due to this cancer. Thus, to minimize the risk of liver cancer, it is critically important that exposure of HBV- and HCV-infected persons to aflatoxin is minimized (Williams et al., 2004).
A factor in this greater potency of aflatoxin in HBV-positive people is the finding that HBV reduces the persons ability to detoxify aflatoxin. Whereas this synergy is recognized as an important factor for cancer, it is also of great potential importance for immunologic and nutritional toxicities, because it increases the level of biological exposure (Williams et al., 2004).
-
Burning sensation:
-
Description:
Farmers who clean out moldy grains from storehouses suffer from burning of the eyes, nose and throat (Bhat, 1989).
-
Chills:
-
Description:
Farmers who clean out moldy grains from storehouses suffer from chills (Bhat, 1989).
-
Fever:
-
Description:
Farmers who clean out moldy grains from storehouses suffer from fever (Bhat, 1989).
-
Cough:
-
Description:
Farmers who clean out moldy grains from storehouses suffer from dry irritating coughs (Bhat, 1989).
-
Syndrome --
Aspergillosis (Website 32):
-
Description:
Aspergillosis is caused by a fungus (Aspergillus), which is commonly found growing on dead leaves, stored grain, compost piles, or in other decaying vegetation. It causes illness in three ways: as an allergic reaction in people with asthma (Pulmonary aspergillosis - allergic bronchopulmonary type); as a colonization and growth in an old healed lung cavity from previous disease (such as tuberculosis or lung abscess) where it produces a fungus ball called aspergilloma; and as an invasive infection with pneumonia that is spread to other parts of the body by the bloodstream (Pulmonary aspergillosis - invasive type) (Website 58).
-
Syndrome --
Pneumonia (Hetherington et al., 1994):
-
Description:
At St. Jude Childrens Research Hospital, where immunocompromised pediatric patients have been treated for over 30 years, A. flavus accounts for over 50% of cases of proven Aspergillus pneumonia. A. flavus has been the dominant pathogenic species in one other institution (Hetherington et al., 1994).
-
Syndrome --
Aspergilloma:
-
Description:
This is the most common and best-recognized form of pulmonary involvement due to Aspergillus. The aspergilloma (fungal ball) consists of masses of fungal mycelia, inflammatory cells, fibrin, mucus, and tissue debris, usually developing in a preformed lung cavity. Although other fungi may cause the formation of a fungal ball (for example, Zygomycetes and Fusarium), Aspergillus spp (specifically, A fumigatus) are by far the most common etiologic agents (Soubani et al., 2002).
-
Aspergilloma (Website 60):
Description:
Aspergilloma is a fungus ball that colonizes in a healed lung scar or abscess from a previous disease (Website 60).
-
Syndrome --
Allergic aspergillosis (Website 32):
-
Description:
Colonization of Aspergilli can cause an allergic response in particular individuals who have clinical symptoms of chronic obstructive pulmonary disease (Shibuya et al., 2004).
Allergic Bronchopulmonary Aspergillosis (ABPA) is a hypersensitivity reaction to Aspergillus antigens, mostly due to A. fumigatus. It is typically seen in patients with long-standing asthma or cystic fibrosis, and it is estimated that 7 to 14% of corticosteroid-dependent asthma patients and 6% of patients with cystic fibrosis meet the diagnostic criteria for ABPA. The factors leading to ABPA are not clearly understood. It is believed that Aspergillus specific, IgE-mediated type I hypersensitivity reactions and specific IgG-mediated type III hypersensitivity reactions play a central role in the pathogenesis of ABPA. Other host factors, including cellular immunity, may contribute to the pathologic changes seen in ABPA (Buckingham and Hansell, 2003).
Symptoms Shown in the Syndrome:
-
Fever:
-
Description:
Symptoms of allergic aspergillosis include fever (Website 60).
-
Malaise:
-
Description:
Symptoms of allergic aspergillosis include malaise (Website 60).
-
Cough:
-
Description:
Symptoms of allergic aspergillosis include cough (Website 60).
-
Coughing up blood (Hemoptysis) or brownish mucous plugs:
-
Description:
Symptoms of allergic aspergillosis include hemoptysis (Website 60).
-
Wheezing:
-
Description:
Symptoms of allergic aspergillosis include wheezing (Website 60).
-
Weight loss:
-
Description:
Symptoms of allergic aspergillosis include weight loss (Website 60).
-
Recurrent episodes of lung obstruction:
-
Description:
Symptoms of allergic aspergillosis include recurrent episodes of lung obstruction (Website 60).
-
Syndrome --
Invasive Aspergillosis (Website 32):
-
Description:
The lower respiratory tract is almost always the primary focus of infection as a result of the inhalation of the infectious spores. Less commonly, IPA may start in locations other than the lungs, like the sinuses, the GI tract, or the skin (i.e., resulting from the insertion of IV catheters, prolonged skin contact with adhesive tapes, or burns). Consequently, patients usually present with respiratory symptoms that are consistent with bronchopneumonia, with fever, cough, sputum production, and dyspnea (Soubani et al., 2002).
Immunocompromised hosts have continued to increase in number in recent years due to an increase in number of patients with chemotherapy, HIV infection, organ transplantation, and long-term administration of immuno-suppressants for example. Under these circumstances, invasive fungal infections have been attracting public attention as opportunistic infections in the immunocompromised host for many years (Shibuya et al., 2004).
Invasive oral aspergillosis is a rare complication and only little information on the epidemiology of Aspergillus flavus infection is available (Myoken et al., 2003).
As the three patients with invasive oral aspergillosis detected in 1992 were infected by a single strain of A. flavus, the strain was suspected to have caused a nosocomial outbreak of invasive oral aspergillosis in the hematology unit (Myoken et al., 2003).
A low incidence of the disease in this country was reported: with 50 cases in 14 hospital institutions during a two-year period. We observed most cases in large hospital centres performing transplant operations. Invasive pulmonary aspergillosis was the main clinical setting in immunosupressed patients. Microbiology diagnostic issues relied on conventional methods in particularly on culture (Lopez-Medrano, 2002).
During the last decade the incidence of invasive aspergillosis has substantially grown due to the increasing use of powerful immunosupressive drugs in more patients. Unfortunately, the associated mortality with this infection is still very high and has not decreased in recent years. Pulmonary aspergillosis is by far the most frequent clinical picture of this infection, followed by sinus, tracheo-bronchial and central nervous system disease. The degree of immunosupression is the main factor influencing the evolution and dissemination of aspergillosis (Lumbreras and Gavalda, 2003).
Symptoms Shown in the Syndrome:
-
Fever:
-
Description:
Symptoms of invasive aspergillosis include fever (Website 60).
-
Headaches:
-
Description:
Symptoms of invasive aspergillosis include headaches (Website 60).
-
Chills:
-
Description:
Symptoms of invasive aspergillosis include chills (Website 60).
-
Increased sputum production:
-
Description:
Symptoms of invasive aspergillosis include increased sputum production (Website 60).
-
Cough:
-
Description:
Symptoms of invasive aspergillosis include coughing (Website 60).
-
Shortness of breath (Dyspnea).:
-
Description:
Symptoms of invasive aspergillosis include shortness of breath (Website 60).
-
Weight loss:
-
Description:
Symptoms of invasive aspergillosis include weight loss (Website 60).
-
Chest pain:
-
Description:
Symptoms of invasive aspergillosis include chest pain (Website 60).
-
Bone pain:
-
Description:
Symptoms of invasive aspergillosis include bone pain (Website 60).
-
Blood in the urine (Hematuria):
-
Description:
Symptoms of invasive aspergillosis include hematuria (Website 60).
-
Decreased urine output (Oliguria):
-
Description:
Symptoms of invasive aspergillosis include decreased urine output (Website 60).
-
Brain: meningitis:
-
Description:
Symptoms of invasive aspergillosis include brain meningitis (Website 60).
-
Eye: blindness or visual impairment.:
-
Description:
Symptoms of invasive aspergillosis include blindness or visual impairment (Website 60).
-
Sinuses: sinusitis:
-
Description:
Aspergillosis is the most common fungal disease in the paranasal sinuses (Egami et al., 2003).
-
Heart: endocarditis:
-
Description:
Symptoms of invasive aspergillosis include heart endocarditis (Website 60).
-
Treatment Information:
-
Chemoprotection:
A simple and effective approach to the chemoprevention of aflatoxicosis has been to diminish or block exposure to aflatoxins via the inclusion of aflatoxin-selective clay (HSCAS) in the diet. HSCAS clay acts as an aflatoxin enterosorbent that tightly and selectively binds these poisons in the gastrointestinal tract of animals, decreasing their bioavailability and associated toxicities (Phillips, 1999).
Evidence suggests that aflatoxins may react at multiple sites on HSCAS particles, especially the interlayer region, but also at edges and basal surfaces (Phillips, 1999).
-
Applicable:
-
Contraindicator:
Since clay and zeolitic minerals comprise a broad family of functionally diverse chemicals, there may be significant hidden risks associated with their indiscriminate inclusion in the diet. All aflatoxin binding agents should be rigorously tested, paying particular attention to their effectiveness and safety in aflatoxin-sensitive animals and their potential for interactions with critical nutrients (Phillips, 1999).
-
Surgery (Website 60):
Endocarditis caused by Aspergillus is treated by surgical removal of the infected heart valves and long-term amphotericin B therapy. (Website 60).
-
Antifungal drugs:
The use of anti-fungal agents in ABPA seems to be a rational one, with short-term efficacy demonstrated for the use of itraconazole. Further investigations are required to identify individuals who will benefit most from treatment and to establish the correct dose and means of delivering treatment in ABPA. Longer-term studies are required to demonstrate that treatment modifies the progressive decline in lung function seen with the disease (Wark, 2004).
The goal of treatment is to control symptomatic infection. A fungus ball usually does not require treatment unless bleeding into the lung tissue is associated with the infection, then surgical removal is required. Invasive aspergillosis is treated with several weeks of intravenous amphotericin B, an antifungal medication. Itraconazole or voriconazole can also be used. Allergic aspergillosis is treated with oral prednisone. Some people may benefit from allergy desensitization. (Website 60).
-
Applicable:
-
Contraindicator:
Antifungal agents do not help people with allergic aspergillosis (Website 60).
-
Complication:
Amphotericin B can cause kidney impairment and severely unpleasant side effects. Invasive lung disease can cause massive bleeding from the lung (Website 60).
-
Success Rate:
Gradual improvement is seen in patients with allergic aspergillosis. Invasive aspergillosis may resist drug treatment and progress to death. The underlying disease and immune status of a person with invasive aspergillosis will also affect the overall prognosis (Website 60).
-
Prevention:
-
Prevention measures:
-
Description:
The traditional approach to preventing exposure to aflatoxin has been to ensure that foods consumed have the lowest practical aflatoxin concentrations. In developed countries, this has been achieved for humans largely by regulations that have required low concentrations of the toxin in traded foods. However, as discussed earlier, this approach has certain limitations and clearly has failed as a control measure for developing countries. In developed countries, where regulations allow higher aflatoxin concentrations in animals, the agricultural industries have developed alternative approaches chemoprotection and enterosorption to limit biologically effective exposure without the high cost of preventing contamination. Chemoprotection is based on manipulating the biochemical processing of aflatoxin to ensure detoxification rather than preventing biological exposure. Enterosorption is based on the approach of adding a binding agent to food to prevent the absorption of the toxin while the food is in the digestive tract; the combined toxin-sorbent is then excreted in the feces. This approach has been used extensively and with great success in the animal feeding industry. The effective enforcement of regulations defining the concentrations of aflatoxins permitted in various foods in North America and Europe has turned aflatoxin into a problem with significant economic but minor human health consequences. To prevent the economic loss associated with failure to meet the regulations, a significant body of research has been published relating to 3 main points of leverage-production, storage, and processing (Williams et al., 2004).
-
Model System:
-
Mus musculus:
-
Model Host:
Vertebrates.
(Shibuya et al., 2004)
-
Model Pathogens:
-
Description:
A major aim of experimental study with animal models of aspergillosis is to gain insight into the pathogenesis of human aspergillosis (Shibuya et al., 2004).
A large number of studies have been conducted, using a variety of experimental models of the disease. Fatal experimental infections leading to multiple organ involvement have been most frequently produced in mice with an intravenous injection of conidia suspension. This type of murine model has been demonstrated to be effective in evaluating antifungal agents. The most frequently used animal model of aspergillosis is that produced in the mouse, as it has various merits for experimental studies. In addition to the convenience of handling in laboratories, various inbred strains, in which immunological and genetic defects are clearly known, are easily obtainable. Inbred mice can be the most suitable animals for analyzing defense mechanisms and cytokine cascades of the host against Aspergillus sp. In the past, mice lethally infected by intravenous inoculation of a conidial suspension were often used to evaluate the efficacy of novel drugs on the basis of mortality and organ cultures, as well as to test the virulence of different strains of Aspergilli. More recently, however, such intravenous models have been less frequently used. Currently, the route of infection chosen most frequently is the respiratory tract because it reflects the natural route of Aspergillus infection in humans. Most of these murine models, usually reported as IPA models, are developed in animals pretreated with some immunosuppressive or myelotoxic agents to induce granulocytopenia. Mostly, mice are intranasally inoculated with a conidial suspension, but airborne models in which mice are infected by aerosol aspiration of Aspergillus conidia have also been reported. If the usage of experimental infection were limited to an induction of primary lesions in lungs, these intranasal models might be satisfactory (Shibuya et al., 2004).
-
Oryctolagus cuniculus:
-
Model Host:
Vertebrates.
(Shibuya et al., 2004)
-
Model Pathogens:
-
Description:
Next to the mouse, the rabbit has been most frequently used to generate a model of Aspergillus infection. Recently, rabbits are commonly used to produce a primary pulmonary infection to elucidate the pathogenesis of IPA, to evaluate the clinical usefulness of newly developed antifungal agents, and to establish and test new serodiagnostic procedures. The rabbit may be large enough to accommodate a laryngoscope to inoculate a conidial suspension by insertion of catheter. This may be an important merit because a short cervical incision, which is usually performed to expose the trachea of the animals treated with immunosuppressive drugs, increases the risk of bacterial infection. Furthermore, rabbit models are advantageous over mouse or rat models in that a rabbit is much larger, making it possible to perform serial sampling of serum from an infected individual, detailed histopathological observation of pulmonary lesions, and cytological examination of bronchoalveolar lavage specimens. In this sense, rabbits infected by respiratory tract injection of conidial suspension are considered suitable IPA models. Besides, rabbits infected by intravenous injection of a conidial suspension also provide experimental models for some specific forms of systemic aspergillosis such as endophthalmitis and endocarditis (Shibuya et al., 2004).
-
Rattus spp.:
-
Model Host:
Vertebrates.
(Shibuya et al., 2004)
-
Model Pathogens:
-
Description:
Rat models. The rat is another species of laboratory animal that has often been used for experimental investigations of aspergillosis because it is of a suitable size for producing a primary pulmonary infection by Aspergilli. We recently reported a new rat IPA model which was produced by an intratracheal injection of agarose beads containing A. fumigatus conidia, accurately delivered to the alveoli The histopathological findings of the pulmonary lesions obtained in this rat model are closely similar to those for IPA in humans. In addition, the development of fungal emboli, which is also known to be characteristic of the pathology of IPA, is clearly demonstrated (Shibuya et al., 2004).
-
Vertebrates:
-
Taxonomy Information:
-
Species:
-
Horses
(Website 55):
-
GenBank Taxonomy No.:
9796
-
Scientific Name:
Equus caballus (Website 55)
-
Description:
Corn from an Arkansas farm, where three horses died and others became sick, was investigated for causative principles. Necropsy of the three horses revealed what appeared to be severe hepatic necrosis. Histopathological examination indicated a pattern of hepatic lesions that was suggestive of aflatoxin contamination of the feed. Mycological examination of the corn by dilution plating revealed 95% of the colonies as Aspergillus flavus. Chemical analysis of the corn for mycotoxins was positive for aflatoxin B1, B2, and M1 at concentrations of 114, 10, and 6 micrograms/Kg, respectively (Vesonder et al., 1991).
The presence of aflatoxin metabolites in the moldy corn and the presence of appropriate lesions were compatible with the diagnosis, equine aflatoxicosis (Vesonder et al., 1991).
-
Cow
(Website 9):
-
GenBank Taxonomy No.:
9913
-
Scientific Name:
Bos taurus (Website 9)
-
Description:
An outbreak of mortality in Friesland dairy calves in which 7 out of 25 calves died in the western Cape Province, Republic of South Africa is described. Clinical signs included a loss in body mass, staring hair coat, diarrhoea and rectal prolapse. Histopathological changes in the liver were characterised by severe portal fibrosis with bile duct proliferation and mild portal round cell infiltration. The calves were fed a ration containing locally-produced maize. The implicated maize was infested with Aspergillus flavus and contained aflatoxins B1, B2, G1 and G2 with total aflatoxin levels as high as 11,790 ng/g. This is the first report of a field outbreak of bovine aflatoxicosis in South Africa (van Halderen et al., 2000).
Aflatoxins are both teratogenic and carcinogenic, the liver is the principal organ affected in most species. Aflatoxin B1 is considered a carcinogen by the International Agency for Research on Cancer. Lactating mothers excrete aflatoxins in the milk thereby directly affecting the nursing animal. All species of animals are susceptible, however susceptibility to aflatoxicosis depends on the species, age, and nutritional status of the animal. Young members of the species are usually more susceptible to the acute effects of the disease. Adverse effects on animals may be expressed as liver damage, gastrointestinal dysfunction, anemia, reduced feed consumption, reduced reproductivity, immune suppression, decreased milk and egg production and overall retarded growth and development (Vesonder et al., 1991).
-
Dog
(Website 29):
-
GenBank Taxonomy No.:
9615
-
Scientific Name:
Canis familiaris (Website 29)
-
Description:
Aflatoxins are hepatotoxic in many species including dogs. In two separate outbreaks, the primary signalment was high morbidity and mortality in hunting dogs presenting with clinical signs of icterus, anorexia and listlessness. Preliminary laboratory examinations revealed toxic hepatitis, bilirubinuria and anemia. In the first case, a feed sample was not available and the diagnosis was established by confirming the presence of significant levels of aflatoxin B1 in tissues. In the second case, cornmeal utilized in formulating the ration contained 511 ng aflatoxin B1 and B2/g. These cases illustrate that aflatoxicosis is a continuing problem despite widespread awareness and testing for aflatoxin (Liggett et al., 1986).
Mycotoxins cause illness and lethality in domestic animals fed moldy feedstuffs. These acute intoxications can have devastating effects and are difficult to diagnose and treat because the suspect feed may be consumed before it can be tested (Task Force Report, 2003).
-
Turkey
(Website 71):
-
GenBank Taxonomy No.:
8835
-
Scientific Name:
Meleagris gallopavo (Website 71)
-
Description:
In 1960 more than 100,000 young turkeys on poultry farms in England died in the course of a few months from an apparently new disease that was termed Turkey X disease. It was soon found that the difficulty was not limited to turkeys . Ducklings and young pheasants were also affected and heavy mortality was experienced. A careful survey of the early outbreaks showed that they were all associated with feeds, namely Brazilian peanut meal . An intensive investigation of the suspect peanut meal was undertaken and it was quickly found that this peanut meal was highly toxic to poultry and ducklings with symptoms typical of Turkey X disease. Speculations made during 1960 regarding the nature of the toxin suggested that it might be of fungal origin. In fact, the toxin-producing fungus was identified as Aspergillus flavus (1961) and the toxin was given the name Aflatoxin by virtue of its origin (Afla from flavis) (Lancaster et al., 1961).
-
Ducks
(Website 37):
-
GenBank Taxonomy No.:
8835
-
Scientific Name:
Anas (Website 37)
-
Description:
Ducklings are the most susceptible class of livestock to aflatoxicosis and are preferentially used in bioassay for aflatoxins in feeds. Ducklings showed a depressed utilization of dietary protein on diets containing only 70 ug aflatoxin B1/ Kg (Reed and Kasali, 1989).
-
Chicken
(Website 38):
-
GenBank Taxonomy No.:
9031
-
Scientific Name:
Gallus gallus (Website 38)
-
Description:
Generally chickens will show depressed levels of performance on diets containing more than 250 ug /Kg aflaltoxin B1, at higher levels (more than 500 ug /Kg), liver lesions become severe (Reed and Kasali, 1989).
-
Pig
(Website 39):
-
GenBank Taxonomy No.:
9823
-
Scientific Name:
Sus scrofa (Website 39)
-
Description:
Relatively low concentrations of aflatoxin B1 (182 ug/ Kg) reduce the average daily gain and feed efficiency in piglets fed with contaminated maize, but this effect was reversed by increasing the concentration of pure protein in the diet, and by addition of fat (Reed and Kasali, 1989).
-
Rainbow trout
(Website 30):
-
GenBank Taxonomy No.:
8022
-
Scientific Name:
Oncorhynchus mykiss (Website 30)
-
Description:
The first documented incidences of aflatoxicosis affecting fish health occurred in the 1960s in trout hatcheries. Domesticated rainbow trout (Oncorhynchus mykiss) that were fed a pelleted feed prepared with cottonseed meal contaminated with aflatoxins, developed liver tumors. As many as 85% of the fish died in these hatcheries. Although cottonseed meal is no longer used as a major ingredient in feed formulations, poor storage of other feed ingredients and complete feeds can lead to contamination with aflatoxins. Initial findings associated with aflatoxicosis include pale gills, impaired blood clotting, anemia, poor growth rates or lack of weight gain. Prolonged feeding of low concentrations of AFB1 causes liver tumors, which appears pale yellow lesions and which can spread to kidneys. Increases in mortality (higher number of dead fish) may also be observed (Website 57).
-
Infection Process:
No infection process information is currently available here.
-
Disease Information:
No disease information is currently available here.
-
Prevention:
No prevention information is currently available here.
-
Model System:
No model system information is currently available here.
-
Insects:
-
Taxonomy Information:
-
Species:
-
Insects
(Website 11):
-
GenBank Taxonomy No.:
6960
-
Scientific Name:
Hexapoda (Website 11)
-
Description:
A. flavus is also pathogenic to many insects and sporulates on dead hosts (Diener et al., 1987)
-
Domestic silkworm
(Website 14):
-
GenBank Taxonomy No.:
7091
-
Scientific Name:
Bombyx mori (Website 14)
-
Description:
Aspergillosis is a common disease of the silkworm (Bombyx mori Linn.), caused by an insect mycopathogen Aspergillus flavus (Kumar et al., 2004).
Diseases of silkworm have been a subject of intensive studies because of their commercial importance for silk-producing countries (Kumar et al., 2004).
A. flavus invades the larval stages of B. mori (Kumar et al., 2004).
-
Infection Process:
No infection process information is currently available here.
-
Disease Information:
No disease information is currently available here.
-
Prevention:
No prevention information is currently available here.
-
Model System:
No model system information is currently available here.
-
Plant:
(Website 44:
-
Taxonomy Information:
-
Species:
-
Yam
(Website 53):
-
GenBank Taxonomy No.:
55571
-
Scientific Name:
Dioscorea alata (Website 53)
-
Description:
Aflatoxin was detected in 98% of samples of dried yam chips surveyed in Benin with levels ranging from 2.2 to 220 ug/kg and a mean value of 14 ug/kg. Aflatoxin B1 was detected in 22% of yam chips in Ogun and Oyo States of Nigeria, while in a larger survey conducted later, 54.2% of dried yam chips were contaminated with aflatoxin B1 (4 186 ug/kg; mean = 23 ug/kg), 32.3% with aflatoxin B2 (2- 55 ug/kg), while 5.2% were positive for aflatoxin G1 (4-18 ug/kg), and two samples tested positive for aflatoxin G2 (Bankhole and Adebanjo, 2003).
-
Peanut (groundnuts)
(Website 4):
-
GenBank Taxonomy No.:
3818
-
Scientific Name:
Arachis hypogaea (Website 4)
-
Description:
A. flavus can colonize peanuts pods before and after harvesting (Pass et al., 1971).
Peanut flowers inoculated with washed conidia of A. flavus were readily colonized by the fungus (Diener et al., 1987).
Experimentally, fresh opened flowers were inoculated by pulling down the keel, exposing the stigma and stamens, and gently dusting the exposed parts with conidia. In 48 hours, conidia had germinated and considerable hyphae had formed (Diener et al., 1987).
Studies have indicated that spores of A. flavus may germinate under certain conditions within the layer of soil adjacent to peanut peg or fruits (geocarposphere) and roots (rhizosphere). Germination of conidia was reported to be high in soil adjacent to fruits following mechanical injury of the shell (Griffin, 1970).
Groundnuts cultivated in Northern Nigeria were contaminated with aflatoxin levels up to 2000 ug/kg. The conditions of the shells was found to be of importance in relation to fungal contamination, and A. flavus was commonly associated with kernels from broken pods, and that most toxic samples come from this grade of pod. Damage to shells, which occur while the crop is in the ground, was found to predispose the kernels to contamination with aflatoxins. Akano and Atanda found aflatoxin B1 concentrations in the range of 20- 455 ug/kg in groundnut cake (kulikuli) purchased from markets in Ibadan, Oyo State, Nigeria. Adebajo and Idowu reported that most of the corn-groundnut snack (donkwa) contained aflatoxins above 30 ug/kg immediately after preparation. Yameogo and Kassamba reported that seeds of groundnuts from Burkina Faso inoculated with A. flavus excreted all the four major aflatoxins, which peaked at 170 ppb after 6 days. Aflatoxin formation in groundnut is favoured by prolonged end of season drought and associated elevated temperature (Bankhole and Adebanjo, 2003).
-
Upland cotton
(Website 5):
-
GenBank Taxonomy No.:
3635
-
Scientific Name:
Gossypium hirsutum (Website 5)
-
Description:
Cotton seeds are particularly susceptible to invasion, both in the field and during storage (Website 10).
Aspergillus flavus is commonly associated with boll rot of cotton. The fungus stains and weakens the lint fibre. Seed infection results in reduced quality and viability and the production of aflatoxin (Website 10).
-
Pistachio
(Website 6):
-
GenBank Taxonomy No.:
55513
-
Scientific Name:
Pistacia vera (Website 6)
-
Description:
Kernel decay has increased in importance because of rising concern about contamination by mycotoxin, especially aflatoxins. Decays caused by A. flavus and A. parasiticus are rare occurring in pistachio (Scheidegger and Payne, 2003)
-
Black walnut
(Website 68):
-
GenBank Taxonomy No.:
16719
-
Scientific Name:
Juglans nigra (Website 68)
-
Description:
Kernel decay has increased in importance because of rising concern about contamination by mycotoxin, especially aflatoxins. Decays caused by A. flavus and A. parasiticus are rare occurring in walnut (Scheidegger and Payne, 2003).
-
Pecan
(Website 69):
-
GenBank Taxonomy No.:
32201
-
Scientific Name:
Carya illinoinensis (Website 69)
-
Description:
Kernel decay has increased in importance because of rising concern about contamination by mycotoxin, especially aflatoxins. Decays caused by A. flavus and A. parasiticus are rare occurring in pecan (Scheidegger and Payne, 2003)
-
Almond
(Website 70):
-
GenBank Taxonomy No.:
3755
-
Scientific Name:
Prunus dulcis (Website 70)
-
Description:
Kernel decay has increased in importance because of rising concern about contamination by mycotoxin, especially aflatoxins. Decays caused by A. flavus and A. parasiticus are rare occurring in almond (Scheidegger and Payne, 2003).
-
Sugarcane
(Website 7):
-
GenBank Taxonomy No.:
4547
-
Scientific Name:
Saccharum officinarum (Website 7)
-
Description:
The distribution of Aspergillus flavus and Aspergillus parasiticus in sugarcane field soils and on harvested sugarcane stems was studied on seven islands of Okinawa and Kagoshima Prefectures, the southernmost prefectures in Japan. With the use of a combination of dilution plate and plant debris plate techniques, the fungi were detected on all seven islands studied and in 74% of 53 soil samples. The fungi were also found on the cut surfaces of sugarcane stems from one of the islands. A. parasiticus was the predominant fungus, although many atypical A. parasiticus isolates that produced metulated conidial heads were also obtained. The proportions of isolates testing positive for aflatoxin production were ca. 89% (146 of 164) of all isolates and ca. 69% of A. flavus isolates. More than 40% of A. flavus isolates also produced G aflatoxins. Scanning electron microscopic observation of conidial wall texture was useful in distinguishing A. parasiticus from A. flavus. Cyclopiazonic acid, an indole mycotoxin, was never synthesized by any of the A. parasiticus or G aflatoxin-producing A. flavus isolates tested (Takahashi et al.).
-
Corn
(Website 51):
-
GenBank Taxonomy No.:
4577
-
Scientific Name:
Zea mays (Website 51)
-
Description:
Distribution of trace element levels in corn germ fractions from kernels naturally infected with Aspergillus flavus and from kernels free of the fungus demonstrated an association between the presence of A. flavus and higher levels of metals. A. flavus production of aflatoxin on various autoclaved corn media showed that ground, whole corn was an excellent substrate; similar high levels of toxin were observed on full-fat corn germ but endosperm and defatted corn germ supported reduced yields. The influence of trace elements and their availability in defatted corn germ to A. flavus-mediated aflatoxin biosynthesis were measured. Enrichment of the substrate with 5 to 10 ug of manganese, copper, cadmium, or chromium per g of germ increased toxin yields. Addition of lead or zinc (50 to 250 ug/g) also enhanced toxin accumulation. Aflatoxin elaboration was reduced by the addition of 25 ug of cadmium per g or 500 ug of copper per g of germ (Lillehoj et al., 1974).
-
Infection Process:
-
Description:
The exact mode of entry is still not clear. The fungus may invade thin-walled cells at the junction between the bracts and their rachillas or it may grow through the air space leading from the cob into the spikelet. Whatever route taken, it is likely that A. flavus grows through the barrier that is the easiest to penetrate. Therefore, while not essential for infection, wounds made by insect feeding would provide an easy mode of entry for the invading fungus. Once Aspergillus flavus is present in plant tissue, it can continue to grow and to produce aflatoxin, and toxin levels in improperly stored infected plant tissue can continue to increase long after harvest. While this has severe consequences for the food and feed supply, saprophytic growth is also important to consider in the life cycle of this pathogen. Infected plant tissue such as corn kernels, cobs, and leaf tissue can remain in the soil and support the fungus until the following season when newly exposed mycelium or sclerotia can give rise to conidial structures, thus producing the primary inoculum for the next infection cycle (Payne and Brown, 1998).
Jones showed that A. flavus is able to infect corn even in an insect-free environment. The fungus will colonize silk tissue (Jones et al., 1980)
that are in the yellow-brown stage of senescence (Marsh and Payne, 1984).
and grow down the silks to the kernels where it can infect developing kernels (Jones et al., 1980).
Germination occurred first nearest the pollen grains, and the hyphae spread rapidly across the silk, producing extensive grow and lateral branching (Marsh and Payne, 1984).
Pollen seems to play a critical role in the establishment of A. flavus growth on external silks (Marsh and Payne, 1984)
Preharvest invasion of corn kernels occurs via the tip cap (Marsh and Payne, 1984).
Working with peanuts under field conditions in Virginia, he concluded that A. flavus in soil may be induced to germinate adjacent to developing peanuts fruits, particularly following injury of the fruits. Colonization of the peanut fruit by A. flavus may follow (Griffin, 1970).
He observed much higher levels of A. flavus conidial germination in soil adjacent to injured peanuts fruits than on aerial peanut pods (Griffin, 1970).
Twenty-seven mature cotton bolls with Aspergillus flavus Link colonies naturally occurring on the surface of the boll or lint were collected in the field in Arizona along with their subtending stems and peduncles (Klich et al., 1986).
Seventy-eight percent of the naturally contaminated bolls with A. flavus in the seed also had the fungus in the stem and peduncle, whereas only 31% of the naturally contaminated bolls with no A. flavus in the seed had the fungus in the stem or peduncle. This difference was significant, indicating a positive relationship between seed infection and stem and peduncle infection. All of the bolls inoculated through the carpel wall had A. flavus in the seed, but only 11% of the stem and peduncle sections were infected, indicating that the fungus does not readily grow downward from the boll into the supporting stem or peduncle. This unidirectional pattern of movement (upward) was further substantiated in greenhouse experiments (Klich et al., 1986)
-
Disease Information:
-
Corn ear rot
(i.e., Aspergillus flavus infection)
(Website 32):
-
Pathogenesis Mechanism:
Smart et al. describe the histology of fungal development in maize ears wound inoculated with A. flavus. The fungus spreads from the wound sometime after 14 days postinoculation, and at 28 days postinoculation it could be found in small amount throughout all rachis tissues except the pith and lignified fibers. The fungus entered the rachillae of adjacent spikelets from the rachis and also from then bracts at their insertion point. The fungus grew through the aerenchyma in the rachilla to the floral axis and innermost layers of the pericarp (the endocarp). Hyphae did not penetrate the endocarp from the exterior of the pericarp. The hyphae were always intercellular in the rachis, rachilla, and pericarp. They were both inter and intracellular in the floral axis and internal to the testa (i.e., inside the seed proper). From the endocarp, entry into the seed was not across the black layer; random tears in the testa over the embryo were the probable immediate pathway. Hyphae were vacuolated everywhere except in the seed. Host cell died (and even collapsed) ahead of the fungus, but no other structural alterations were seen (Smart et al., 1990).
The pathogenic ability of A. flavus is of great importance from an agricultural and economic standpoint. A flavus appears to spend most of its life growing as a saprophyte in the soil. Growth of the fungus in this habitat is supported largely by the presence of plant and animal debris. Fungal mycelium appears to be the predominant structure found in the soil, but sclerotia can be formed, thus contributing to the long-term survival of the fungus. A. flavus has no known sexual stage, and primary infection therefore occurs through the dissemination and germination of conidia (Horn et al., 1996).
Although A. flavus is able to grow on virtually any stored crop or resulting food product, it is of major concern on corn, cottonseed, peanuts, and tree nuts. The fungus is well-known for its aggressiveness as a storage rot and its ability to produce aflatoxin in colonized seeds and grain. Most often, however, A. flavus infection and aflatoxin contamination is a problem long before harvest. Aflatoxin levels are closely monitored in food products, and pre-harvest infection even in a proportionately small amount of plant tissue can mean rejection of an entire crop. Pre-harvest contamination has been observed on each of the commodities listed above, but the most work on the infection process has been done with A. flavus ear rot on corn (Scheidegger and Payne, 2003).
-
Diagnosis Overview:
-
Symptom Information
:
-
Aspergillus ear rot (Website 10):
-
Description:
Symptoms first appear as spots on the cotyledons of the seedlings. Seedlings and ungerminated seeds shrivel to become a dried brown to black mass covered by yellow or green spores. Plants that survive germination and emergence appear chlorotic due to the presence of aflatoxin throughout the plant. The roots are stunted and lack a secondary root system, a condition known as aflaroot. The leaves are small and pointed with a thick and leathery texture. Infected seedlings may survive infection in optimal growing conditions, then yellow mould of peanut pods and seeds may occur, especially in dry conditions. Following harvest, further infections may develop, with fungal growth covering the seed surface and invading the seed itself. A yellow to brown discolouration, and weight loss occurs as a result (Website 10).
-
Fusarium ear rot (Website 56):
Description: Ear rot of corn
-
Treatment Information:
-
Biological control (Website 33):
Biological control by introducing atoxigenic strains of A. flavus and A. parasiticus to soil of developing crop is one strategy that has recently gained prominence in literature. The introduction of various combinations of atoxigenic A. flavus and A. parasiticus into soil resulted in 74.3 to 99.9% reduction in aflatoxin contamination of peanuts in the US. The application of non-aflatoxigenic strain of A. flavus around developing cotton plants led to a 68-87% reduction in aflatoxin contamination (Bankhole and Adebanjo, 2003).
Essential oils from Azadirachta indica and Morinda lucida were found to inhibit the growth of a toxigenic A. flavus and significantly reduced aflatoxin synthesis in inoculated maize grains. It should be noted that despite the vast literature on the efficacy of plant material in controlling mycotoxigenic moulds, there has not been any concerted effort of a large-scale trial of these plants on the farmers field (Bankhole and Adebanjo, 2003).
-
Knockout gene:
Current control and prevention methods can only slightly decrease the presence of aflatoxin contamination. Certain studies done on aflatoxin show that drought and heat provide a suitable environment for the growth of aflatoxin. Moreover, the biological circuit for the biosynthesis of aflatoxin has been partially created and is continually updated. Therefore, a possible solution to the problem could be found in the genetic manipulation of the biological circuit. Several possible alterations could be done, but we have found that the most effective and feasible manipulation would be to knock out the X gene, the last gene in the cluster. In this manner, only aflatoxins are removed (Website 62).
-
Fumigation (Website 34):
Seed fumigation with ethylene oxide and methyl formate was found to significantly reduce the incidence of fungi including toxigenic species on store groundnuts and melon seeds, reported that sodium chloride (2.5, 5.0 and 10.0%), propionic acid (1.0, 2.5 and 5.0%), acetic acid (1.0, 2.5 and 5.0%) inhibited aflatoxin B1 production in A. flavus inoculated groundnuts and maize kept in gunny bags. However, all treatments except sodium chloride have adverse effect on seeds germination and viability (Bankhole and Adebanjo, 2003).
-
Scout fields:
These toxins tend to be higher in corn that has experienced insect damage, so insect-damaged fields should be checked for symptoms of molds. To check for ear rots, strip back the husks on at least 100 plants scattered throughout the field. Scout fields separately according to hybrid, tillage and rotation history, and planting date. It is important to be able to recognize the ear rot diseases because their potential for impact is highly dependent on the particular fungus involved (Website 56).
When evaluating an ear rot problem, remember that certain ear rots are a warning sign to suspect toxins, but ear rots do not always lead to toxin problems. When potentially toxigenic ear rots are noticed in the field, grain can be managed so as to minimize toxin development. If more than approximately 10 percent of ears have a significant amount of mold (25 percent of the ear or more), these fields should be harvested and the corn dried as soon as possible. The combine removes some of the moldiest kernels (Website 56).
-
Applicable:
-
Success Rate:
The best option for moldy grain is to feed it or sell it instead of storing it. However, it should be tested for toxins before feeding. Testing for mycotoxins can be done before putting the grain in storage. The best sampling method is to take a composite sample of at least 10 pounds from a moving grain stream, or to take multiple probes in a grain cart or truck for a composite 10-pound sample. If toxins are present, it is possible that the grain can be fed to a less sensitive livestock species, such as beef cattle, depending on the specific toxin and its concentration. A veterinarian or extension specialist can help with these decisions. If the grain is sold, there may be a reduced price due to mold damage (Website 28).
-
Prevention:
-
Cultural practices:
-
Description:
PREHARVEST: Cultural practices designed to reduce mycotoxin contamination of crops have their roots in plant disease epidemiology. The general strategy is to alter the conditions under which the crop is grown so that infection by the offending fungus or fungi is avoided. Tactics employed in this struggle include those used to battle most plant diseases: tillage practices, fertilization practices, crop rotation, plant population, planting date, and irrigation (Munkvold, 2003).
Mycotoxin contamination in maize depends on the coincidence of host susceptibility, environmental conditions favorable for infection, and, in some cases, vector activity. Because of the importance of timing in the events leading to infection, a change in planting date can significantly affect mycotoxin accumulation. In maize, earlier planting dates in temperate areas generally result in a lower risk, but annual fluctuations in weather can jeopardize this advantage. Cultural practices that tend to expose plants to greater drought stress will lead to higher levels of aflatoxins (Munkvold, 2003).
Jones et. al., in 1981 reported on a study conducted to determine the influence of several cultural practices, including planting date and harvest date, on the development of aflatoxin in short-season, mid-season, and full-season cultivars at three locations in North Carolina. The results of these studies showed that corn planted in April contained about one-third of the aflatoxins found in corn planted in May (averaged across the varieties, location, and years). Although the results were influenced by location and year, there was a significant association of high aflatoxin levels with delayed harvest. The short-season and mid-season hybrids used in this study contained less aflatoxins than the full-season hybrid. Although these data agree nicely with the trends noted in the surveys conducted in North Carolina, scientists in other states in the southeast have reported opposite trends. The reason for this variation has not been adequately explained, but it may be due to the amount of stress that the plants are under at time of pollination (Jones et al., 1981).
They reported that irrigation did greatly reduce the number of kernels infected and the levels of aflatoxins regardless of hybrid. The level of aflatoxin contamination at time of harvest in this study was correlated with the number of spores of A. flavus in the atmosphere, particularly at the time the full-season hybrids were pollinating. The degree of drought stress, particularly at time of pollination, was also correlated with aflatoxin levels (the greater the stress, the higher the aflatoxin contamination). Although drought stress is very important in the aflatoxin problem, it is not the only stress factor that can have an influence. For example, nitrogen stress can also influence the level of aflatoxin. Insect damage and other stress factors that alter normal kernel morphology have also been reported as being important contributors to the aflatoxin problem. However, in the study reported a poor correlation with the insect damage and aflatoxin concentration was found (Jones et al., 1981).
A study conducted in Mexico demonstrated that a combination of cultural practices (early planting, reduced plant population, and irrigation), hybrid selection, and insect control reduced aflatoxin concentrations down to 0 to 6 ng/g, compared to 63 to 167 ng/g in late-planted, nonirrigated maize at a higher plant population without insect control (Munkvold, 2003).
-
Cultural practices:
-
Description:
HARVEST AND DRYING: Management of mycotoxins requires late-season scouting in order to make informed decisions about harvest timing, postharvest grain handling, storage, and marketing. Timing of harvest can have major consequences for the ultimate level of mycotoxin accumulation. In general, earlier harvest results in lower concentrations of mycotoxins. While grain dries slowly in the field, moisture content remains high enough to allow continued development and toxin production by fungi that infect kernels preharvest. Insects may continue to feed on maize in the field late in the season, enhancing the ability of fungi to attack the kernels. On the other hand, if there is little preharvest infection, if insect activity is not a serious problem, and if weather conditions are favorable for grain drying, it can be safe to allow field drying to proceed to desirable moisture levels. To assess the need to harvest early, scouting in the field is necessary. Physical damage to grain during harvest and transportation contributes to the potential for mycotoxins to develop. Field shelling in a mechanical combine subjects the kernels to direct physical contact with the moving parts of the harvesting equipment. This damage, and the vulnerability of the grain to toxigenic storage fungi, can be reduced by adjusting the combines cylinder speed and clearance. Furthermore, harvested grain quality can be improved by increasing the combine fan speed so that the low-density, moldy kernels are discarded through the back of the combine. This strategy has obvious limitations; discarded grain is an economic loss, so it is undesirable to discard more than a low percentage of the grain. After harvest, reducing grain moisture by artificial drying is a valuable tool for arresting fungal development and mycotoxin production. The objective of grain drying is to reduce moisture content to the extent that molds, both toxigenic and nontoxigenic, are not able to grow or remain physiologically active. Artificial drying can involve natural gas burners (50 to 82C) or ambient or low-temperature drying. Ambient-air drying can be used in the upper Midwest only if harvested maize is not higher than about 25% moisture. This process is most successful at temperatures between 4 and 15C and fairly low relative humidity between 55% and 75%. Grain with significant ear rot or head scab symptoms from the field should be dried at high temperature as quickly as possible to minimize the risk of mycotoxin development. The lower the moisture content in storage, the lower the risk of mycotoxin development (Munkvold, 2003).
-
Cultural practices:
-
Description:
POSTHARVEST: In addition, grain storage practices can be altered to decrease the likelihood of postharvest mycotoxin development (Munkvold, 2003).
Mold development can arise in storage because of moisture variability within the grain mass or moisture migration that results from rapid grain cooling along the bin walls (Munkvold, 2003).
Storage facilities should be thoroughly cleaned before the new crop is stored, because grain residue will often harbor large populations of storage molds. Storage temperature is the most critical factor in managing potential mycotoxin problems in dried grain. Ideally, grain should be cooled after drying and maintained at 1 to 4C for the duration of storage. At this temperature, fungal metabolism is minimal. During the summer months, grain temperature can be maintained between 10 and 15C. Temperature control is achieved by aerating the grain when outside air temperature is within the desired range and humidity is low. Aeration is essential for maintaining grain quality in storage, by controlling temperature and evaporating moisture that has migrated and condensed in the bin (Munkvold, 2003).
Postharvest management of mycotoxins in high-moisture maize or silage also depends on proper storage conditions. These materials are stored in sealed storage facilities, where the goal is to establish anaerobic conditions. Under these conditions, toxigenic fungi are not able to grow and produce mycotoxins, although performed mycotoxins will persist (Munkvold, 2003).
Insect activity in stored grain promotes the development of toxigenic fungi, so controlling insects will help reduce the risk of molds and mycotoxins. Insect control in stored grain requires an integrated approach, including sanitation, good control of grain moisture and temperature, frequent monitoring, and chemical treatments. Sanitation includes cleaning the grain and the empty bin to remove fines, broken kernels, and other debris that provide breeding sites and food for storage insects. The area around the bin also should be kept clean and free of vegetation (Munkvold, 2003).
-
Genetic resistance:
-
Description:
Native Resistance: Currently, there are several well-characterized sources for resistance to A. flavus infection or aflatoxin production. Inheritance studies have shown additive and dominant gene activity in crosses between resistant and susceptible inbreds. The resistance in some of these sources has been linked to one or more kernel proteins that inhibit either fungal growth or aflatoxin production (Munkvold, 2003).
Currently, maize hybrids with improved resistance to A. flavus and aflatoxins are being used, but the level of resistance is not yet adequate to prevent unacceptable aflatoxin concentrations in some fields. Active breeding programs are under way in the public sector (Munkvold, 2003).
Aspergillus flavus infection and the subsequent accumulation of aflatoxin in corn grain are major limitations to profitable corn production in the southern United States. This investigation was conducted to determine the effect of southwestern corn borer feeding on aflatoxin accumulation and to determine the effectiveness of transgenic corn hybrids expressing the delta endotoxin insecticidal (Cry delta Ab) proteins isolated from Bacillus thuringiensis (Bt) in reducing aflatoxin accumulation (Williams et al., 2004).
The results of this investigation indicate that these transgenic corn Bt hybrids should be effective in reducing aflatoxin contamination in areas where high southwestern corn borer infestations occur. The reduced levels of aflatoxin accumulation associated with transgenic corn Bt hybrids are likely a consequence of reduced insect damage rather than resistance to A. flavus infection or aflatoxin accumulation per se (Williams et al., 2004).
Transgenic Resistance: The third strategy could involve engineering plants to produce proteins or compounds that interfere with mycotoxin biosynthesis, or altering the plant genome so that it fails to produce signaling compounds involved in mycotoxin biosynthesis. Several genes involved in aflatoxin biosynthesis have been cloned, parts of the aflatoxin biosynthesis gene cluster have been mapped, and knowledge of regulation of aflatoxin biosynthesis genes is growing. One evolving strategy involves the inhibition of alfa-amylase in Aspergillus spp, a mechanism that may already be functional in the native resistance to aflatoxin production found in some maize inbreds. The 14-kDa trypsin-inhibiting protein identified in several resistant inbreds is also an inhibitor of -amylase. An alfa-amylase inhibitor from the legume Lablab purpureus inhibited aflatoxin production, spore germination, and hyphal growth by A. flavus. This protein appears to be 37 times more active than the alfa-amylase inhibitor from maize, and is a candidate for expression in genetically altered maize plants (Munkvold, 2003).
-
Model System:
-
Plant (Website 44):
-
Model Host:
Pistacia vera
.
Aflatoxin contamination is associated with wounding in corn, peanut, cotton seed and tree nut. Assessment of the efficacy of P. anomala has been achieved by mechanically wounding pistachio nuts on the tree in the orchard to increase the number of wounded nuts. The results clearly demonstrate that the production of A. flavus spores was drastically inhibited by spraying yeast onto wounded pistachio nuts. One can anticipate that field spraying of this effective yeast to pistachio trees will decrease the population of A. flavus in the orchards. The outcome will be a reduction of aflatoxin contamination in the edible nuts. Using pistachio as a model system, similar results can be predicted for almond (Sui-Sheng, 2004).
-
Model Pathogens:
-
Aspergillus flavus
.
The results clearly demonstrate that the production of A. flavus spores was drastically inhibited by spraying yeast onto wounded pistachio nuts (Sui-Sheng, 2004).
IV. Labwork Information
A. Biosafety Information:
-
General biosafety information
:
-
Precautions:
-
Decisions to feed aflatoxin-contaminated corn should be based on (1) contamination level, (2) age and species of the livestock to be fed, (3) willingness to risk toxic effects on livestock, and (4) balancing the value of contaminated feed and risk of livestock poisoning against the cost of non-contaminated feedstuffs (Duncan and Hagler, 1986).
Detoxification procedures. Several detoxification procedures are presently being studied. While these procedures are promising, they are not to be recommended at this time. Roasting may reduce aflatoxins, but may char corn kernels and affect feeding value. Detoxification procedures involving aqueous and anhydrous ammonia are being developed. Since the toxicity of breakdown products of aflatoxins has not been determined, the use of detoxification procedures has not been approved by the Food and Drug Administration to date; however, the agency is evaluating new data which may influence a change in detoxification regulations. Aqueous ammonia procedures, which should be carried out under controlled conditions, are corrosive and expensive. Procedures involving anhydrous ammonia are less costly, but may be hazardous because of toxic fumes and the danger of explosions. In addition, detoxified corn must be thoroughly aerated in order to prevent feed refusal or reduced feed intake due to residual ammonia. Farmers are advised to obtain more details from their local Extension office before initiating this procedure (Duncan and Hagler, 1986).
B. Culturing Information:
-
Czapek dox agar
(Website 13):
-
Description:
-
Medium:
-
Maximum germination occurred at 35C in glucose plus NH(4)Cl medium, while in glucose plus peptone medium maximum germination occurred at 30C and 35C (Pass et al., 1971).
A broad pH optimum range (range from 3.0 to 7.5) was found for conidilal gemination using both citrate-phosphate and phosphate buffers containing glucose plus peptone. In glucose plus NH(4)Cl a somewhat narrower pH optimum range, was observed (Pass et al., 1971).
-
Optimal Temperature:
35C (Pass et al., 1971)
-
Upper Temperature:
40C (Pass et al., 1971)
-
Lower Temperature:
10C (Pass et al., 1971)
-
Optimal pH:
5.5 (citrate-phosphate buffer) and 5.7 (phosphate buffer) (Pass et al., 1971).
-
Upper pH:
7.0 (citrate-phosphate buffer) and 8 (phosphate buffer) (Pass et al., 1971).
-
Lower pH:
3.0 (citrate-phosphate buffer) and 5.7 (phosphate buffer) (Pass et al., 1971).
-
Note:
Incubation was carried out in five replicate flasks at 18, 24, 32, and 40 C, both in complete darkness and in normal, diffused laboratory light (with overnight illumination). At the end of an 8-day incubation period, the pH of the liquid was determined (Jofee and Lisker, 1969).
Negligible yields of aflatoxin were obtained at 18 and 40 C. The highest amounts of this substance by far were synthesized by our isolate at 24 C. The effect of light however, was most striking. The data show that light was deleterious to the aflatoxin formation, since in the complete absence of light a five-fold increase of the toxin (from 35,000 to 178,000 pg/g) as noted at 24 C and an initial pH of 4.0 (Jofee and Lisker, 1969).
Using several buffer systems, Cotty showed an inverse correlaton between the amount of aflatoxin produced and the pH, in pHs ranging from 2.7 to 6.3. He also reported that the acidification of nitrate medium with HCl resulted is some alleviation of nitrate inhibition of aflatoxin formation. A pH effect was also observed for sclerotial formation. Sclerotial production by A. flavus was profuse on nitrate and buffered ammonium medium but did not occur on unbuffered ammonium medium. It is interesting that sclerotia formation and aflatoxin formation are inversely affected by nitrogen and pH. Both aflatoxin biosynthesis and sclerotia formation are thought to be developmentally regulated, and sclerotia contain high concentrations of aflatoxin. Cotty argues that sclerotial maturation is associated with the cessation of aflatoxin biosynthesis. This suggests that aflatoxin is mobilized from undifferentiated mycelium to nascent sclerotia, or that aflatoxin production occurs in sclerotia but differs temporally from aflatoxin production in the mycelium (Cotty, 1988).
-
Picture(s):
-
Culture of A. flavus (Website 13):
Description:
On Czapek dox agar, colonies are granular, flat, often with radial grooves, yellow at first but quickly becoming bright to dark yellow-green with age (Website 13).
C. Diagnostic Tests
:
-
Organism Detection Tests:
-
Light microscopy (Smart et al., 1990):
-
Time to Perform:
unknown
-
Description:
They follow the growth of A. flavus hyphae the wound-inoculation site to the adjacent, unwounded spikelets by using light microscopy of sectioned tissues (Smart et al., 1990).
-
Fluorescence:
-
Time to Perform:
unknown
-
Description:
Under certain conditions Aspergillus flavus can infect plants and produce aflatoxin, one of the most highly carcinogenic natural substances known. An ongoing project seeks to reduce aflatoxin contamination of peanut (Arachis hypogae L.). This paper describes new research tools, which have been developed to reach this goal. A minirhizotron system was used to study root growth and drought resistance in relation to aflatoxin resistance. The minirhizotron was combined with a microvideo camera, which has an ultraviolet light source to observe A. flavus infection using a strain of A. flavus that produces a green fluorescent protein (GFP). Fluorescence observed on roots, pods, and pegs decreased with time. Less than 5% of roots and pods observed with a minirhizotron fluoresced and less than 1% of pods or seeds cultured after harvest showed colonization by GFP A. flavus. Still, this technology provides an excellent tool for the study of infection pathways and A. flavus population development. To observe fluorescence at higher resolution, peanut was grown in 20-L containers in a growth chamber to which clear acrylic cuvettes filled with soil and inoculated with GFP A. flavus was attached. Although mycelia fluoresced on some pegs, A. flavus populations appeared small and levels of fluorescence were low. In a subsequent experiment using the same pod cuvette culture system, flowering plants was sprayed with A. flavus spores suspended in water. About 14 days after spraying the spore suspension on the flowers, A. flavus mycelia fluoresced on the surface of peanut flowers, but any fluorescence was observed in either excised ovules or in pegs excised before entering soil. Many minirhizotron images taken under ultraviolet illumination have little visible fluorescence. In order to quantify fluorescence and to detect fluorescence in images having weak fluorescence, software was developed, QuaCos, to analyze the red-green-blue color values of pixels in digital images. These tools, applied in combination, offer great potential to improve the understanding of how A. flavus attacks peanut, and how varieties and management methods might be developed to reduce risk of aflatoxin contamination (Ingram et al., 2003).
-
Immunoassay Tests:
-
ELISA:
-
Time to Perform:
unknown
-
Description:
Two anti-Aspergillus murine monoclonal antibodies (MAbs), designated 164G and 611F, have been produced; both specifically recognize cytoplasmic antigens of A. fumigatus, A. flavus, and A. niger by enzyme-linked immunosorbent assay (Fenelon et al., 1999).
-
False Positive:
The positive predictive value was almost 93%. False-positive reactions occurred at a rate of nearly 8%, although this figure might have been overestimated (Maertens et al., 1999).
-
False Negative:
The negative predictive value was 95%, and the efficacy was 94% (Maertens et al., 1999).
-
Nucleic Acid Detection Tests:
:
-
Polymerase Chain Reaction:
-
Time to Perform:
unknown
-
Description:
It is concluded that genes involved in the aflatoxin biosynthetic pathway may form the basis for an accurate, sensitive, and specific detection system, using PCR, for aflatoxigenic strains in grains and foods (Shapira et al., 1996).
-
Primers:
-
VER-496, VER-1391
-
APA 450, APA 1482
-
OMT-208,OMT-1232
-
Reverse Transcriptase Polymerase Chain Reaction:
-
Time to Perform:
unknown
-
Description:
A real-time reverse transcription-PCR system has been used to monitor the expression of an aflatoxin biosynthetic gene of Aspergillus flavus in wheat (Mayer et al. 2003).
-
Primers:
-
nortaq-1, nortaq-2
-
-
Forward:
bentaq1, 5- CTTGTTGACCAGGTTGTCGAT -3 (Mayer et al. 2003)
-
Reverse:
bentaq2, 5- GTCGCAGCCCTCAGCCT -3 (Mayer et al. 2003)
-
Product
-
Name: tubulin gene (benA56)
-
Size: 989
-
Product GenBank Accession Number:
AF036801
-
Other Types of Diagnostic Tests:
-
Aflatoxin detection:
-
Time to Perform:
unknown
-
Description:
Detection of aflatoxins in corn lots is necessary for regulatory agencies, producers, and the grain buyers for obvious reasons. The detection of aflatoxins is not exact and there are opportunities for error in all of the steps involved. Perhaps the greatest chance for error is in the sampling process, either in the field or from truckload lots. The data obtained in this area indicate that at least a 10 lb. sample should be obtained from the area to be sampled, and the sample should be as representative of the total lot as possible. Once the main sample has been obtained, a sub-sample must be obtained. This is probably the second greatest source of error. The final analysis for aflatoxin is done on a 50 to 100 gr. sample, which again must be representative of the larger sample. The sub-sampling error can be reduced if the total sample is ground before the sub-sample is obtained. However, in many laboratories neither time nor equipment is available to grind the entire 10 lb. sample. Thus, a sub-sample of the intact kernels is taken before grinding. Although there is a chance for error in the analytical process, this is the most accurate step in the detection procedure. There are several ways of detecting aflatoxin once the sub-sample has been obtained. Detection methods range from procedures as simple as visual observation of the toxin-producing fungi to complicated chemical analyses of the toxins themselves (Duncan and Hagler, 1986).
-
Ultraviolet light:
-
Time to Perform:
unknown
-
Description:
This is the so-called black light method and is used by several buying stations. An ultraviolet light of 365 nm is normally used. However, it is not a reliable method of detecting aflatoxin since the compound that produces the bright, greenish-yellow fluorescence is kojic acid and not aflatoxin. It may be used as a presumptive screening method, but not as an analytical method since fluorescence may occur without aflatoxin being present (Duncan and Hagler, 1986).
-
Minicolumn method.:
-
Time to Perform:
unknown
-
Description:
Minicolumn method. Velasco devised a minicolumn method employing florisil for rapid screening of aflatoxin B1. This procedure has been modified and is used by several buying stations to determine whether or not to purchase a lot of corn. Elevators frequently use this method to follow up on black light positive samples, particularly during years when aflatoxin problems are common. The method can detect B1 as low as 5 PPB in cottonseed products, but cannot be used analytically because it lacks resolution, and more importantly, because it does not definitely identify B1. Normally, a sample is called positive for B1 if an aflatoxin-like fluorescing material is found absorbed to the florisil layer of the column. Generally, an unknown sample is compared to one or more known aflatoxin positive samples (usually at 20 and 100 PPB) (Duncan and Hagler, 1986).
-
Fluorometric-iodine method.:
-
Time to Perform:
unknown
-
Description:
Fluorometric-iodine method. Davis and Diener developed a method for detecting aflatoxins in which iodine is used to convert aflatoxin B1 into a more intensely fluorescent derivative which is then quantitated using a comparatively simple photo-fluorometer and filter combination. The instrument is adjusted to read directly in micrograms per kilogram (PPB) of aflatoxin. This method also has the advantage of using less solvents, which makes it much safer for the operator (Duncan and Hagler, 1986).
-
Thin layer chromatography:
-
Time to Perform:
unknown
-
Description:
This method is approved by the Association of Official Analytical Chemists and is referred to commonly as the CB method. In this method, the aflatoxins are extracted from corn using solvents concentrated and spotted on chromatograms. The presence of spots on thin layer chromatograms with RF values similar to or identical with those of aflatoxins B1, B2, G1, or G2 is a tentative identification. To confirm the presence of aflatoxins, the suspect spot is reacted with trifluoroacetic acid or glacial acetic acid, and developing the reaction products in a new solvent system and comparing with known standards. This method is used by several laboratories, but is not used by buying stations (Duncan and Hagler, 1986).
-
High performance liquid chromatography:
-
Time to Perform:
unknown
-
Description:
This is a relatively new method of detecting aflatoxins and is very reliable. Again, it is used by several research laboratories, but not by buying stations. A recently developed HPLC procedure is more rapid, more sensitive, and more precise than the TLC procedure at high toxin levels (Duncan and Hagler, 1986).
-
Biosensors:
-
Time to Perform:
unknown
-
Description:
Recently substantial progress has been made in the application of new technologies to the monitoring of aflatoxins. In particular, several research groups have developed biosensors for detection of the toxins as well as presumptive tests for fungal infection. Biosensors have been developed in a variety of formats including surface plasmon resonance, fiber optic probes, and microbead-based assays. The sensitivity and selectivity of the biosensors and of the presumptive tests has reached the level where the application of these techniques to the screening of foods warrants further investigation (Maragos, 2002).
-
Mass Spectrometry:
-
Time to Perform:
unknown
-
Description:
There is no more definitive confirmation of the aflatoxins than mass spectroscopy because this method is a direct molecular characterization of the molecule. However, this method is used by only a few research laboratories (Duncan and Hagler, 1986).
V. References
A. Journal References:
Bankhole and Adebanjo, 2003:
Bankhole SA,
Adebanjo A. Mycotoxins in food in West Africa: current situation and possibilities of controlling it.
African Journal of Biotechnology.
2003;
2(9):
254 -
263.
[PubMed:
].
Bennett and Klich, 2004:
Bennett JW.,
Klich M. Mycotoxins.
Clin Microbiol Rev.
2003;
16(3):
497 -
516.
[PubMed:
12857779].
Buckingham and Hansell, 2003:
Buckingham SJ,
Hansell DM Aspergillus in the lung: diverse and coincident forms.
Eur Radiol.
2003;
13(8):
1786 -
1800.
[PubMed:
12571042].
Cotty, 1988:
Cotty P. Aflatoxin and sclerotial production by Aspergillus flavus: influence of pH.
Phytopathology .
1988.;
78:
1250 -
1253.
[PubMed:
NA].
del Palacio et al., 2003 :
delPalacio A,
Cuetara MS,
Ponton J. Laboratory diagnosis of invasive aspergillosis.
Rev Iberoam Micol.
2003;
20(3):
90 -
98.
[PubMed:
15456364].
Diener et al., 1987:
Diener UL,
Cole RJ,
Sanders TH, Payne GA, Lee SL, Klich ML. Epidemiology of aflatoxin formation by Aspergillus flavus.
Ann. Rev. Phytopathol. .
1987;
25:
249 -
270.
[PubMed:
].
Duncan and Hagler, 1986:
Duncan HE,
Hagler, WM. Aflatoxins and Other Mycotoxins.
NCH-52 PEST MANAGEMENT-North Carolina State University.
1986;
:
1 -
111.
[PubMed:
NA].
Egami et al., 2003:
Egami T,
Noguchi M,
Ueda S Mycosis in the ear, nose and throat.
Nippon Ishinkin Gakkai Zasshi.
2003;
44(4):
277 -
283.
[PubMed:
14615794].
Ehrlich and Cotty, 2004:
Ehrlich KC,
Cotty PJ Variability in Nitrogen Regulation of Aflatoxin Production by Aspergillus Flavus Strains.
Applied And Environmental Microbiology.
2002;
60(1-2):
174 -
178.
[PubMed:
12382060].
Fenelon et al., 1999:
Fenelon LE,
Hamilton AJ,
Figueroa JI, Bartholomew MA, Allen MH, McCarthy P, Hay RJ. Production of Specific Monoclonal Antibodies to Aspergillus Species and Their Use in Immunohistochemical Identification of Aspergillosis.
Journal of Clinical Microbiology.
1999;
37(4):
1221 -
1223.
[PubMed:
1670319].
Griffin, 1970:
Griffin GJ Conidial germination and population of Aspergillus flavus in the geocarposphere of peanuts.
Phytopathology .
1970;
60:
1293 -
1293.
[PubMed:
].
Hetherington et al., 1994:
JJ Monoclonal antibodies against a 97-kilodalton antigen from Aspergillus flavus.
Clin Diagn Lab Immunol.
1994;
1(1):
63 -
67.
[PubMed:
7496924].
Horn et al., 1996:
Horn BW,
Greene RL,
Sobolev VS, Dorner J W, Powell J H, Layton R C Association of morphology and mycotoxin production with vegetative compatibility groups in Aspergillus flavus, A. parasiticus, and A. tamarii.
Mycologia.
1996.;
88(4):
574 -
587.
[PubMed:
NA].
Ingram et al., 2003:
Ingram KT,
Ahohuendo BC,
Diarra B, Hoogenboom G.
Aspergillus flavus infection and aflatoxin contamination of peanut. New tools for research on aspergillus flavus infection and aflatoxin contamination of peanut.
Annales des Sciences Agronomiques du Benin.
2003;
4(2):
-
.
[PubMed:
NA].
Jofee and Lisker, 1969:
Joffe AZ,
Lisker N. Effects of Light, Temperature, and pH Value Aflatoxin Production In Vitro.
Applied Microbiology.
1969;
18(5):
517 -
518.
[PubMed:
NA].
Jones et al., 1980:
Jones RK,
Duncan HE,
Payne GA, Leonard KJ. Factors influencing infection by Aspergillus flavus in silk-inoculated corn.
Plant Disease.
1980;
64:
859 -
863.
[PubMed:
].
Jones et al., 1981:
Jones RK,
Duncan HE,
Payne GA, Leonard KJ. Factors influencing infection by Aspergillus flavus in silk-inoculated corn.
Plant Disease.
1980;
64:
859 -
863.
[PubMed:
].
Kalayanamitr et al., 1987:
Kalayanamitr A,
Bhumiratana A,
Flegel TW. Occurrence of Toxicity among Protease, Amylase, and Color Mutants of a Nontoxic Soy Sauce Koji Mold.
Appl Environ Microbiol.
1987;
53(8):
1980 -
1982.
[PubMed:
2444160].
Klich et al., 1986:
Klich MA,
Lee LS,
Huizar HE. The occurrence of Aspergillus flavus in vegetative tissue of cotton plants and its relation to seed infection.
Mycopathologia .
1986;
95(3):
171 -
174.
[PubMed:
3095645].
Krishnamachari et al., 1977 :
Krishnamachari KA,
Bhat VR,
Nagarajan V,
Tilak TB, Tulpule PG. The problem of aflatoxic human disease in parts of India-epidemiological and ecological aspects.
Ann Nutr Aliment.
1977;
31((4-6)):
991 -
996.
[PubMed:
566071].
Kumar et al., 2004:
Kumar V,
Singh GP,
Babu AM. Surface ultrastructural studies on the germination, penetration and conidial development of Aspergillus flavus Link:Fries infecting silkworm, Bombyx mori Linn.
Mycopathologia.
2004;
157(1):
127 -
135.
[PubMed:
15008355].
Lancaster et al., 1961:
Lancaster MD,
Jenkins FD,
Phillips JM Toxicity associated with certain samples of groundnuts.
Nature.
1961;
192:
1095 -
1096.
[PubMed:
].
Liggett et al., 1986:
Liggett AD,
Colvin BM,
Beaver RW, Wilson DM. Canine aflatoxicosis: a continuing problem.
Vet. Hum.Toxicol. .
1986;
5:
428 -
430.
[PubMed:
3776087].
Lillehoj et al., 1974:
Lillehoj EB,
Garcia WJ,
Lambrow M. Aspergillus flavus Infection and Aflatoxin Production in Corn: Influence of Trace Elements.
Applird Microbiology.
1974;
28(5):
763 -
767.
[PubMed:
4216287].
Lopez-Medrano, 2002:
Lopez-Medrano R. Invasive aspergillosis in Castilla y Leon and Cantabria: years 1998 and 1999.
Rev Iberoam Micol.
2002;
18(2):
70 -
75.
[PubMed:
15487910].
Lumbreras and Gavalda, 2003:
Lumbreras C,
Gavalda J. Invasive aspergillosis: clinical manifestations and treatment.
Rev Iberoam Micol.
2003;
20(3):
79 -
89.
[PubMed:
15456363].
Maertens et al., 1999:
Maertens J,
Verhaegen J,
Demuynck H, Brock P, Verhoef G, Vandenberghe P, Van Eldere J, Verbist L, Boogaerts M. Autopsy-Controlled Prospective Evaluation of Serial Screening for Circulating Galactomannan by a Sandwich Enzyme-Linked Immunosorbent Assay for Hematological Patients at Risk for Invasive Aspergillosis.
Journal of Clinical Microbiology.
1999;
37(10):
3223 -
3228.
[PubMed:
10488181].
Maragos, 2002:
Maragos CM. Novel assays and sensor platforms for the detection of aflatoxins.
Adv Exp Med Biol.
2002;
504(1):
85 -
93.
[PubMed:
11922101].
Marsh and Payne, 1984:
Marsh S,
Payne GA Scanning EM studies on the colonization of dent corn by Aspergillus flavus.
Phytopathology.
1984;
74(5):
557 -
561.
[PubMed:
].
Mayer et al. 2003:
Mayer Z,
Frber P,
Geisen R. Monitoring the Production of Aflatoxin B1 in Wheat by Measuring the Concentration of nor-1 mRNA.
Applied and Environmental Microbiology.
2003;
69(2):
1154 -
1158.
[PubMed:
12571042].
Mellon and Cotty, 2004:
Mellon JE,
Cotty PJ. Expression of pectinase activity among Aspergillus flavus isolates from southwestern United States.
Mycopathologia.
2004;
157:
333 -
338.
[PubMed:
].
Moreno and Kang, 1999:
Moreno OJ,
Kang MS Aflatoxin in maize: The problem and genetic solutions.
Plant Breeding .
1999;
118:
-
.
[PubMed:
].
Munkvold, 2003:
Munkvold G. Cultural and genetic approaches managing mycotoxins in maize.
Annu. Rev. Phytopathol.
2003;
41:
99 -
116.
[PubMed:
15008355].
Myoken et al., 2003:
Myoken Y,
Sugata T,
Fujita Y, Kyo T, Fujihara M, Kohara T, Katsu M, Mikami Y. Molecular epidemiology of invasive stomatitis due to Aspergillus flavus in patients with acute leukemia.
Journal of Oral Pathology and Medicine .
2003;
32(4):
215 -
.
[PubMed:
12653860].
Payne, 1992:
Payne GA Aflatoxin in maize.
Crit. Rev. Plant Sci.
1992;
10(5):
423 -
440.
[PubMed:
].
Payne and Brown, 1998:
Payne GA,
Brown MP Genetics and Physiology of aflatoxin biosynthesis.
Ann. Rev. of Phytopath.
1998;
36:
329 -
362.
[PubMed:
].
Phillips, 1999:
Phillips TD .
Dietary clay in the chemoprevention of aflatoxin-induced disease.
1999;
52Sup:
118 -
126.
[PubMed:
].
Scheidegger and Payne, 2003:
Scheidegger KA,
Payne GA. Unlocking the Secrets Behind Secondary Metabolism: A Review of Aspergillus flavus from Pathogenicity to Functional Genomics.
Journal of Toxicology.
2003;
22(2 and 3):
423 -
459.
[PubMed:
].
Shapira et al., 1996:
Paster N,
Eyal O,
Menasherov M, Mett A, Salomon R. Detection of Aflatoxigenic Molds in Grains by PCR.
Applied and environmental microbilology.
1996;
62(9):
3270 -
3273.
[PubMed:
].
Shibuya et al., 2004:
Shibuya K,
Hasegawa C,
Hamatani S, Hatori T, NagayamaT, Nonaka H. Pathophysiology of pulmonary aspergillosis.
J Infect Chemother.
2004;
10:
138 -
145.
[PubMed:
15290452].
Smart et al., 1990:
Smart MG,
Wicklow DT,
Caldwell RW. Pathogenesis in Aspergillus Ear rot of maize:Light microscopy of fungal spread from wounds.
Phytopathology.
1990;
80(12):
1287 -
1294.
[PubMed:
].
Soubani et al., 2002:
Soubani AO,
Chandrasekar PH. The clinical spectrum of pulmonary aspergillosis.
Chest.
2002;
121(6):
1988 -
1999.
[PubMed:
12065367].
St. Leger et al., 2000:
St. Leger RJ,
Screen SE ,
Shams-Pirzadeh B. Lack of Host Specialization in Aspergillus flavus.
Applied and Environmental Microbiology .
2000;
66(1):
320 -
324.
[PubMed:
].
Stone, 2002:
Stone R. Peering Into the Shadows: Iraqs Bioweapons Program.
Science.
2002;
297(5584):
1110 -
1112.
[PubMed:
12183606].
Stynen et al., 1995:
Stynen D,
Goris A,
Sarfati J, Latge, JP. A new sensitive sandwich enzyme-linked immunosorbent assay to detect galactofuran in patients with invasive aspergillosis.
J Clin Microbiol.
1995;
33(2):
497 -
500.
[PubMed:
7714217].
Takahashi et al.:
Takahashi H,
Kamimura H,
Ichinoe M. Distribution of aflatoxin-producing Aspergillus flavus and Aspergillus parasiticus in sugarcane fields in the southernmost islands of Japan.
J Food Prot.
2004;
67(1):
90 -
95.
[PubMed:
NA].
Taubenhaus, 1920:
Taubenhaus JJ A study of the black and the yellow molds of ear corn.
Texas Agricultural Experimental Station Bulletin . .
1920;
270:
3 -
38.
[PubMed:
].
Vandecasteele al., 2002:
Vandecasteele SJ,
Boelaert JR,
Verrelst P , Graulus E, Gordts BZ. Diagnosis and treatment of Aspergillus flavus sternal wound infections after cardiac surgery.
Clin Infect Dis.
2002;
35(7):
887 -
890.
[PubMed:
12228828].
van Halderen et al., 2000:
van Halderen A,
Green JR,
Marasas WF, Thiel PG, Stockenstrom S. A field outbreak of chronic aflatoxicosis in dairy calves in the western Cape Province.
J S Afr Vet Assoc.
1989;
60(4):
210 -
211.
[PubMed:
2518661].
Vesonder et al., 1991:
Vesonder R,
Haliburton J,
Stubblefield R, Gilmore W, Peterson S. Aspergillus flavus and aflatoxins B1, B2, and M1 in corn associated with equine death.
Arch Environ Contam Toxicol.
1991;
20(1):
151 -
153.
[PubMed:
1670319].
Wark, 2004:
Wark P. Pathogenesis of allergic bronchopulmonary aspergillosis and an evidence-based review of azoles in treatment.
Respir Med.
2004;
98(10):
915 -
923.
[PubMed:
15481266].
Wicklow et al., 1993:
Wicklow DT,
Wilson DM,
Nelsen TC. Survival of Aspergillus flavus sclerotia and conidia buried in soil in Illinois or Georgia.
Phytopathology.
1993;
83(11):
1141 -
1147.
[PubMed:
].
Williams et al., 2004:
Williams JH,
Phillips TD.,
Jolly PE, Stiles JK, Jolly CM, Aggarwal D. Human aflatoxicosis in developing countries: a review of toxicology, exposure, potential health consequences, and interventions.
Am J Clin Nutr.
2004;
80(5):
1106 -
1122.
[PubMed:
15531656].
Williams et al., 2004:
Williams WP,
Windham GL,
Buckley PM, Perkins JM. Southwestern corn borer damage and aflatoxin accumulation in conventional and transgenic corn hybrids next term.
Agronomy Journal.
2004;
NS(NS):
-
.
[PubMed:
].
Yu et al., 2002:
Yu J,
Chang PK,
Cary JW, Wright M, Bhatnagar D, Cleveland TE, Payne GA and Linz JE. Comparative mapping of aflatoxin pathway gene clusters in Aspergillus parasiticus and Aspergillus flavus.
Appl. Environ. Microbiol.
1995;
61(6):
2365 -
2371.
[PubMed:
7793957].
Yu et al., 2004:
Yu J,
Whitelaw CA,
Nierman Nierman WC, Bhatnagar D, Cleveland TE Aspergillus flavus expressed sequence tags for identification of genes with putative roles in aflatoxin contamination of crops.
FEMS Microbiol Lett.
2004;
237(2):
333 -
340.
[PubMed:
15321681].
Yu et al., 2004:
Yu J,
Ehrlich KC,
Cary JW, Bhatnagar D, Cleveland TE., Payne GA, Linz JE, Woloshuk CP, Bennett JW
Clustered pathway genes in aflatoxin biosynthesis. Contamination of crops.
Appl Environ Microbiol.
2004;
70:
1253 -
1262.
[PubMed:
15006741].
B. Book References:
Alexopoulos et al., 1996:
Alexopoulos CJ,
Mims CW,
Blackwel MI. -
.
In: Alexopoulos CJ. Introductory Mycology.1996.
John Wiley and Sons, Inc,
New York.
Bhat, 1989:
Bhat RV Risk to human health associated with consumpption of groundnuts contaminated with aflatoxins.
19 -
29.
In: McDonald D,
Mehan VK Aflatoxin contamination of groundnuts.1989.
ICRISAT,
Patancheru, A.P. 502 324, India.
Bhatnagar et al., 2000:
Bhatnagar D,
Cleveland TE.,
Payne GA. .
72 -
79.
In: Robinson RK. Encyclopedia of Food Microbiology.2000.
Academic Press,
London.
Langford, 2004:
Langford RE. Bioweapon diseases and medical treatments.
153 -
155.
In: Introduction to weapons of mass destruction: radiological, chemical, and biological.2004.
Wiley-Interscience,
Hoboken, N.J., USA.
Munkvold et al., 1999:
Munkvold G,
Hurburgh C,
Meyer J. Aflatoxins in corn.
-
.
In: Pest Management 1800.1999.
Cooperative Extension service ,
Iowa State University, Ames, IA, USA.
Reed and Kasali, 1989:
Reed JD,
Kasalis OB. Hazard to livestock of consuming aflatoxin-contaminated groundnut meal in Africa.
31 -
36.
In: McDonald D,
Mehan VK. Aflatoxin contamination of groundnuts.1989.
ICRISAT,
Patancheru, A.P. 502 324, India.
Sui-Sheng, 2004:
Sui-Sheng SH. Field assesment of an effective yeast strain to control aflatoxin-producing fungus, Aspergillus flavus.
154 -
157.
In: Proceedings Addendum-California Conference on Biological Control IV. 2004.
University of California,
Berkeley, California.
Task Force Report, 2003:
Mycotoxicoses in animals.
58 -
85.
In: Mycotoxins: Risks in Plants, Animals, and Human Systems.2003.
Council for Agricultural Science and Technology,
Ames, Iowa, USA.
C. Website References:
Website 1:
Aspergillus flavus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=5059&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 2:
Aflatoxin Control Through Targeting Mechanisms Governing Aflatoxin Biosynthesis in Crops [
http://www.ncbi.ars.usda.gov/research/publications/Publications.htm
?mode=Info&id=5059&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 3:
Fungal Genome Initiative [
http://www.broad.mit.edu/annotation/fungi/fgi/FGI_01_whitepaper_2002.pdf
].
Website 4:
Arachis hypogaea [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3818
].
Website 5:
Gossypium hirsutum [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3635
].
Website 6:
Pistacia vera [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=55513
].
Website 7:
Saccharum officinarum [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=4547
].
Website 8:
Vertebrate [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=7742&lvl=3&li=f&keep;=1&srchmode;=1&unlock;
].
Website 9:
Cow [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9913
].
Website 10:
Yellow mould - Aspergillus flavus [
http://www.rbgsyd.gov.au/conservation_research/pland_pathology_research/Soilborne_plant_diseases/Vietnam_template3/Aspergillus
].
Website 11:
Hexapoda [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=6960&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 13:
Mycology online [
http://www.mycology.adelaide.edu.au/Fungal_Descriptions/Hyphomycetes_(hyaline)/Aspergillus/flavus.html
].
Website 14:
Bombyx mori [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=7091
].
Website 15:
Aspergillus flavus var. columnaris [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=41123&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 16:
Aspergillus sp. L [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=187393&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 17:
Aspergillus sp. S [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=187381&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 18:
Aspergillus sp. S(B) [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=187392&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 19:
Aspergillus sp. S(BG) [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=187380&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 28:
Scout and guide hut [
http://umlsks.nlm.nih.gov/kss/servlet/Turbine/action/DoNextSearch/cui/C0562983/release/2004AC/template/meta,concept,ResultScreen.vm/definition/definition/synonyms/synonyms/sab/ALL/lat/;jsessionid=58D1B6664AB54D5B3FFDBF05DB82F57D.kss2
].
Website 29:
Canis familiaris [
http://umlsks.nlm.nih.gov/kss/servlet/Turbine/action/DoNextSearch/cui/C0012984/release/2004AC/template/meta,concept,ResultScreen.vm/definition/definition/synonyms/synonyms/sab/ALL/lat/;jsessionid=393096D04DC86E8C0F488206D6779B5E.kss1
].
Website 30:
Oncorhynchus mykiss [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=8022
].
Website 32:
Aspergillosis [
http://umlsks.nlm.nih.gov/kss/servlet/Turbine/action/DoSelectedSearch;jsessionid=962512886B000D27D50661DD866B0DBE.kss1
].
Website 33:
Biological regulation [
http://umlsks.nlm.nih.gov/kss/servlet/Turbine/action/DoSelectedSearch;jsessionid=58D1B6664AB54D5B3FFDBF05DB82F57D.kss2
].
Website 34:
Antifungal drugs [
http://umlsks.nlm.nih.gov/kss/servlet/Turbine/action/DoNextSearch/cui/C0003308/release/2004AC/template/meta,concept,ResultScreen.vm/definition/definition/synonyms/synonyms/sab/ALL/lat/;jsessionid=57BE79BADCA3284F4AF4AC68FC4FB853.kss2
].
Website 37:
Anas [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=8835&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 38:
Gallus gallus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9031&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 39:
Sus scrofa [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9823&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 40:
A Focus On Aflatoxin Contamination [
http://www.nal.usda.gov/fsrio/research/fsheets/fsheet01.htm
].
Website 41:
Aspergillus flavus Link SRRC 1304 [
www.iums.org/ ICPAAspflav.htm
].
Website 42:
Aspergillus [
http://www.aspergillus.man.ac.uk/indexhome.htm?homepagenew/siteupdate.htm~main
].
Website 44:
Plant [
http://umlsks.nlm.nih.gov/kss/servlet/Turbine/action/DoNextSearch/cui/C0032098/release/2004AC/template/meta,concept,ResultScreen.vm/definition/definition/synonyms/synonyms/sab/ALL/lat/;jsessionid=C24D25ABBD72293D9FB6AF0A9417CA06.kss2
].
Website 50:
Gesellschaft f?r Mykotoxinforschung [
http://www.mykotoxin.de/Startseite.htm
].
Website 51:
Zea mays [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id;=4577&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 52:
Fungal infection [
http://umlsks.nlm.nih.gov/kss/servlet/Turbine/action/DoSelectedSearch;jsessionid=6646B3B2F75FBE57ADA03685ABAE70F1.kss2
].
Website 53:
Dioscorea alata [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=55571
].
Website 54:
Homo sapiens [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9606&lvl=3&li=f&keep;=1&srchmode;=1&unlock;
].
Website 55:
Equus caballus [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9796
].
Website 56:
Corn ear molds and mycotoxins [
http://www.ipm.iastate.edu/ipm/icm/2002/10-21-2002/molds.html
].
Website 57:
Molds in Fish Feeds and Aflatoxicosis [
http://edis.ifas.ufl.edu/pdffiles/FA/FA09500.pdf
].
Website 58:
Aspergillosis [
http://health.allrefer.com/health/aspergillosis-info.html
].
Website 59:
Aspergilloma [
http://health.allrefer.com/health/aspergillosis-aspergilloma.html
].
Website 60:
Aspergillosis [
http://www.nlm.nih.gov/medlineplus/ency/article/001326.htm
].
Website 62:
Aflatoxin in Aspergillus flavus: can peanuts give you cancer? [
http://www.coe.uga.edu/ctl/portfolios/artsci/peanuts_cancer.pdf
].
Website 64:
Aspergillosis [
http://www.doctorfungus.org/mycoses/images/aspergillus-flavus.jpg
].
Website 65:
Food Safety [
http://www.nri.org/images/foodsafety1.jpg
].
Website 66:
Aflatoxin [
http://www.aflatoxin.info/health.asp
].
Website 67:
Stock Photography [
http://www.denniskunkel.com/index.asp
].
Website 68:
Juglans nigra [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id;=16719&lvl;=3&lin;=f&keep;=1&srchmode;=1&unlock;
].
Website 69:
Carya illinoinensis [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi
].
Website 70:
Zea mays [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id;=4577&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
Website 71:
Meleagris gallopavo [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9103&lvl=3&lin=f&keep=1&srchmode=1&unlock
].
D. Thesis References:
Pass et al., 1971:
Pass Ted; .
Studies on the physiology of conidial germination by Aspergillus flavus.
1971.
PH. D.
Virginia Polytechnic Institute and State University.
Blacksburg, VA.
VI. Curation Information
-
Curators:
Graciela Santopietro (, graciela@vbi.vt.edu. Tel: (540) 231-3053)
-
Date: 5/25/05
-
Version:
-
Note:
-
Revision:
-
Curators:
Bryan Lewis (, blewis@vbi.vt.edu. Tel: );
-
Date:
-
Version:
-
Note:
-
Contact information:
- Email: pathinfo@vbi.vt.edu
- Telephone:
- Address: